ID: 955114605

View in Genome Browser
Species Human (GRCh38)
Location 3:55984930-55984952
Sequence TGGTACTGTAGTCAATGGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 77}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955114603_955114605 -5 Left 955114603 3:55984912-55984934 CCTTGTTTTGAAATAACTTGGTA 0: 1
1: 0
2: 1
3: 26
4: 266
Right 955114605 3:55984930-55984952 TGGTACTGTAGTCAATGGATTGG 0: 1
1: 0
2: 1
3: 6
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955114605 Original CRISPR TGGTACTGTAGTCAATGGAT TGG Intronic
904589728 1:31605486-31605508 TGTTACTGTAGGCAATGCAATGG + Intergenic
908856341 1:68433942-68433964 AAGTACTGTGTTCAATGGATTGG + Intronic
908941509 1:69440560-69440582 TGACACTGTAGTCAATTAATGGG + Intergenic
916770300 1:167901405-167901427 TGGTATGGTAGTTAATGCATAGG - Intronic
1067498577 10:46781303-46781325 AGGTACTCTACTTAATGGATTGG + Intergenic
1071119937 10:82265425-82265447 ATGTATTATAGTCAATGGATTGG + Intronic
1074358941 10:112809828-112809850 GGGGACTGTAGTCAATGTACTGG + Intronic
1085156295 11:74297941-74297963 TTGTAAAGTAGTCAATGCATTGG + Intronic
1086273682 11:85098014-85098036 AAGTACTCTAATCAATGGATAGG + Intronic
1086824424 11:91477832-91477854 TAGTGCTGTAGTCCAAGGATGGG - Intergenic
1090870872 11:130746332-130746354 AGGTACTGCAGTCAGTGGCTAGG - Intergenic
1097255901 12:57674307-57674329 TTGTCCTTTAGTCTATGGATAGG + Intergenic
1106908276 13:34432395-34432417 TAGGACTCTAGTAAATGGATAGG - Intergenic
1107049407 13:36031402-36031424 TGGTAATGGTGTCAAAGGATTGG + Intronic
1107402672 13:40084675-40084697 TGGTTCTGGAGTCATTGGAGTGG - Intergenic
1109392121 13:61707018-61707040 GGGAACTGTAGTCACTGAATTGG + Intergenic
1109874139 13:68376531-68376553 TGGTAATGTTGTCAAGTGATGGG - Intergenic
1120393486 14:83938443-83938465 TGGTACTGTAGGAAGTGGAGGGG + Intergenic
1123570486 15:21601887-21601909 TAGTACTATAGTCAATGAAGTGG - Intergenic
1123606600 15:22037241-22037263 TAGTACTATAGTCAATGAAGTGG - Intergenic
1127529636 15:59830840-59830862 AGGTTTTGTAGTTAATGGATAGG + Intergenic
1131766723 15:95684306-95684328 TGGCACTGCATTGAATGGATTGG - Intergenic
1202978839 15_KI270727v1_random:329011-329033 TAGTACTATAGTCAATGAAGTGG - Intergenic
1133960588 16:10489499-10489521 GGGTACTGTCGTCTATGGATAGG + Intergenic
1134437121 16:14270331-14270353 TTGTACTTTATTCTATGGATAGG - Intergenic
1146932842 17:36790365-36790387 TGGTGGTGTAGACAGTGGATGGG + Intergenic
1152422572 17:80202041-80202063 TGGCACTGGAGTCAGTGGGTGGG - Intronic
1160944485 19:1635023-1635045 TGGTACTGAAGTCTGTCGATTGG - Intronic
1161162861 19:2770294-2770316 TGGAGCTGTAGTCTATGGACAGG + Intronic
925780330 2:7376095-7376117 TGGTGCTGAAGTCACTGGGTTGG + Intergenic
928018546 2:27681964-27681986 TTGTACTGTAGTCATTTCATGGG + Intronic
930154666 2:48093864-48093886 TGGTACTGTAGTCAATGTAGGGG + Intergenic
930545678 2:52764591-52764613 TGGTACTTTTGTCACAGGATAGG - Intergenic
934084132 2:88495601-88495623 TATTACTGGGGTCAATGGATGGG + Intergenic
937891026 2:126938908-126938930 TGGTATTGTTCTCAATGGAGGGG - Intergenic
938934303 2:136115753-136115775 TGGCATTGTGGGCAATGGATTGG - Exonic
943776356 2:191770837-191770859 TGGTAGTGCAGTCAATGGTAGGG + Intergenic
944596656 2:201267266-201267288 TGATGCTTTACTCAATGGATGGG - Intronic
948864945 2:240770478-240770500 TGGGACTGTCGTCAGTGGAGGGG + Intronic
1170023905 20:11867810-11867832 TGGTACTGTTGCCACTGGATAGG + Intergenic
1173942500 20:46923501-46923523 TTGTACTGTGGAGAATGGATTGG + Intronic
1178319384 21:31593620-31593642 TTGTACAGTAGTCACTGTATTGG + Intergenic
1182535891 22:31002670-31002692 TGGTTCTGTATTCATTGGTTTGG - Intergenic
949285455 3:2397646-2397668 CTGTAATGTAGCCAATGGATTGG + Intronic
952213305 3:31251151-31251173 TTGTAATGGAGTCAATGGGTGGG + Intergenic
955114605 3:55984930-55984952 TGGTACTGTAGTCAATGGATTGG + Intronic
955690426 3:61585411-61585433 TGGTACTATAGCCATTGGGTGGG + Intronic
955940034 3:64138733-64138755 GGGCCCTGTGGTCAATGGATAGG + Intronic
956931060 3:74043483-74043505 TGGTACTGTAGTGACTGGTGAGG + Intergenic
964333457 3:155629394-155629416 TGGAACTGAAGGCAAAGGATGGG - Intronic
965536701 3:169830891-169830913 TGGTAGTGTAATAAATGTATGGG - Intronic
965736148 3:171823196-171823218 TGCTACTCTAGTCCTTGGATGGG - Intergenic
970178853 4:13366461-13366483 TCGTACTGTAGTAATTGTATTGG + Intronic
972201231 4:36716632-36716654 TGGGGCTGTAGCCAATGGTTTGG - Intergenic
974122533 4:57657124-57657146 TGGTACTGGAGTAATTGGATAGG + Intergenic
977034213 4:91928846-91928868 AGATTCTGTAGTCATTGGATAGG + Intergenic
977430841 4:96928761-96928783 ATGGACTGTAGTCAATGGTTTGG + Intergenic
977466076 4:97383926-97383948 ATGGACTGTAGTCAATGGTTTGG + Intronic
978146358 4:105376876-105376898 TGGTACTGTAGTCATTTTACTGG - Intronic
979811517 4:125042048-125042070 TGGTACTTTAGTCACCGGATAGG + Intergenic
984578640 4:181482811-181482833 TGAGATTTTAGTCAATGGATGGG - Intergenic
988092305 5:26559911-26559933 TGGTACTGAACTCAATTGAAAGG - Intergenic
992742394 5:79786971-79786993 TGGTACTGAAGTCAAAATATGGG - Intronic
995194271 5:109346135-109346157 TGCTACTGTATTCAAAGAATTGG + Intronic
997029886 5:130114863-130114885 TGGTCCTGTAGGCAACAGATAGG - Intronic
998270137 5:140699096-140699118 TTCTACTGTAAGCAATGGATGGG - Exonic
999264417 5:150257011-150257033 GGGGACTGGAGTCAATGGAAGGG - Intronic
1012069823 6:94600507-94600529 TGTGACTGAAGTCAATGGAGGGG - Intergenic
1012225881 6:96702992-96703014 GGGGACTGTAGCCACTGGATTGG + Intergenic
1019483482 7:1276985-1277007 TGGCACTTTAAACAATGGATGGG - Intergenic
1021232421 7:18101997-18102019 AGGTTCTGTAGTTCATGGATAGG + Intronic
1024168909 7:46764268-46764290 TGGTACTGTAGTGTATGAGTTGG - Intergenic
1032429307 7:131847997-131848019 TGGCAGTGTAGAGAATGGATTGG + Intergenic
1035849974 8:2908950-2908972 TTGTGCTGTAGTGAATGGAGAGG - Intergenic
1035860743 8:3025591-3025613 TGGTAGTGTAGTCATTGGAAAGG - Intronic
1040625801 8:49148723-49148745 TAGTAGTGCAGTCATTGGATTGG - Intergenic
1041262462 8:56033617-56033639 TGGTGCTGTGGACAATGGAAAGG - Intergenic
1042084142 8:65089194-65089216 TGGTTTTTTAGGCAATGGATGGG - Intergenic
1045138189 8:99246919-99246941 TGGTACTTTAGGCAATCTATTGG + Intronic
1203728231 Un_GL000216v2:68145-68167 TGGAACGGTAGTAAATGGAACGG - Intergenic
1203483884 Un_GL000224v1:33532-33554 TGGTACTGTTGTCATTGTTTTGG - Intergenic
1186036226 X:5426293-5426315 TGGGACTATAGTCATTGGAGGGG + Intergenic
1189101104 X:38190872-38190894 TGCTCCTGTAGTCAAGGGATAGG - Intronic
1189867464 X:45346116-45346138 TGGTCCTGCAGTCAAGAGATAGG - Intergenic
1200755240 Y:6984617-6984639 TGGTACCAAAGGCAATGGATGGG - Intronic