ID: 955108270

View in Genome Browser
Species Human (GRCh38)
Location 3:55921770-55921792
Sequence TTCTAGGAATTATGTGCAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955108268_955108270 21 Left 955108268 3:55921726-55921748 CCATATATGGAGAGTATTAATTC 0: 1
1: 0
2: 0
3: 7
4: 138
Right 955108270 3:55921770-55921792 TTCTAGGAATTATGTGCAATTGG 0: 1
1: 0
2: 0
3: 12
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955108270 Original CRISPR TTCTAGGAATTATGTGCAAT TGG Intronic
902065854 1:13685955-13685977 TTTTAGGAATTAGATGGAATAGG + Intergenic
909373659 1:74915722-74915744 TTCTAGGATATATGTGCACAAGG + Intergenic
912329916 1:108810231-108810253 TTCTACCAATGATGTGCACTTGG + Intergenic
913385799 1:118256975-118256997 CTCAAGAAGTTATGTGCAATTGG + Intergenic
914301041 1:146377325-146377347 TTGTAGGATTTCTGTGCTATCGG + Intergenic
915793159 1:158697272-158697294 TTATAGAAATTCTTTGCAATAGG - Intergenic
916023740 1:160816043-160816065 TTTGAGGCATTGTGTGCAATAGG - Intronic
916158067 1:161878019-161878041 TTCAAGGGAATGTGTGCAATTGG + Intronic
917367891 1:174253916-174253938 TTCTAGGGAATCTGTGCTATTGG + Intronic
917545485 1:175962426-175962448 TTCTAGGAGTGATGAACAATAGG - Intronic
918120756 1:181537532-181537554 TTCTAGGAATTTGGTGGAAGGGG + Intronic
918406435 1:184215599-184215621 TTCTAGGAAATGTGTGGAAAAGG - Intergenic
920692983 1:208160775-208160797 ATCTATGAATTATGTGACATAGG - Intronic
922578912 1:226682560-226682582 TGCTAGGAATTAGCTGCACTAGG + Intronic
1063039650 10:2324062-2324084 CCCTAAGAATTATGTGAAATTGG - Intergenic
1069165632 10:65154751-65154773 TTCTAGAAATGATGTGTGATTGG + Intergenic
1069208722 10:65728733-65728755 TACTAGGAAGTATCTGCTATTGG + Intergenic
1069222533 10:65902601-65902623 TTCTAAGAATTATATATAATTGG + Intergenic
1071908319 10:90200238-90200260 TTCTATTAATTTTGTGTAATTGG - Intergenic
1072320059 10:94240607-94240629 TTCAAGGGATTATGTTAAATTGG + Intronic
1072959779 10:99918844-99918866 TGCTAGGATTTATGTGTATTTGG - Intronic
1076198071 10:128534773-128534795 TTTCAGGTATTTTGTGCAATAGG + Intergenic
1077629618 11:3802301-3802323 TTCTGGGAATGATGAGCCATGGG - Intronic
1079491265 11:20991421-20991443 TTGTACCAATTATGTGCAATAGG + Intronic
1079891590 11:26062414-26062436 TTTTATGAATTATGTTTAATTGG + Intergenic
1080528295 11:33149174-33149196 TTTTAGGGATTCTGTGAAATTGG - Intronic
1086302864 11:85447943-85447965 TTCTAGGAATTCTCTGAACTTGG + Intronic
1086780909 11:90904765-90904787 TACAAGAAATTATGGGCAATGGG + Intergenic
1087646662 11:100815867-100815889 TTCTAGATACTATGTGCAAGTGG + Intronic
1087765187 11:102143906-102143928 TTCTGGGAATGATAAGCAATAGG + Intronic
1090677656 11:129016701-129016723 TTCTAAAATTTATGTGAAATGGG - Intronic
1092100111 12:5876138-5876160 TTCTAGGACTTAATTTCAATGGG - Intronic
1093797818 12:23334725-23334747 TTATATAAATTATGAGCAATTGG - Intergenic
1098931763 12:76425022-76425044 TGCTGTGAATTATGTGCAAAAGG - Intronic
1099355407 12:81628887-81628909 CTATAGGCCTTATGTGCAATTGG - Intronic
1104138946 12:125968182-125968204 TTCTAGGAAATATGAACAAATGG - Intergenic
1105357898 13:19676530-19676552 TTCTAGGATTTGTGTGCACTTGG - Intronic
1105794311 13:23834880-23834902 TTCTGGGAATTATGTAGACTTGG - Intronic
1105834979 13:24202234-24202256 TCCTAGGATTTAAGTGCAAAAGG + Intronic
1106962953 13:35022799-35022821 TTCTCAAAATTCTGTGCAATGGG - Intronic
1107153111 13:37134819-37134841 TACAAAGAATTATGTGAAATAGG + Intergenic
1107542046 13:41397951-41397973 TTGTATGAAATATCTGCAATAGG + Intergenic
1108467223 13:50728351-50728373 TAATAGGAGTTATGTGCAAAAGG + Intronic
1109304901 13:60627453-60627475 TGCTAGACATTATGTGCATTTGG - Intergenic
1110229562 13:73154045-73154067 TTCTGGAAAGTGTGTGCAATTGG - Intergenic
1112766583 13:102752126-102752148 GTCTAGGAAGGATGTGCAGTGGG + Intronic
1114173524 14:20298290-20298312 TCCTAGGAATTAAGTGAATTAGG - Intronic
1121136969 14:91508384-91508406 TTCAAGGAATTTTCTTCAATTGG - Intronic
1121203143 14:92137535-92137557 TTCTGGGAAGTATGTAGAATTGG + Intronic
1125497130 15:40207267-40207289 TTTTAGGAATTCTTTGTAATTGG + Intronic
1127860742 15:62992329-62992351 TAAGAGGAATTATGTGAAATGGG - Intergenic
1130571595 15:85050426-85050448 TTTTAGGAATTCTGTGTATTAGG + Intronic
1131399636 15:92114020-92114042 TTCTGGCATTCATGTGCAATTGG - Intronic
1132112010 15:99108425-99108447 TGCTAGGAAGTATGTGAAAGAGG + Intronic
1138042898 16:53693674-53693696 TTCTCGGAATTAGGTGGAAAAGG - Intronic
1143638433 17:8180490-8180512 TTTTAGGAATCAAATGCAATGGG - Intergenic
1143698241 17:8636731-8636753 TTCCAGGAATCATGTTCAAAGGG - Intergenic
1146419214 17:32666729-32666751 TTCTAGTCATTATGGGCATTGGG + Intronic
1149311523 17:55398902-55398924 TTCTAAGAGTTATTTGCAACTGG + Intronic
1149389732 17:56176663-56176685 TTTTAAGACTTATGTGCAAATGG + Intronic
1153909809 18:9696864-9696886 TTTTAGGCATGATGTGCAATGGG + Intergenic
1154983478 18:21524552-21524574 TTCTTGGTATTATTTGCATTAGG - Exonic
1155782210 18:29850614-29850636 TTCTGTGAATTCTGTGCATTGGG + Intergenic
1156104534 18:33642924-33642946 TTGTTGGAATCATGTGCATTAGG + Intronic
1156566252 18:38194740-38194762 TTCTAGAAAATGTGGGCAATAGG + Intergenic
1156764099 18:40630467-40630489 TTCTGGTAATTATGTGTGATAGG - Intergenic
1157121887 18:44918692-44918714 TTCTAGCAATTCTGTGCACTAGG - Intronic
1158439340 18:57460277-57460299 TTTTATAAATTATGTGAAATTGG + Intronic
925259656 2:2518507-2518529 TTCTAGAAATGATGTGCTGTGGG - Intergenic
926499043 2:13629711-13629733 TCATATGAATTATGTGTAATAGG + Intergenic
927329373 2:21843855-21843877 TTCTAGGAATTAAGAGAAAGAGG - Intergenic
933699813 2:85246495-85246517 TTCTAAGAATTAAGTGCAGCTGG + Intronic
940078210 2:149768027-149768049 TTCTAAGAATCATGTTCGATGGG + Intergenic
940709862 2:157148870-157148892 TCCTTGGAATTATGTCCCATGGG - Intergenic
941470778 2:165884259-165884281 TTCTTGGAATTGTGTGCATATGG - Intronic
943783516 2:191850601-191850623 GTCTAGGAATTATGGGCTAGTGG - Intergenic
945457314 2:210064927-210064949 TTCTAGGCAGAATGTGCAAAGGG + Intronic
947469831 2:230390954-230390976 TTCTAGGCATTTTCTGCAAATGG + Intronic
1170779558 20:19412123-19412145 TTCTAGGAATTCAGTGCATTTGG + Intronic
1178309160 21:31515296-31515318 TTTGAGGATTTCTGTGCAATAGG - Intronic
1179125591 21:38587941-38587963 TTCTCTTAAATATGTGCAATGGG + Intronic
1180026592 21:45166900-45166922 TTCTTGGAATTTTGTTCCATAGG + Intronic
1183921269 22:41171002-41171024 TTTTAGGAATTACATGCAAGAGG - Intronic
949432001 3:3986964-3986986 TTGTAGGACACATGTGCAATAGG - Intronic
950763226 3:15253428-15253450 TTCTGGGAATTCTGTTCACTGGG - Intergenic
951365983 3:21783254-21783276 TACAAGGGTTTATGTGCAATGGG + Intronic
952006010 3:28843126-28843148 ATCTAGGAATTTTGTACAAATGG - Intergenic
952128538 3:30332522-30332544 TTCTTGGACTTTTGTGCAAGTGG + Intergenic
954649465 3:52151796-52151818 TGATAGGAATTATGTGGAATCGG - Intronic
955108270 3:55921770-55921792 TTCTAGGAATTATGTGCAATTGG + Intronic
960635133 3:119777524-119777546 TTCTAGGTATTTTATGTAATTGG - Intergenic
962564119 3:136639998-136640020 TTGTAGTAATTATGTGGAAAGGG - Intronic
963153954 3:142076255-142076277 TTCTAGTTGTTATTTGCAATAGG + Intronic
964731818 3:159875505-159875527 TTCTAGGAATTATTTTTCATTGG + Intronic
964862562 3:161218797-161218819 TTCTATCAATTATTTGCTATAGG + Intronic
965655763 3:170982809-170982831 TTATAGTTATTATGTGCAATAGG + Intergenic
967289959 3:187909808-187909830 TTCTACAAATTAAGTGAAATAGG + Intergenic
970322694 4:14890852-14890874 TTCTATGAAATATTTGGAATAGG - Intergenic
975310743 4:72900726-72900748 TTCCAGGAATCATATGCAAAGGG - Intergenic
975893362 4:79055916-79055938 TTCCATGAATTTTGTGCTATTGG + Intergenic
976808660 4:89076163-89076185 TTCTAGGAATTATGGCTAAATGG + Intronic
978017444 4:103762887-103762909 TTTTAGGAATAATGTGGAAATGG - Intergenic
978535576 4:109758557-109758579 TTCTAGTTAATAAGTGCAATAGG + Intronic
979769501 4:124505387-124505409 TTCTAAAAGGTATGTGCAATTGG + Intergenic
980220576 4:129908559-129908581 TTCTGGAAATTATTTGCCATAGG - Intergenic
982345377 4:154351951-154351973 TTCTATGAATTATGTATATTAGG + Intronic
982602955 4:157474825-157474847 TGCTAAGAATTATGTGCATGAGG - Intergenic
983357909 4:166688061-166688083 TACTATAAATTATGTGGAATTGG + Intergenic
984984378 4:185313683-185313705 TTACAGGAATTATGTACAGTTGG + Intronic
985901318 5:2797146-2797168 TTCTTGGAATGATTTGTAATTGG + Intergenic
986113400 5:4743832-4743854 TTATAGGAATTATATGAAATTGG + Intergenic
986201974 5:5587344-5587366 TCCTATGAATTATGCCCAATTGG + Intergenic
989726442 5:44592176-44592198 TTCTAGGTATAATTTGCATTTGG - Intergenic
989951308 5:50300875-50300897 TTCAATGAATTATGAGCAGTTGG + Intergenic
990036650 5:51329614-51329636 TTGGAGGACCTATGTGCAATAGG + Intergenic
990374757 5:55158387-55158409 TACTAGGAATTATGTTTAAAAGG + Intronic
990474832 5:56152282-56152304 TGCTAAGAATTATGTCCAAAAGG + Intronic
991545095 5:67772848-67772870 TTATAGCAATTAGGTGAAATGGG + Intergenic
996043045 5:118838070-118838092 TTATAAGACTTATGTGGAATAGG - Intronic
996118693 5:119647309-119647331 TTCTGGGAACAATGTGAAATAGG + Intergenic
996587821 5:125110659-125110681 CTTGAGGAATTTTGTGCAATGGG - Intergenic
1003811961 6:9794089-9794111 TTGGAGGAATCATATGCAATAGG - Intronic
1004740461 6:18455544-18455566 TTCTAGGAATCATGAGCCCTAGG + Intronic
1005275433 6:24211909-24211931 GTCTAGAAATTATGTGCATGAGG + Intronic
1007533681 6:42565041-42565063 TTCTAGGAGTTAGGGGTAATTGG + Intronic
1008752341 6:54750758-54750780 TTCTAGGATTTATTTCCAAGGGG + Intergenic
1010167080 6:72928329-72928351 ATGTAGGAACTATGTGCAGTTGG + Intronic
1010564082 6:77387074-77387096 TCTAAGGCATTATGTGCAATTGG + Intergenic
1011614519 6:89185673-89185695 TTGCAGGAATTATGTGCATTTGG - Intronic
1014308870 6:119773541-119773563 TATTAGGAATTATGTCCAACTGG - Intergenic
1016795974 6:148117819-148117841 ATCTATTAATTATGTGTAATGGG - Intergenic
1018583069 6:165324540-165324562 TTCTATGACTTATGTGTAATAGG - Intergenic
1020720065 7:11732880-11732902 TTCAAAGAAATATGTGCATTGGG + Intronic
1021960371 7:25865926-25865948 ATTTACGAATTATGTGAAATGGG + Intergenic
1022362947 7:29680561-29680583 TACTAAGTATTATGTACAATTGG - Intergenic
1022698447 7:32733228-32733250 TACTAAGTATTATGTACAATTGG + Intergenic
1023530436 7:41148039-41148061 TTCTAAAAATGATGTGGAATGGG + Intergenic
1024177794 7:46859463-46859485 TTCTAGAAAATATCTGCATTGGG + Intergenic
1027550594 7:79588894-79588916 TTATAGGAAATATGTCCCATTGG - Intergenic
1034853510 7:154518571-154518593 TTATTGGAAGTATGTGAAATGGG + Intronic
1037371213 8:18181290-18181312 TTCTAAGATTTTTTTGCAATTGG + Intronic
1038031066 8:23640516-23640538 TTTTGTGAATTGTGTGCAATAGG + Intergenic
1041931230 8:63288944-63288966 ATCTAAAAATTATTTGCAATTGG - Intergenic
1045876256 8:106984448-106984470 TTCTTGGAATTATTTTTAATTGG + Intergenic
1046817011 8:118596280-118596302 TTCTAGGAACTAGATGCATTAGG + Intronic
1046922313 8:119745142-119745164 TGCTAGAAATTATCAGCAATGGG + Intronic
1047000878 8:120571119-120571141 TTCTGGGCATTATGAACAATGGG - Intronic
1048073658 8:131044757-131044779 TTCTAGTAATTATGTGAATTAGG + Intergenic
1048298983 8:133237814-133237836 TTCCAGGAATTTTGTGTGATTGG - Exonic
1048340007 8:133531141-133531163 TTTTAGAAATAATGTGAAATGGG + Intronic
1049299605 8:141862582-141862604 TTCTAGGAAGTATCTGGAAGGGG - Intergenic
1051759099 9:20440831-20440853 TTCTTGGCTTTTTGTGCAATTGG + Intronic
1051965933 9:22829973-22829995 TTCTAGTTATTATTTTCAATGGG + Intergenic
1052588700 9:30462869-30462891 TTCTTGTAAATATATGCAATGGG + Intergenic
1057120445 9:92568096-92568118 TTCTAGGATACATGTGCACTAGG + Intronic
1058937668 9:109783826-109783848 TTCAAGAAATTATGTGCAAAAGG - Intronic
1186858321 X:13646956-13646978 TTCCAGGGAGGATGTGCAATCGG + Intergenic
1187129303 X:16486641-16486663 TTCTAGGAAATGTCTACAATAGG + Intergenic
1188402846 X:29769096-29769118 TTCTATGAAATATATGGAATGGG - Intronic
1188996002 X:36887036-36887058 TTGTAGGAATTCTGTGCATAGGG + Intergenic
1190450378 X:50573571-50573593 TTCTACGAATTTTGTCAAATGGG + Intergenic
1196311326 X:114169873-114169895 TTCTAGAGATTATGTGAAACTGG - Intergenic
1198408467 X:136340266-136340288 GTCTAGAAATTAATTGCAATGGG - Intronic
1201903284 Y:19064913-19064935 TCCTAAGAATTATGTGGATTGGG - Intergenic