ID: 955112127

View in Genome Browser
Species Human (GRCh38)
Location 3:55959704-55959726
Sequence CTGGTGAGCCAGAGAGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 384}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955112123_955112127 -9 Left 955112123 3:55959690-55959712 CCTCCCATCTAGGTCTGGTGAGC 0: 1
1: 0
2: 0
3: 7
4: 106
Right 955112127 3:55959704-55959726 CTGGTGAGCCAGAGAGCACAGGG 0: 1
1: 0
2: 1
3: 36
4: 384
955112119_955112127 15 Left 955112119 3:55959666-55959688 CCAAACAAATTTCTTATCACTTG 0: 1
1: 0
2: 1
3: 13
4: 283
Right 955112127 3:55959704-55959726 CTGGTGAGCCAGAGAGCACAGGG 0: 1
1: 0
2: 1
3: 36
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955112127 Original CRISPR CTGGTGAGCCAGAGAGCACA GGG Intronic
900386901 1:2414759-2414781 CTGGTCAGCCAGGAAGGACATGG - Intergenic
900793418 1:4693769-4693791 CAGGAGGGCAAGAGAGCACATGG + Intronic
901083208 1:6595226-6595248 GCTGTGAGCCAGAGAGCAGAAGG - Intronic
902077708 1:13801005-13801027 CTGGAGAGGCAGAGAGCATGAGG - Intronic
902460211 1:16569237-16569259 CTGATGAGCCAGGCAGGACAGGG + Intronic
902614518 1:17616485-17616507 CAGGTGAGCCAGACAGCGCAGGG - Intronic
903065163 1:20695616-20695638 CTGGTAAGTCACAGAGAACAGGG + Intronic
903159729 1:21478121-21478143 CTGATGAGCCAGGCAGGACAGGG - Intronic
903440373 1:23383656-23383678 CTGGTGGCCCAGACATCACATGG + Intronic
903649184 1:24912721-24912743 CTGGACAGCCAGTGAGCTCAAGG + Intronic
904797437 1:33067673-33067695 CTGGTGAGACAGAAAGTATAAGG - Intronic
905774824 1:40661833-40661855 CTGGGGAGCCAGAGGGCAAGAGG - Intronic
905915465 1:41681561-41681583 TTTGTGAGCCACAGAGGACAAGG + Intronic
907049650 1:51321605-51321627 CTGGTGACCCAGAAAGCCAAAGG + Intronic
907245544 1:53106157-53106179 CAGGTGAGCCAGTGACCGCACGG - Intronic
908403729 1:63794029-63794051 CTGGGGAACCAGGAAGCACAGGG + Intronic
908405782 1:63812898-63812920 CTGGTAAGGCATTGAGCACAGGG + Intronic
910363271 1:86436565-86436587 CTATTGATCCACAGAGCACAAGG - Intronic
910740818 1:90514316-90514338 CTGGTGAGCCAGGAAGCAGATGG + Intergenic
911236788 1:95420718-95420740 CCTGAGAGCCAGAGAGCAAATGG - Intergenic
912442137 1:109707293-109707315 CTGGTGAGACAGAAAGTATAAGG - Intronic
913489004 1:119360780-119360802 CTGTTGAGCCTGAGAGGTCAAGG + Intergenic
913605206 1:120459344-120459366 CTGATGAGCCAGGCAGGACAGGG - Intergenic
913642073 1:120822081-120822103 CTGATGAGCCAGGCAGGACAGGG - Intronic
914083332 1:144429864-144429886 CTGATGAGCCAGGCAGGACAGGG + Intronic
914189356 1:145395142-145395164 CTGATGAGCCAGGCAGGACAGGG + Intronic
914211204 1:145580854-145580876 CTGATGAGCCAGGCAGGACAGGG + Intergenic
914276408 1:146128283-146128305 CTGATGAGCCAGGCAGGACAGGG + Intronic
914366409 1:146982905-146982927 CTGATGAGCCAGGCAGGACAGGG - Intronic
914380925 1:147115478-147115500 CTGATGAGCCAGGCAGGACAGGG + Intergenic
914486038 1:148110542-148110564 CTGATGAGCCAGGCAGGACAGGG + Intronic
914537452 1:148579238-148579260 CTGATGAGCCAGGCAGGACAGGG + Intronic
914586370 1:149065690-149065712 CTGATGAGCCAGGCAGGACAGGG + Intronic
914628474 1:149486107-149486129 CTGATGAGCCAGGCAGGACAGGG - Intergenic
914894318 1:151654758-151654780 CATGTGAGACAGAGAGCAAATGG + Intronic
915012249 1:152698406-152698428 CCTGGGAGCCAGAGGGCACAGGG + Intronic
916009204 1:160689427-160689449 CTGGTGAGACAGAAAGTATAAGG + Intronic
916418017 1:164610649-164610671 TTGGTGAACCAGAGAACACAGGG - Intronic
917478144 1:175386389-175386411 CTGGTGAGTCAGAGAGAGGATGG + Intronic
917486119 1:175456073-175456095 CGGGTGAGCTAGTGAGCTCAGGG - Intronic
918086766 1:181252172-181252194 CTGGTGAGACAGAAAGTATAAGG - Intergenic
918993568 1:191729019-191729041 CTGGAGAGACAGAGCCCACATGG - Intergenic
919367765 1:196686045-196686067 CAGGAGAGACAGAGAGCAAAGGG + Intronic
919536605 1:198796100-198796122 CAGGTAAGAGAGAGAGCACAGGG + Intergenic
921015676 1:211188477-211188499 CAGGTGAGTCAGAGACCACATGG - Intergenic
921555277 1:216591341-216591363 GTGGTGTGCCAGAGAGAGCATGG + Intronic
921990353 1:221359525-221359547 CTAAGGAGGCAGAGAGCACATGG - Intergenic
922578408 1:226678954-226678976 CTGATGAGGAAGAGACCACATGG + Intronic
922898529 1:229118997-229119019 CTGGGGACCCAGAGCTCACAAGG + Intergenic
922932490 1:229401293-229401315 CTGGAGAGGCTGAGAACACATGG + Intergenic
923411529 1:233714808-233714830 CTGGTGAGGAAGAAAGCACAGGG + Intergenic
1064921393 10:20523043-20523065 CTGGTGAGCTACAGAGCAGTTGG + Intergenic
1065450853 10:25855465-25855487 CTGATGAGCCAGAGACAGCAGGG + Intergenic
1066336292 10:34481573-34481595 CTGGCCACCCAGAGAGCAAATGG + Intronic
1067541846 10:47160593-47160615 CTGAGGGACCAGAGAGCACAAGG + Intergenic
1067745254 10:48930874-48930896 CATGTGTGCCAGAGAACACAGGG - Intronic
1068017115 10:51530981-51531003 CCGTTGAGTCAGTGAGCACAGGG + Intronic
1069162569 10:65109297-65109319 CTGGTGAGACAGAAAGTATAAGG + Intergenic
1071497607 10:86179594-86179616 CTGGGGACCCAGGGAGCAGAAGG - Intronic
1072664151 10:97381677-97381699 CTGAGGAAGCAGAGAGCACAGGG - Intronic
1073354254 10:102841236-102841258 CTGGTGAGACAGAAAGTATAAGG + Intergenic
1073986633 10:109217036-109217058 CAGGTGATCCTGAGAGCACTGGG - Intergenic
1074743781 10:116510227-116510249 CTGGGGACCCAGGGAGCACTGGG + Intergenic
1074826954 10:117221539-117221561 CAGGTGGGGCAGAGAACACAGGG - Intergenic
1075589961 10:123684156-123684178 CTCATGTCCCAGAGAGCACACGG + Intronic
1076204314 10:128583240-128583262 CTGGTAAGGCTAAGAGCACAGGG - Intergenic
1076424790 10:130359825-130359847 CTGGTGACGCAGGGAGCCCATGG + Intergenic
1076474893 10:130744988-130745010 CTTGGGATCCACAGAGCACAGGG - Intergenic
1077045918 11:545079-545101 GGGCTGAGCCAGAGACCACAGGG - Intronic
1077235773 11:1481368-1481390 CTGGCCAGCCTGAGAGCACGGGG + Intronic
1077439007 11:2559612-2559634 CTGGTGAGCGAGAGAGGCAAGGG - Intronic
1078722362 11:13896887-13896909 CTGAAGAGCCAGAGAGGGCAGGG - Intergenic
1078839569 11:15065842-15065864 CTGGTGAGACAGAAAGTATAAGG + Intronic
1079108198 11:17587808-17587830 GTGGTGAGCCAGAGCTCACCAGG + Intronic
1079344608 11:19641111-19641133 ATGGTGAGCCAGCTACCACAGGG - Intronic
1080412431 11:32038410-32038432 CTGGTGAGACAGAAAAGACAAGG - Intronic
1081760073 11:45571026-45571048 CTGGTGATCCAGGGAGCAGCAGG - Intergenic
1081927424 11:46842613-46842635 ATGGTGAGACAGAGGGCAAATGG + Intronic
1084161312 11:67351951-67351973 GTGGTGAGCAAGAGAGCTAAGGG + Exonic
1085546117 11:77319782-77319804 CTGGAGAGCCAGGGAGCCAATGG - Intergenic
1089867462 11:121644081-121644103 CTGGTGAGCCAGAGATAACGAGG - Intergenic
1090719583 11:129459378-129459400 CTGGGCTGCCAGAGAGCAGACGG + Intergenic
1091048496 11:132347261-132347283 CTGGTGAGCCAAATAGCACTAGG + Intergenic
1091315886 11:134613802-134613824 CTGTGGGGCCAGAGAGCACTGGG + Intergenic
1092252073 12:6905133-6905155 CTGGTGTACCAGAGGGCCCAAGG + Intronic
1092260558 12:6951436-6951458 CTGGGCAGGCAGAGAGCTCAGGG - Exonic
1092309693 12:7339023-7339045 ATGGTGGGCCTGAGGGCACAGGG + Intergenic
1093082023 12:14823213-14823235 CTTCTGAACCACAGAGCACATGG - Exonic
1093428158 12:19052683-19052705 CTGGTTACTCAGATAGCACATGG + Intergenic
1094036832 12:26081123-26081145 CAGGAGAGACAGAGAGCAAAGGG + Intergenic
1094070894 12:26411952-26411974 GTGGTGAGCCAGGAAGCAGATGG - Intronic
1094849189 12:34374772-34374794 ATGGAGAGCCTGAGAACACAGGG - Intergenic
1094865707 12:34528060-34528082 CTGGTGAGACAGAAAGTATAAGG - Intergenic
1095363511 12:41373533-41373555 CTGGTGAGCCAGGCAGAAGAGGG - Intronic
1095948772 12:47769414-47769436 TTGTTGAGCCATAAAGCACATGG - Intronic
1096503423 12:52079266-52079288 CTGCTGAGCCAGGAGGCACACGG - Intergenic
1096770646 12:53934008-53934030 CTGCAGAGCCAGAGAGGAAAAGG + Intergenic
1097173036 12:57128180-57128202 CTGGTGCTCCAGAGAGCAGAAGG - Intronic
1098139796 12:67439870-67439892 CTGGAGAGCCAAAGGCCACAAGG + Intergenic
1099068264 12:78011890-78011912 CAGGTGAGAAAGAGAGGACATGG + Intronic
1100229221 12:92590170-92590192 CTGGAGAGGAAGAAAGCACAGGG + Intergenic
1100289552 12:93200756-93200778 CACGTGAGCCTGAGAGCACCTGG + Intergenic
1100710189 12:97247600-97247622 CTGGTGCAATAGAGAGCACATGG + Intergenic
1101592926 12:106139282-106139304 CTGGCGAGCCCGAGAGCGCCCGG - Exonic
1102877970 12:116462422-116462444 GGGGAGAGCAAGAGAGCACATGG + Intergenic
1103126204 12:118424545-118424567 ATTGTGAGCCAGAGAGGACAGGG + Intergenic
1103198001 12:119062273-119062295 CTGGTGAGCCAGGGAGAGAATGG + Intronic
1103291231 12:119847957-119847979 CTTATGATGCAGAGAGCACAAGG + Intronic
1104706143 12:130948937-130948959 CTGCTGAGTCAGAGACCCCAGGG + Intergenic
1104770401 12:131358147-131358169 CAGGAGAGACAGAGAGCAAAGGG - Intergenic
1105401758 13:20102384-20102406 CCAGAGAGCCAGAGAGCAAAGGG + Intergenic
1105496850 13:20938053-20938075 CTCTTGAGCCAGAGAGGTCAAGG - Intergenic
1105556315 13:21449425-21449447 CTGCTGAGTGAGAGACCACATGG - Intronic
1105564288 13:21528896-21528918 GTGGTGAGTCAGAGAGTAGAGGG + Intronic
1106562116 13:30855856-30855878 CTGGTGAGCAAGATTACACATGG - Intergenic
1106806316 13:33311211-33311233 CTCTTGAGCCAGAGAGGTCAAGG + Intronic
1106846419 13:33742452-33742474 CTGGTGAGAGAGGAAGCACAGGG - Intergenic
1107052222 13:36063335-36063357 CTGAAGAGCCAGAGAGAACGTGG + Intronic
1107549257 13:41459065-41459087 AGGGGGAGCCAGAGAGCACATGG + Intronic
1108499026 13:51051925-51051947 CAGGTGATACAGAGAGCACGGGG - Intergenic
1110129495 13:71989651-71989673 CTGGTGAGCCACAGTGGAAAGGG + Intergenic
1110775558 13:79405239-79405261 CAGATGAGCCAGACAGCACATGG + Intronic
1111564555 13:89997764-89997786 ATGGTGAGCCAAAGACCACAAGG - Intergenic
1111628971 13:90825830-90825852 CTGGAGAAAGAGAGAGCACAGGG + Intergenic
1111688098 13:91526856-91526878 CAGGAGAGAGAGAGAGCACAGGG + Intronic
1113047709 13:106173653-106173675 CTGCTGAGCCAGAGAGCAACAGG + Intergenic
1114687093 14:24543585-24543607 CTGGTGAGCCAGGTGGAACAGGG + Intergenic
1115160107 14:30384241-30384263 CTGAGGAGGCAGAGAGCAAAGGG + Intergenic
1115979027 14:39029611-39029633 CAGGAGAGCGAGAGAGCAAAGGG + Intergenic
1116012501 14:39367334-39367356 CTGTTGAGCCCTAGAGCAGAAGG + Intronic
1116984640 14:51205779-51205801 ATGCTGTGCCAGAGACCACATGG + Intergenic
1117271988 14:54154127-54154149 CAGGAGAGAGAGAGAGCACAGGG + Intergenic
1117334448 14:54744949-54744971 TTGGTGAGACAGAGAAAACAGGG - Intronic
1117556831 14:56894706-56894728 CTAGTGAGCCAGAGAGGATGTGG - Intergenic
1117660916 14:58003690-58003712 CTGGTGAACAACAGAGCTCATGG - Exonic
1118285599 14:64468600-64468622 CTGATCAGCCAGAGCCCACACGG + Exonic
1119023515 14:71135011-71135033 CAGCTGATCCAGGGAGCACAGGG - Intergenic
1120946205 14:89999987-90000009 CTGGTGAGACACTGAGCAGAGGG - Intronic
1120951527 14:90046131-90046153 CAGCTGTGCCAGAAAGCACAGGG - Intergenic
1122205442 14:100145861-100145883 CTGGTGAGCCACAGCTCAGATGG - Exonic
1122207378 14:100154751-100154773 CTGCTGAGCCATTGAGCAGAGGG + Intronic
1122373651 14:101243616-101243638 CTGGGGAGTCCGAGATCACAGGG + Intergenic
1122616382 14:103020665-103020687 CCCGTGAGAGAGAGAGCACAGGG + Intronic
1124960993 15:34394713-34394735 ATGTTGAGCCATAGAGCCCATGG - Intronic
1124977623 15:34540934-34540956 ATGTTGAGCCATAGAGCCCATGG - Intronic
1125332306 15:38594226-38594248 CTTGTGTGCCAGACAGCACAAGG - Intergenic
1125567713 15:40689846-40689868 CTGGTGAGACAGAAAGTATAAGG + Intergenic
1125680644 15:41528140-41528162 CTAGTGAGCCAGAGTGAAAAGGG + Intronic
1126098221 15:45104201-45104223 CTTGTCAGCCAGAGAGAACATGG + Exonic
1126106004 15:45147575-45147597 CTTGTCAGCCAGAGAGAACATGG - Exonic
1130297998 15:82660615-82660637 CTGGTGTGCAGGAGAGCAGACGG - Intronic
1131305475 15:91239320-91239342 GAGGTGAGGCAGAGAGGACAAGG - Intronic
1131352602 15:91715168-91715190 CAGGAGAGACAGAGAGCAAAGGG - Intergenic
1132457872 16:34033-34055 CTGGGGAGCCTGGAAGCACACGG + Intergenic
1132705414 16:1241224-1241246 CAGGTGAGCCTGAGAGTCCACGG + Exonic
1132999434 16:2841600-2841622 CTGGAAAGCAAGAGAGCAAAGGG + Intergenic
1133258360 16:4532674-4532696 CTGGGGAGCCTGAGAGCACTCGG + Intronic
1133696341 16:8266621-8266643 CTGGAGAGAGAGAGAGCAAAGGG - Intergenic
1133737740 16:8628832-8628854 CTGCTGAGACAGGCAGCACAGGG + Exonic
1133978651 16:10617965-10617987 CTGATGACCCAGACAGGACAGGG - Intergenic
1134042334 16:11078201-11078223 CTGCTGGGCCAGAAACCACAGGG - Intronic
1134191247 16:12122646-12122668 CTGGAGCGGCAGAGAGGACATGG + Intronic
1135105573 16:19646251-19646273 GTGGTGAGAAAGAGAGGACATGG - Intronic
1135588430 16:23688887-23688909 CTGGGGAGTCAGGGAGCACTGGG - Intronic
1135840773 16:25874080-25874102 CTGGTAAAGCAGAGAGGACAGGG - Intronic
1136052561 16:27662496-27662518 CAGGTGGGTCAGACAGCACAGGG + Intronic
1136547737 16:30965134-30965156 CTGGGGAGCCAGAGCGGGCAGGG - Exonic
1136989391 16:35142869-35142891 CTGGTGAGGCAGGGAGGGCATGG - Intergenic
1138767800 16:59624804-59624826 CTGGTGAGACAGAAAGTATAAGG + Intergenic
1139633450 16:68244546-68244568 CTGGGGAACCAGAGAGGACATGG - Intergenic
1139922089 16:70466952-70466974 CTGGTGAGCCTGAGACTACCTGG + Exonic
1140571198 16:76108306-76108328 CTGGTCAGCCAGAGGATACAGGG - Intergenic
1141668111 16:85476505-85476527 CTGGTGACCCAGGGAACAGAAGG - Intergenic
1141757116 16:85998601-85998623 GTGGGGAGCCTGAGAGCAAAGGG + Intergenic
1143524470 17:7464000-7464022 CTGGTGAGGGAGGCAGCACAAGG - Intronic
1143739995 17:8945459-8945481 CTGGTGACCCAGAGAGAGCCTGG + Intronic
1144390094 17:14785106-14785128 GTTGTGAGCGAGTGAGCACAGGG - Intergenic
1144798048 17:17905862-17905884 CTGGGGACCCAGATAACACAGGG - Intronic
1145013519 17:19382830-19382852 TTGGTGTGCCTGAGAACACAGGG - Exonic
1145801525 17:27689115-27689137 CTGGTGAGACAGAAAGTATAAGG + Intergenic
1146535582 17:33647809-33647831 CTGCTGAGCCAGAGGGCTGAGGG + Intronic
1147381167 17:40057077-40057099 GCAGTGAGCCAGAGAGCCCAAGG - Intronic
1148029138 17:44608090-44608112 ATGGAGAGGCAGGGAGCACATGG - Intergenic
1148439604 17:47704906-47704928 CGGAGGAGCCAGAGAGCAAATGG - Intronic
1148763586 17:50022524-50022546 TTGTTGAGACAGAGATCACATGG - Intergenic
1151713894 17:75821793-75821815 CTGTTGAGCGAGTGAGCAGAGGG + Intronic
1152245257 17:79182116-79182138 CTGGAGAGAGAGAGAGTACAGGG - Intronic
1152417671 17:80173248-80173270 ATGGAGAGGCAGAGAGCAGAGGG - Intronic
1152961871 18:84736-84758 CTGGGGAGCCTGGAAGCACACGG + Intergenic
1154031915 18:10760677-10760699 CTGGAGATCCAGAGAGGCCAAGG + Intronic
1156544083 18:37946420-37946442 CTGGTGAGTCAGGGAGTAGAAGG + Intergenic
1157063476 18:44320709-44320731 CTGCTGTGCAGGAGAGCACAGGG - Intergenic
1157210757 18:45740018-45740040 CTGGAGAGCCCGTGAGCACAGGG - Intronic
1157915491 18:51660009-51660031 CTGGGGAGGCAGGGAGCACATGG - Intergenic
1158568813 18:58579255-58579277 CTGGTGAGTCAGAAAACTCAGGG - Exonic
1160082227 18:75738976-75738998 CTGGTGTGTCAGAGAGGTCAAGG - Intergenic
1160590974 18:79944524-79944546 CTGGGGAGGCAGAGACCGCAGGG - Intronic
1163177109 19:15572032-15572054 CTCAGGAGCCAGAGAGCACCAGG - Intergenic
1163432010 19:17273881-17273903 CTGGGGAGGCAGAGAGTACAGGG - Intronic
1164377994 19:27706326-27706348 CTGGTGAGACAGAAAGTATAAGG + Intergenic
1164484533 19:28643471-28643493 CTGGTGAGCCAGCCTGCAGAGGG - Intergenic
1164532793 19:29060945-29060967 CTGGGGAACCAGAAAACACATGG + Intergenic
1164777922 19:30868671-30868693 CATGTGTGCCAGTGAGCACATGG - Intergenic
1166081057 19:40444330-40444352 CTGGTGGGCCAGAGGCCAGACGG - Exonic
1166906242 19:46110418-46110440 CTGGAGAGCCACAGGGGACAAGG - Intergenic
1167586733 19:50379640-50379662 CTGGTGTGGCTGAGAGAACAGGG + Intronic
1167708246 19:51094483-51094505 AGGGTGAGGCAGAGAGCACAGGG - Intergenic
1167730610 19:51251500-51251522 CTGGTCAGCCAGAGGGCAGCTGG + Intronic
1168433143 19:56297138-56297160 CAGGTGAGCCAGAGATAACTGGG + Intronic
1202676643 1_KI270711v1_random:12965-12987 CTGATGAGCCAGGCAGGACAGGG + Intergenic
925473064 2:4183438-4183460 CTGGTTAGCAAAAGAGCTCAAGG + Intergenic
926108401 2:10166695-10166717 CTGGTGCGCCATAGGGAACAGGG - Intronic
926158152 2:10469464-10469486 CTGGTGCTCCAGAGTGCACAAGG - Intergenic
926421668 2:12705754-12705776 CTTATGAGCCAGAAATCACATGG - Intergenic
926702811 2:15815114-15815136 CTGGTGAGACAGAAGGCACGTGG - Intergenic
928353082 2:30580999-30581021 CTGATCTGACAGAGAGCACAGGG - Intronic
929195892 2:39183788-39183810 ATGGGGAGTCTGAGAGCACAGGG + Intronic
930404685 2:50940535-50940557 CTTGTGACCCAGAGAGCACAAGG - Intronic
930686398 2:54313023-54313045 TTGGAGAGCCACAGAGCTCAAGG + Intergenic
931600081 2:63994319-63994341 CTGGTGAGACAGAAAGTATAAGG - Intronic
933844690 2:86315736-86315758 ATGGTGACCCAGAGAGCATCTGG - Intronic
934541347 2:95177832-95177854 CTGCTGAGCGAGAGAGCCTATGG - Intronic
935142376 2:100364743-100364765 CTGGTGAGACAGAAAGTATAAGG + Intergenic
935351869 2:102157994-102158016 CTAGTGAGGCTGAGAGCCCAAGG + Intronic
935540713 2:104345062-104345084 CAGGTGAGTCAGGCAGCACAGGG + Intergenic
935899031 2:107770713-107770735 CTGGCGAGCCAGAGAAAACAGGG - Intergenic
936061697 2:109299026-109299048 CAGGTGACCCAGAGGGCACTGGG - Intronic
936850931 2:116896694-116896716 CAGGAGAGAGAGAGAGCACAGGG + Intergenic
937090698 2:119204539-119204561 CTGGAGAGACAGGGAGAACAGGG + Intergenic
937106735 2:119322881-119322903 CTGGTCAGACAGAGACCAGAAGG + Intronic
937253632 2:120539934-120539956 GTGGGGAGCCAGGGAGGACAGGG + Intergenic
937345199 2:121121136-121121158 GTGGGAAGCCAGAGGGCACAGGG - Intergenic
938211332 2:129467659-129467681 TTTTAGAGCCAGAGAGCACAGGG - Intergenic
939116508 2:138067726-138067748 TTGGAGAGCCACAGAGAACAAGG - Intergenic
939727455 2:145740566-145740588 CAGGAGAGAGAGAGAGCACAAGG + Intergenic
941731481 2:168922612-168922634 CTTGGGAGCCAGAAAGCAAATGG - Intergenic
943387657 2:187222757-187222779 CAGGAGAGAGAGAGAGCACAGGG + Intergenic
943436257 2:187868582-187868604 CTGGAGAGCCAGAGAGGAGCTGG - Intergenic
943436382 2:187869480-187869502 CTGGAGACCCAGAGAGCAGCTGG - Intergenic
943700195 2:190980990-190981012 CTGGGGAGGGAGAGAGCAGATGG - Intronic
945072465 2:206005125-206005147 CTGATCAGCCAGAGTGCACTTGG - Exonic
945175678 2:207041026-207041048 CTGGTGTTCCTGAGACCACAGGG - Intergenic
945723346 2:213446589-213446611 CTGGTGAGACAGAAAGTATAAGG - Intronic
947679448 2:232016765-232016787 CAAGTGAGCCAGGTAGCACATGG - Intronic
948479465 2:238240714-238240736 CTGGTGACCCGCAGAGCCCAGGG - Intergenic
1169186464 20:3621219-3621241 GTGCTGAGCCAGAAAGGACAGGG + Intronic
1169312973 20:4562979-4563001 CTGGAGATCAAGAGAGCAGAAGG - Intergenic
1169940004 20:10926675-10926697 CTGGGGAGTCACAAAGCACAGGG - Intergenic
1171194571 20:23187158-23187180 ATGGAGAGCCAGGGAGCAGATGG - Intergenic
1172265882 20:33613451-33613473 CAGGAGAGGCAGAGAGCATAAGG - Intronic
1172330489 20:34072685-34072707 CAGGAGGGCCTGAGAGCACAAGG + Intronic
1173866438 20:46315406-46315428 CTGCTCAGCCAGAGACCACATGG - Intergenic
1174149021 20:48473086-48473108 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149047 20:48473244-48473266 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149085 20:48473495-48473517 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149325 20:48475064-48475086 CTGGTGAGCCAGGGAGGAGCTGG - Intergenic
1174211186 20:48879442-48879464 CTGGAGAGCCACAGAGCATGTGG - Intergenic
1174682675 20:52423704-52423726 CTGGTGAGCAAGGGTGGACACGG - Intergenic
1175891100 20:62316414-62316436 CAGCTGAGCCACAGGGCACAGGG - Intronic
1175919084 20:62441671-62441693 CTGGTGACCCTGGGAGCAGAGGG - Intergenic
1175951891 20:62587993-62588015 CTGCAGGTCCAGAGAGCACACGG - Intergenic
1177905598 21:26967787-26967809 CTGGACAGCCAGAGAGCCCAGGG + Intergenic
1178484395 21:33008807-33008829 CTGGTAAAGCAGAGACCACATGG - Intergenic
1179357724 21:40676898-40676920 GTGGAGAGCCAGGGAGCACGAGG - Intronic
1179966028 21:44806319-44806341 CTTGAGGGCCAGAGAGCACGTGG + Exonic
1180538211 22:16415688-16415710 CAGGAGAGACAGAGAGCAAAGGG + Intergenic
1180605696 22:17057494-17057516 CTGATGAGACAAAGAACACAGGG - Intergenic
1180652860 22:17393153-17393175 CTGGGGAGGCAGGGAGCTCAAGG - Intronic
1182401851 22:30084287-30084309 CTGGTAAGACAGAGAGAGCAAGG + Intronic
1182983937 22:34698819-34698841 CAGGAGAGACAGAGAGCAAAGGG - Intergenic
1183190945 22:36321864-36321886 ATGGGGAGCTAGAGAGCACGGGG + Intronic
1183367800 22:37416530-37416552 CTGGGGAGCGAGAGGGCTCAAGG + Intronic
1184045324 22:41969477-41969499 CTGGTGGGACAGTGAGCAGAGGG + Intergenic
1184646127 22:45896458-45896480 CTGGCTTGCCAGAGACCACAAGG + Intergenic
1184826045 22:46952029-46952051 CTGCTGAGCCCCACAGCACAGGG + Intronic
949159375 3:861318-861340 CTGGAGACCCAGAGAGCAGCTGG - Intergenic
949347177 3:3087344-3087366 CTGGCCAGCCAAGGAGCACAGGG - Intronic
949679114 3:6492003-6492025 CTGGTAAGGCAGCCAGCACATGG - Intergenic
952924162 3:38309120-38309142 CTGGTGAGCAAGCGAGTACCGGG + Exonic
953140389 3:40224174-40224196 CTGGTGAGGTAGAAAGCACCTGG + Intronic
953519200 3:43625038-43625060 CTTGGAAGCCAGAGAGAACATGG - Intronic
953537887 3:43789842-43789864 GTGGAGAGCGAGAGAGCAGAGGG - Intergenic
954030955 3:47819587-47819609 CTAGGGAGCTAGAAAGCACAGGG - Intronic
955112127 3:55959704-55959726 CTGGTGAGCCAGAGAGCACAGGG + Intronic
956750073 3:72338031-72338053 CTTGTCAGCCAGAGAGGCCATGG - Intergenic
956872100 3:73428200-73428222 CTGGGGAGCCAGTGAGCAAGTGG + Intronic
957353863 3:79057693-79057715 CTGGTGAGACAGAAAGTATAAGG - Intronic
958515834 3:95114252-95114274 CTCTGGAGACAGAGAGCACAGGG - Intergenic
958585658 3:96083777-96083799 ATGATGAGTCATAGAGCACAGGG - Intergenic
959596761 3:108137144-108137166 GTAATGGGCCAGAGAGCACAGGG - Intergenic
959888340 3:111527420-111527442 CTGGTGAGACAGAAAGTATAAGG - Intronic
960567616 3:119151204-119151226 CTGCTGAGAAAGAGAGCATAAGG - Exonic
961194156 3:124987329-124987351 CGGGTGAGCCAGGGAGCAGGAGG - Intronic
961537203 3:127577343-127577365 CTGGTGAGCAGGAGTGCGCATGG + Intronic
961793410 3:129392700-129392722 CTGGTGACTCAGAGAGGGCATGG + Intergenic
961807407 3:129499318-129499340 CTGGTGACTCAGAGAGGGCATGG + Intronic
961922882 3:130446362-130446384 CTGGTGAGACAGAAAGTATAAGG + Intronic
965353913 3:167649955-167649977 CTGGAGAGCCCAGGAGCACAGGG + Intronic
965711261 3:171558605-171558627 AGGGTGAGCCACAGAGCACCTGG - Intergenic
967220860 3:187246973-187246995 CTGGTCAGCCTGAGGCCACATGG + Intronic
969008938 4:4044991-4045013 CTGGTGAGACAGAAAGTATAAGG + Intergenic
969090932 4:4693587-4693609 GTGATGATCCAGAAAGCACAGGG + Intergenic
969566119 4:7979222-7979244 CCGCAGAGCCAGATAGCACAAGG - Intronic
970087096 4:12362034-12362056 CAGGAGAGACAGAGAGCACAGGG + Intergenic
971186376 4:24381113-24381135 ATGGTCAGCCAGAGAGGTCATGG + Intergenic
973012990 4:45100654-45100676 CTGGAGAGTCAGAGAGCCAATGG - Intergenic
974165004 4:58190754-58190776 CTGGGGATCGAGAGAGCCCATGG - Intergenic
974605381 4:64144262-64144284 CTGGTGAGACAGAAAGTATAAGG + Intergenic
975431237 4:74293652-74293674 ATGGTGAACCAGGGAGCAGAGGG - Intronic
975673394 4:76803762-76803784 CTGGTGAACCAGTGACCACTGGG - Intergenic
975912955 4:79290451-79290473 CTGATGAGAGAGAGAGCAGAGGG - Intronic
975955086 4:79827260-79827282 CTGGTGAGACAGAAAGTATAAGG + Intergenic
977853010 4:101853433-101853455 CTGCTTAGCCAAAGAGCACCAGG + Intronic
978594734 4:110364994-110365016 CTGTTGAGCCAGAAATCAAATGG - Intergenic
981773060 4:148332709-148332731 CTGGTGTTACAAAGAGCACATGG + Intronic
985293697 4:188412223-188412245 TTAGTGAACCTGAGAGCACAGGG - Intergenic
986316669 5:6593614-6593636 TTGGTGTGCCAAAGGGCACAAGG + Intergenic
988136376 5:27176316-27176338 CAGGAGAGACAGAGAGCCCAGGG + Intergenic
988149790 5:27363238-27363260 CTGGTGATCCAGGGAACACCAGG + Intergenic
991505671 5:67321506-67321528 CAGGAGAGACAGAGAGCAAAGGG - Intergenic
992396706 5:76375259-76375281 TAGGGGAGCCAGAGAGCTCAGGG - Intergenic
997202239 5:132017978-132018000 CTGGAGAGAGAGAGAGAACAGGG + Intergenic
998010533 5:138691939-138691961 CAGGAGAGAGAGAGAGCACAGGG + Intronic
999321128 5:150615712-150615734 CTGGTGAGTGAGAAAGCACCTGG + Intronic
999406830 5:151314115-151314137 CTGATGAAACAGAGAGCTCAGGG + Intergenic
1000232468 5:159328914-159328936 CTGATGGGCCAGAGAGCCAAAGG - Intronic
1000305194 5:159988064-159988086 CTGGTGGGCCTGATATCACAAGG + Intergenic
1001521823 5:172399783-172399805 CTGGTGAGACAGAAAGTATAAGG - Intronic
1003624264 6:7727728-7727750 CTGGTGCGCCAGAGAACGCGGGG + Intronic
1003682764 6:8272085-8272107 CTAGTGAGCCACAGTACACAGGG + Intergenic
1004483834 6:16047004-16047026 CAGGTGAGAGAGAAAGCACAAGG + Intergenic
1005348078 6:24909911-24909933 CTGGAGAGCGAGAGAGCAAGTGG - Intronic
1006722399 6:36165366-36165388 CTAGAGAGCCAGAGACAACATGG - Intergenic
1006917494 6:37603923-37603945 CTGATGCCACAGAGAGCACAGGG - Intergenic
1007066563 6:38996771-38996793 CTGGTGTGTTAGAGAGGACACGG + Intronic
1008487583 6:52052458-52052480 CTGGAGAGACAGAAAGGACAAGG + Intronic
1008727657 6:54441707-54441729 CTGTGGAGCCAGAAAGGACATGG + Intergenic
1009546196 6:65022276-65022298 TTGGTAAGCCAGAGAGCAAATGG - Intronic
1010594448 6:77747469-77747491 CAGGTGAGAGAGAGAGCAAAGGG + Intronic
1010917873 6:81642841-81642863 CTGGTGAGCAAAAGACCACTGGG + Intronic
1013043795 6:106463068-106463090 CTCTTGAGCCAGAGAGTTCAAGG + Intergenic
1013081953 6:106821014-106821036 CTGGAGAGCCCAAGAACACATGG + Intergenic
1013330371 6:109094783-109094805 CCGCCGAGCCAGAGGGCACAGGG + Exonic
1013701643 6:112777409-112777431 CTGGAGAGCCGGAGGGCTCATGG + Intergenic
1014020057 6:116576541-116576563 CTGGGGAGCCAGATAGAACAGGG - Intronic
1014208451 6:118682595-118682617 CTTGTTACCCAAAGAGCACAAGG + Intronic
1015775427 6:136809301-136809323 CAGGAGAGAGAGAGAGCACAGGG + Intergenic
1016991914 6:149935901-149935923 CTGGTGAGCATGACAGCACCTGG + Intergenic
1017811602 6:157987944-157987966 CTGGTGAGCTCGGGAGGACAAGG + Intronic
1017840912 6:158222312-158222334 CTGCTGGGCCAGGGACCACATGG + Intergenic
1017886991 6:158607760-158607782 CTGGGGTGGCAGGGAGCACACGG - Intronic
1018201130 6:161396759-161396781 CTGCTGTGCTAGAGAGCATAAGG - Intronic
1018576631 6:165266515-165266537 CCTGGGAGCCAGAGAGCCCATGG - Intergenic
1019521718 7:1463667-1463689 CTGGGGACCCAGGGAGGACATGG + Intergenic
1019592449 7:1842529-1842551 CTGGGGGGCCAGTGAGCACGCGG - Intronic
1019685627 7:2380342-2380364 GTCCAGAGCCAGAGAGCACAGGG - Exonic
1020169299 7:5832681-5832703 CTTGGGAGGCAGAGATCACAGGG - Intergenic
1024875136 7:54013570-54013592 CAGGTGAGCAGGAGAGCAGATGG + Intergenic
1025120493 7:56297558-56297580 AAGATGAGCCAGAGAACACAAGG - Intergenic
1026023043 7:66725716-66725738 CTGGTATGACAGAGAGGACATGG + Intronic
1026877562 7:73888197-73888219 AGGGTGTGCCAGAGAGCACCTGG + Intergenic
1028409635 7:90514712-90514734 CAGGTGAGCTTGAGAGTACAGGG + Intronic
1029193215 7:98786352-98786374 CTGCTGAGTCAGAGAGGAGAAGG - Intergenic
1029692201 7:102189962-102189984 CTGCTGAGCCAGAGGGCAGGGGG - Intronic
1031178470 7:118383467-118383489 CAGGAGAGAGAGAGAGCACAGGG - Intergenic
1033290462 7:140078621-140078643 GTGGTGACCCAGAGAGCAACAGG + Intergenic
1034572215 7:151965152-151965174 CTGGTGAGTCAGTGGACACATGG - Intronic
1035332054 7:158102830-158102852 CTGGGGAGAAAGACAGCACACGG + Intronic
1036250211 8:7155656-7155678 CTGGTGAGACAGAAAGTATAAGG + Intergenic
1036367277 8:8131794-8131816 CTGGTGAGACAGAAAGTATAAGG - Intergenic
1036883603 8:12533868-12533890 CTGGTGAGACAGAAAGTATAAGG + Intergenic
1037814320 8:22103767-22103789 CTGGGGAGCCAGGGAGCTCAGGG + Exonic
1039040064 8:33399355-33399377 TAGGTGAACCAGAGAGCACAAGG - Intronic
1039920899 8:41893924-41893946 CTGGTGAGGCAGAGGGCCTAGGG - Intronic
1039969332 8:42308015-42308037 CTGCTGAGGCAGAGAGCGCTGGG - Intronic
1040800001 8:51329937-51329959 CTGGAGAGCCAGAGGACAAATGG + Intronic
1040865092 8:52040784-52040806 CTGGTCAGCCTGCAAGCACAAGG + Intergenic
1041459073 8:58091777-58091799 CTTGTAACCCAGAGACCACATGG - Intronic
1046209164 8:111044089-111044111 CTGGTGTCCCTGAGAGCCCATGG + Intergenic
1046521733 8:115333898-115333920 CAGGTGAGTCTGAGATCACATGG - Intergenic
1048070684 8:131017547-131017569 CTAGGAAGCCAGAGAGCACTGGG + Intronic
1049004079 8:139843871-139843893 CTGGTGAATCAGCGTGCACATGG - Intronic
1049503130 8:142978725-142978747 CTGGAGAGACAGAGGGGACATGG + Intergenic
1053164557 9:35835282-35835304 CTGGTGTGCCAGAGAGCCTGTGG - Intronic
1056201642 9:84282692-84282714 CTGGTGAACAACAGAGTACACGG - Intronic
1057302647 9:93895716-93895738 CTGGGGAGGCAGGCAGCACATGG - Intergenic
1057517554 9:95734955-95734977 CTGGGCAGCCACAGAGAACAGGG - Intergenic
1057866932 9:98688839-98688861 CAGGTGAGCCAGGCAACACAAGG + Intronic
1058683724 9:107462880-107462902 CCTGTGAGTCAGAGAGCAAAAGG + Intergenic
1060007859 9:120016285-120016307 CAGGAGAGAGAGAGAGCACAGGG + Intergenic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1060361671 9:122964910-122964932 CTTTTGAGCCAGAGAGGTCAAGG + Intronic
1061257217 9:129460015-129460037 CCTGTGAGCCAGAGAGCACTGGG + Intergenic
1062044122 9:134417407-134417429 CTGATGAGCCAGAGAGGTCCTGG + Intronic
1062194275 9:135264263-135264285 CTGATGACCCACAGAGAACAGGG - Intergenic
1062206530 9:135340767-135340789 CTGCTGAGCCACAGCACACATGG - Intergenic
1062736272 9:138139368-138139390 CTGGGGAGCCTGGAAGCACACGG - Intergenic
1186393967 X:9189257-9189279 CTATTGAGACTGAGAGCACATGG + Intergenic
1187462750 X:19502406-19502428 CAGGAGAGAGAGAGAGCACAGGG - Intronic
1187820033 X:23277651-23277673 CTGGTGAGCCAGGGAGGACCAGG + Intergenic
1187985272 X:24803279-24803301 CTGGAGAGAAGGAGAGCACACGG + Intronic
1188823302 X:34800568-34800590 CTGGTGAGACAGAAAGTATAAGG - Intergenic
1189310396 X:40013949-40013971 CTGGAGTGCCAGAGAGCCCGGGG + Intergenic
1189509286 X:41645803-41645825 CTGGTGAGACAGAAAGTATAAGG - Intronic
1189557879 X:42164209-42164231 CTGGTGAGGCAGAAAGTATAAGG + Intergenic
1189978553 X:46486714-46486736 CTGGTGAGACAGAAAGTATAAGG + Intronic
1190430258 X:50371918-50371940 CTAGTGACCAAGAGACCACAAGG + Intronic
1190691793 X:52918760-52918782 CAAGTCAGCCAGGGAGCACAAGG - Intergenic
1190694190 X:52937032-52937054 CAAGTCAGCCAGGGAGCACAAGG + Intronic
1191125245 X:56947333-56947355 CTGGTGAGACAGAAAGCATAAGG - Intergenic
1192552673 X:72066594-72066616 GTGGTGAGGCAGAAAGGACAAGG + Intergenic
1192736422 X:73853436-73853458 TTGGTGAGCAAGAGAGAAAAAGG + Intergenic
1195540617 X:106058683-106058705 ATGGTGAGACAGAAGGCACAGGG + Intergenic
1198417406 X:136434595-136434617 CAGGTGAGCCAGAGACCTGAAGG - Intergenic
1199977387 X:152902322-152902344 GTGCTGAGCCAAAGATCACAGGG - Intergenic
1200210304 X:154344190-154344212 ATGAAGAGCCAGAGAGCACACGG - Intergenic
1200220548 X:154387902-154387924 ATGAAGAGCCAGAGAGCACACGG + Intergenic
1200861223 Y:7994755-7994777 CTGGTGAGACAGAAAGTATAAGG + Intergenic
1201497296 Y:14601999-14602021 ATGATGGGCCAGAGAGCACGTGG + Intronic
1201756626 Y:17493798-17493820 CCAGTGAGCCAGCGAGCACTAGG - Intergenic
1201844927 Y:18412186-18412208 CCAGTGAGCCAGCGAGCACTAGG + Intergenic
1202193622 Y:22272526-22272548 CTGAAGATCCAGAGGGCACATGG + Intergenic