ID: 955113875

View in Genome Browser
Species Human (GRCh38)
Location 3:55976980-55977002
Sequence CTGTGTGAGAACAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3796
Summary {0: 1, 1: 0, 2: 4, 3: 189, 4: 3602}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955113875_955113879 10 Left 955113875 3:55976980-55977002 CCTTCCACCTTGTTCTCACACAG 0: 1
1: 0
2: 4
3: 189
4: 3602
Right 955113879 3:55977013-55977035 CTATCCATGAGTCAGAAAGCAGG 0: 1
1: 0
2: 7
3: 54
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955113875 Original CRISPR CTGTGTGAGAACAAGGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr