ID: 955110164

View in Genome Browser
Species Human (GRCh38)
Location 3:55941218-55941240
Sequence CAGTTGCGTGTACCTGCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 64}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955110164 Original CRISPR CAGTTGCGTGTACCTGCCAT GGG Intronic
900164398 1:1238991-1239013 CAGTTGTGTGTCCCTGCGACTGG - Intergenic
900710050 1:4107909-4107931 CACTTCTGTGTACCTGCCCTCGG + Intergenic
901192314 1:7419969-7419991 CAGCTGCATGTTTCTGCCATTGG + Intronic
915000565 1:152585535-152585557 CTGGTGCTTGTGCCTGCCATTGG + Intronic
921470888 1:215547811-215547833 CTCTTGCTGGTACCTGCCATTGG + Intergenic
922822444 1:228493671-228493693 CAGTTGCCCGTGCCAGCCATAGG + Intronic
1068134302 10:52936506-52936528 CAGTTGCTTGTTCCTTCCACAGG - Intergenic
1077395985 11:2321546-2321568 CAGCAGCGTGGACCTGCCTTGGG - Intergenic
1078057368 11:8019139-8019161 CAGTCGCGCGTCCCCGCCATTGG + Intergenic
1080367906 11:31598403-31598425 GAGTCTGGTGTACCTGCCATTGG + Intronic
1089280592 11:117371574-117371596 CATTTGCGTGTCCCTGCACTGGG + Intronic
1101600504 12:106205553-106205575 CAGGTGCCTGTCCCTGCCACAGG + Intergenic
1104269109 12:127266423-127266445 CATTTTCATGTACCTGCGATGGG + Intergenic
1110487687 13:76066128-76066150 CAGTTTGGTGTTCCTGCCATAGG + Intergenic
1110638316 13:77791517-77791539 CTGGTGCTTGTGCCTGCCATTGG + Intergenic
1116574665 14:46557641-46557663 CTGGTGTGTGTGCCTGCCATTGG - Intergenic
1122672095 14:103380317-103380339 CAGGTGCTTGAAGCTGCCATCGG + Intergenic
1124177636 15:27441252-27441274 CAGTTTCCTGTACCTGCTGTAGG + Intronic
1126241724 15:46452694-46452716 TAGTTTCTTGTAGCTGCCATTGG + Intergenic
1129183026 15:73888784-73888806 AAGTTGAATGCACCTGCCATGGG - Intronic
1132576504 16:666783-666805 CAGCTGCGTGTACCTGCTTCTGG - Exonic
1140613246 16:76626664-76626686 CAGATTGGTGAACCTGCCATTGG - Intronic
1145822556 17:27850750-27850772 CAGTCATGTGCACCTGCCATAGG + Intronic
1148193458 17:45696705-45696727 CAGGTGAGAGTACCTGGCATAGG - Intergenic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1156404245 18:36769626-36769648 CTGTTCAGTGTATCTGCCATTGG + Intronic
1156886506 18:42141464-42141486 CTGGTGCTTGTGCCTGCCATTGG + Intergenic
1157696038 18:49724469-49724491 CACCTGCCTGTACCTGGCATTGG - Intergenic
1162660229 19:12163142-12163164 CGGTTTCCTGTACCTGCCTTGGG + Exonic
925924178 2:8658819-8658841 CAGATGCGTGTACTGGGCATGGG + Intergenic
930549548 2:52815170-52815192 CTGGTGCTTGTACTTGCCATTGG - Intergenic
931970612 2:67581803-67581825 CTGGTGCCTGTGCCTGCCATTGG + Intergenic
932098453 2:68873746-68873768 CATGTGCGTGTAACTGCCACAGG + Intergenic
934112179 2:88754264-88754286 CAGTTGTGTGTACCTGGCACTGG + Intergenic
935069953 2:99685296-99685318 CAGTTGTATGTACCTGACAATGG - Intronic
941308341 2:163898098-163898120 CTGATGCATGTACTTGCCATTGG + Intergenic
948884214 2:240874880-240874902 CAGCTGTGTGACCCTGCCATGGG - Intronic
1169000532 20:2164678-2164700 GAGTTGCTAGTACCTGCCAAGGG - Intronic
1171257556 20:23701600-23701622 CTGGTGCTTGTACCTGCTATTGG + Intergenic
1171264972 20:23763759-23763781 CTGGTGCTTGTACCTGCTATTGG + Intergenic
1179622611 21:42627177-42627199 AAGTTGTGTATACGTGCCATAGG + Intergenic
949963900 3:9338850-9338872 CAGTAGAGGGTACGTGCCATTGG - Intronic
954374706 3:50188119-50188141 CAGCTGCCTGTGCCTGCCATGGG + Exonic
955110164 3:55941218-55941240 CAGTTGCGTGTACCTGCCATGGG + Intronic
959739075 3:109695232-109695254 CTGGTGCCTGTGCCTGCCATCGG - Intergenic
966076426 3:175940911-175940933 CCGTTGCTTGTACCTACCATTGG + Intergenic
972306140 4:37831903-37831925 CAGTTGGTTACACCTGCCATTGG + Intronic
977388141 4:96371364-96371386 CTGGTGCTTGCACCTGCCATAGG - Intergenic
999111118 5:149122098-149122120 CTGGTGCTTGTGCCTGCCATTGG + Intergenic
1006451395 6:34107694-34107716 TAGTTTCTTGGACCTGCCATGGG - Intronic
1006630945 6:35429129-35429151 CTGTTGCTTTTACCTCCCATTGG + Intergenic
1013625959 6:111937244-111937266 CAGTTGCTTGTGCCTTGCATTGG + Intergenic
1014397219 6:120939465-120939487 CAGTTGCATGTAACTGTCATGGG - Intergenic
1016041563 6:139437068-139437090 CAGTTGCCTCCACCTGCCCTGGG + Intergenic
1019163233 6:170082711-170082733 CAGGGGCTTGTGCCTGCCATGGG - Intergenic
1021189486 7:17603220-17603242 CTGGTGCTTGTGCCTGCCATTGG + Intergenic
1022615247 7:31923182-31923204 CAGTTTAGAGTATCTGCCATTGG - Intronic
1022804336 7:33806984-33807006 AAGAAGCGTGTGCCTGCCATGGG - Intergenic
1024825967 7:53389615-53389637 CAGTTGCGTGAACTTGACTTTGG - Intergenic
1032846648 7:135757091-135757113 CAGTTGCCTGTCTCTGCCACTGG - Intergenic
1038015039 8:23507697-23507719 TTGTTGCATGTACCTGCCATAGG - Intergenic
1039785951 8:40834270-40834292 CAGTTGCATGTGCCTGCCCTTGG - Intronic
1041887706 8:62830869-62830891 CTGATGCTTGTGCCTGCCATTGG + Intronic
1049486264 8:142865241-142865263 CAGGTGCCTGTGCTTGCCATTGG - Intronic
1051385057 9:16498864-16498886 GAGGTGCGTGTCCCTGCCAGGGG + Intronic
1052466865 9:28839998-28840020 CAGTTGGGTGTGCCTGCACTTGG - Intergenic
1061357684 9:130118869-130118891 CAGCTGGGTGTGCCTGCCCTTGG - Intronic
1186706182 X:12141076-12141098 CAGTTGCTTGTTTCTGCCTTGGG + Intronic
1188506861 X:30892288-30892310 CATTTGCTTGTGCCTGCCAAAGG - Intronic
1191615734 X:63167690-63167712 CTGTTGCTTGTGCCTGTCATTGG + Intergenic
1191620564 X:63211233-63211255 CTGTTGCTTGTGCCTGTCATTGG - Intergenic
1195683526 X:107565891-107565913 CAGTTGGGGGGCCCTGCCATAGG + Intronic