ID: 955117638

View in Genome Browser
Species Human (GRCh38)
Location 3:56021714-56021736
Sequence GAGTGGGGAAGGTGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7520
Summary {0: 1, 1: 24, 2: 241, 3: 1624, 4: 5630}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955117638 Original CRISPR GAGTGGGGAAGGTGGGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr