ID: 955118991

View in Genome Browser
Species Human (GRCh38)
Location 3:56036751-56036773
Sequence TCCTGATTTGCAGGTTGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 259}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955118991_955118995 12 Left 955118991 3:56036751-56036773 CCTGTACAACCTGCAAATCAGGA 0: 1
1: 0
2: 1
3: 9
4: 259
Right 955118995 3:56036786-56036808 AGCCCATGCCACCAGAGCCGTGG 0: 1
1: 4
2: 67
3: 158
4: 457
955118991_955118996 13 Left 955118991 3:56036751-56036773 CCTGTACAACCTGCAAATCAGGA 0: 1
1: 0
2: 1
3: 9
4: 259
Right 955118996 3:56036787-56036809 GCCCATGCCACCAGAGCCGTGGG 0: 1
1: 5
2: 69
3: 249
4: 508
955118991_955118998 14 Left 955118991 3:56036751-56036773 CCTGTACAACCTGCAAATCAGGA 0: 1
1: 0
2: 1
3: 9
4: 259
Right 955118998 3:56036788-56036810 CCCATGCCACCAGAGCCGTGGGG 0: 1
1: 0
2: 1
3: 14
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955118991 Original CRISPR TCCTGATTTGCAGGTTGTAC AGG (reversed) Intronic
902803632 1:18847090-18847112 TACTGTTCTGCAGGCTGTACAGG - Intronic
903882080 1:26517496-26517518 TCCTGATTAGCCGGTACTACAGG + Intergenic
904018496 1:27442875-27442897 TCCTGAGTAGCTGGTTTTACAGG - Intronic
904167652 1:28568397-28568419 TCCTGATTAGCTGGTACTACAGG + Intronic
904202175 1:28827451-28827473 TCCTGAGTAGCTGGTAGTACAGG + Intronic
906490597 1:46265357-46265379 TCCTGAGTTGCTGGTATTACAGG - Intronic
906788158 1:48634394-48634416 TCCTAATTTGCAGCTTCTAGTGG + Intronic
908397034 1:63735113-63735135 TCCTGATTAGCTGGGTCTACAGG + Intergenic
909012654 1:70352214-70352236 TCCTGAGTAGCTGGTAGTACAGG - Intronic
909528723 1:76657714-76657736 TACAGTTTTGCAGGCTGTACAGG - Intergenic
910286210 1:85556991-85557013 TCCTGATTAGCTGGTATTACAGG - Intronic
910629187 1:89339038-89339060 TTTTGATTTGCAGGATGGACTGG + Intergenic
910706290 1:90133089-90133111 GCCAGATTTACAGGATGTACTGG - Intergenic
910772575 1:90844815-90844837 TCCGGATTTGCAGACTGGACAGG - Intergenic
914003528 1:143712676-143712698 TCCTGATTTGCTGGGATTACAGG + Intergenic
914421963 1:147537449-147537471 GCCTGATTTGGGGGCTGTACAGG - Intergenic
915219785 1:154365515-154365537 TCCTGAGTAGCTGGTTCTACAGG + Intergenic
915548183 1:156615430-156615452 TCCTGATTAGCTGGGAGTACAGG - Intergenic
915770245 1:158414680-158414702 TCCTCATTTGTAGGCTGTTCAGG + Intergenic
915776915 1:158500528-158500550 TCATGATTTGCAGAATTTACAGG + Intergenic
915990085 1:160505523-160505545 TCCTGAGTAGCTGGTTCTACAGG + Intronic
916043265 1:160979561-160979583 TCCTGAGTAGCTGGTAGTACAGG - Intergenic
917841517 1:178983727-178983749 TACAGATCTGCAGGCTGTACAGG - Intergenic
919032244 1:192257023-192257045 TCCAGCTTTGCTGGTTTTACTGG + Intergenic
921645195 1:217606615-217606637 TCCTGAGTAGCAGGGTCTACAGG - Intronic
923618519 1:235557723-235557745 TCATGATGTACAGGATGTACTGG - Intronic
924358471 1:243209814-243209836 TCCTGAGTTGCTGGGAGTACAGG + Intronic
1063347850 10:5327824-5327846 TCATGTTCTGCAGGCTGTACAGG + Intergenic
1063946395 10:11180398-11180420 TCCTCATCTGCAGGATGAACAGG + Intronic
1065330614 10:24593951-24593973 TCTTGATTTGCAGGTAATAGAGG + Intronic
1067874656 10:49993694-49993716 TCCTGATTAGCTGGGAGTACAGG - Intronic
1069476316 10:68735974-68735996 TCCTGAGTTGCTGGTACTACAGG + Intronic
1071952164 10:90716022-90716044 TACAGTTCTGCAGGTTGTACAGG - Intergenic
1072349486 10:94543500-94543522 TTCTGATTTGCAGTTGGTTCAGG + Intronic
1076021321 10:127076375-127076397 TCCTGATTAGCAGGGACTACAGG - Intronic
1077415405 11:2422312-2422334 ACCTGCCTTGCAGTTTGTACGGG - Exonic
1077559537 11:3250209-3250231 TCCTGATTTGTAGGATGGAGGGG + Intergenic
1077565431 11:3296012-3296034 TCCTGATTTGTAGGATGGAGGGG + Intergenic
1077792477 11:5456315-5456337 TACTGATTTTCAGGTTCTAATGG + Intronic
1078034984 11:7794273-7794295 TTCTGATTTGCAGTTGGTTCAGG - Intergenic
1078917992 11:15798745-15798767 TCTTGTTCTGCAGGTTGTACAGG + Intergenic
1079303927 11:19305834-19305856 TCCTGAGTAGCTGGTTCTACAGG + Intergenic
1079730068 11:23929180-23929202 TCCTGATTAGCTGGGTCTACAGG + Intergenic
1080008702 11:27436033-27436055 TCCTGAGTTGCTGGGAGTACAGG + Intronic
1081363243 11:42205346-42205368 TCCTGGTCTGCAGGTTGTGAAGG - Intergenic
1081878487 11:46427883-46427905 TCCTGATTAGCTGGGTCTACAGG - Intronic
1083713670 11:64563790-64563812 TCCTGAGTAGCAGGGTCTACAGG - Intronic
1084612276 11:70211144-70211166 TCCTGATTAGCTGGGTCTACAGG - Intergenic
1085500092 11:77012741-77012763 TCCTGATTTGTAGGTTCTGCAGG + Intronic
1085744476 11:79103021-79103043 CCCTCATCTGGAGGTTGTACTGG - Intronic
1087628319 11:100621836-100621858 TCCTCACATGCAGGTTGTTCTGG - Intergenic
1088282552 11:108150383-108150405 TCCTGAGTTGCAGGGACTACAGG - Intergenic
1088479869 11:110285587-110285609 TCCTGAGTTGCAGGGACTACAGG - Intronic
1092857562 12:12688994-12689016 TACACATTTGCAGGCTGTACAGG + Intronic
1092926928 12:13279945-13279967 CACTGTTCTGCAGGTTGTACAGG + Intergenic
1093190738 12:16071890-16071912 TCATGATTTACTGGTTATACAGG + Intergenic
1094450220 12:30576253-30576275 TACTGTTCTGCAGGCTGTACGGG + Intergenic
1095620602 12:44249013-44249035 TTCTGTTCTGCAAGTTGTACAGG + Intronic
1095736607 12:45564086-45564108 TCCTGATTTTCTGATTTTACAGG + Intergenic
1097084662 12:56458483-56458505 TCCTGATTTGCTGGGACTACAGG - Intronic
1098416163 12:70237548-70237570 TCCTGATTTACAGCTTGGTCAGG + Intergenic
1100190694 12:92188120-92188142 TCCTGAGTAGCAGGTATTACAGG - Intergenic
1101367543 12:104089084-104089106 TCCGCATTTGCAGGTTCCACAGG - Intronic
1102768048 12:115450642-115450664 TCCTGATGTGCAGGTTCTCCTGG - Intergenic
1107006209 13:35614901-35614923 TCCTGATATGAAGGTTGACCAGG + Intronic
1108225184 13:48282161-48282183 CCCTGATTTTCAGTTTGTACTGG + Intergenic
1109481897 13:62965817-62965839 TCCTGATTAGCAGGGACTACAGG - Intergenic
1109490958 13:63099731-63099753 TACTGTTCTGCAGGCTGTACAGG - Intergenic
1110697823 13:78512559-78512581 TCTTGATTTTCAGCTTGTTCTGG + Intergenic
1111443529 13:88313358-88313380 TCCTGATTAGCAGGGACTACAGG - Intergenic
1111922759 13:94429965-94429987 TCCTGAGTAGCTGGTTTTACAGG + Intergenic
1112257962 13:97852149-97852171 TCATGGTCTGCAGGCTGTACAGG + Intergenic
1112515396 13:100048924-100048946 TCATGGTCTGCAGGCTGTACAGG + Intergenic
1113976554 13:114231727-114231749 TACTGTTCTGCAGGCTGTACAGG - Intergenic
1114503460 14:23189683-23189705 TCCTGAGTTGCTGGTGCTACAGG - Intronic
1116903806 14:50386308-50386330 TCCTGAGTTGCTGGTATTACAGG - Intronic
1119476069 14:74929718-74929740 TTCTGATCTGCTGGTTGTACTGG + Intergenic
1121377649 14:93429348-93429370 TGCTGATTGGCAGGTTGCTCTGG - Intronic
1123001215 14:105295482-105295504 TCCTGAGTTGCTGGTACTACAGG - Intronic
1123136007 14:106027728-106027750 ACCTGATTTGCAGGTAGCAGTGG + Intergenic
1127301275 15:57656152-57656174 TCCTGATTTGGGGGTTGCTCTGG + Intronic
1129016272 15:72472077-72472099 TCCTGAGTTGCTGGTACTACAGG - Intergenic
1130360130 15:83176488-83176510 TGCAGATTTGCAGGCTGTAAGGG - Intronic
1130694930 15:86121555-86121577 TCTTCATTTGCAAGTTGTAGGGG + Intergenic
1132307698 15:100828751-100828773 CCCTGATTTGAAGGTTTTGCTGG - Intergenic
1135192154 16:20363292-20363314 TCCTGATTTGCTGGGACTACAGG + Intronic
1138908487 16:61367534-61367556 TCCTGATCTGCAGTCTGAACAGG - Intergenic
1138988420 16:62360921-62360943 GCCTGACTTACAGGTTTTACAGG - Intergenic
1139212472 16:65093058-65093080 TCCTGAGTAGCAGGGTTTACAGG + Intronic
1139398176 16:66657834-66657856 TCCTGAAATACAGTTTGTACAGG - Intronic
1139526842 16:67521978-67522000 TCCTGCTATGCAGGCTGTTCTGG + Intronic
1141240099 16:82257789-82257811 TCCTGAGTAGCCGGTTCTACAGG - Intergenic
1142782678 17:2193340-2193362 TACGGTTCTGCAGGTTGTACAGG - Intronic
1145025999 17:19468244-19468266 TCCTGAGTTGCTGGTATTACAGG + Intergenic
1147784466 17:42969217-42969239 TCCTGCTTTGCAGGGTCTACAGG - Intronic
1149041908 17:52200006-52200028 TCCTGAGTAGCTGGTTCTACAGG - Intergenic
1150932391 17:69599310-69599332 TCCTGATTTGGAGGGTGGAGAGG - Intergenic
1152082939 17:78199773-78199795 TTCTGAGATGCAGGTTCTACAGG + Intronic
1154187476 18:12198504-12198526 TTCTGTATTGCAGGTTGTGCAGG + Intergenic
1155295609 18:24381835-24381857 TCCTGAGTAGCTGGTTTTACAGG - Intronic
1155594349 18:27467568-27467590 TCCTGAGTAGCAAGGTGTACAGG + Intergenic
1155924877 18:31644912-31644934 TCCCGATTTTCAGTTTGTTCTGG - Intronic
1156745933 18:40391097-40391119 TCCTGAGTAGCAGGGAGTACAGG + Intergenic
1159537471 18:69733068-69733090 TCCTGAGTAGCTGTTTGTACAGG - Intronic
1164939348 19:32240094-32240116 TCAAGTTCTGCAGGTTGTACAGG - Intergenic
1166912079 19:46166020-46166042 TGCTGATTTCCAGGTGGTGCAGG - Intergenic
1167165906 19:47799772-47799794 TCCTGAGTAGCTGGTTTTACAGG - Intergenic
1167393691 19:49213111-49213133 TCCTGAGTAGCTGGTTCTACAGG + Intergenic
1167482657 19:49742619-49742641 TCCTGAGTAGCAGGTATTACAGG + Intronic
1168684945 19:58343309-58343331 TCCTGATTAGCTGGATCTACAGG - Intergenic
925381246 2:3427767-3427789 TCCTGAGTAGCTGGTAGTACTGG - Intronic
925775207 2:7328493-7328515 TCATGGTGTGCAGGCTGTACAGG - Intergenic
928494599 2:31819271-31819293 TCATGATCAGCAGGCTGTACAGG + Intergenic
928580937 2:32706921-32706943 TCCTCTTTTGCAGGTTGGAGAGG + Intronic
930985761 2:57586116-57586138 TCCTGATTAGCAGGGACTACAGG - Intergenic
931399806 2:61921099-61921121 TCCTGAGTAGCTGGTTCTACAGG + Intronic
932415390 2:71570463-71570485 TCCTAATTTGCAGCTTGGAGTGG - Intronic
933632513 2:84673632-84673654 TCCAGTTTTGGAGGTTGGACTGG - Intronic
936464934 2:112739437-112739459 CCCTGATTTCCAGAATGTACTGG + Intronic
937679404 2:124627393-124627415 TGCTGTTCTGCAGCTTGTACTGG + Intronic
938054809 2:128207026-128207048 TCCTGAGTAGCTGGTAGTACAGG + Intergenic
938966111 2:136389989-136390011 TCCTTATTTGCATCTTGTGCAGG + Intergenic
941181526 2:162264993-162265015 TCCTGATTAGCTGGGTTTACAGG + Intergenic
941791188 2:169553979-169554001 TCCTGAGTAGCTGGTTTTACAGG - Intronic
943361720 2:186927241-186927263 TCCTGAGTAGCTGGGTGTACAGG - Intergenic
945421777 2:209646974-209646996 TCATGGTTCACAGGTTGTACAGG + Intronic
947169611 2:227298226-227298248 TCCTGAGTTGCCGGTATTACAGG - Intronic
947497693 2:230650162-230650184 TCCTGAGTAGCTGGGTGTACAGG - Intergenic
1169083564 20:2813482-2813504 TGCAGTTTTGCAGGCTGTACAGG - Intergenic
1173278169 20:41602803-41602825 TCCTGAGTAGCAGGATCTACAGG + Intronic
1174142153 20:48422982-48423004 TCCTGATTAGCTGGTACTACAGG + Intergenic
1175069052 20:56316442-56316464 TGCTGAGTTGCAGGTTGTCAGGG - Intergenic
1175547776 20:59789905-59789927 TCCTGGCTTGCAGTTTGTGCTGG + Intronic
1175883627 20:62275083-62275105 TCCTGAGTTGCAGGTATTCCAGG - Intronic
1176037116 20:63044943-63044965 TCCTGGTTAGCAGGGTGTCCCGG - Intergenic
1177293348 21:19143824-19143846 TCCTGAGTAGCTGGTAGTACAGG + Intergenic
1177383079 21:20370909-20370931 TCCTGAAGTGCTGGTTTTACAGG - Intergenic
1177855749 21:26398702-26398724 TAGTGTTCTGCAGGTTGTACAGG + Intergenic
1177947984 21:27496646-27496668 TCCTGAATTGCTGGTATTACAGG - Intergenic
1178909020 21:36659402-36659424 TCCTGAGTAGCTGGTTTTACAGG + Intergenic
1179380695 21:40896471-40896493 TATGGTTTTGCAGGTTGTACAGG - Intergenic
1180858463 22:19063022-19063044 GCCTGATCTGCAGGCTGCACTGG + Intronic
1181552200 22:23646623-23646645 TCCTGAGTTGCTGGATCTACAGG - Intergenic
1182302872 22:29347772-29347794 TCCTGTTGTGGAGGTTGTGCTGG - Intronic
1182331483 22:29554289-29554311 TCCTGAATCCCTGGTTGTACGGG + Intronic
1182365217 22:29774232-29774254 TCCTGAGTTGCTGGGAGTACAGG + Intergenic
1183179821 22:36252573-36252595 TCCTGAGTAGCTGGTTCTACAGG - Intergenic
1185016429 22:48345844-48345866 TCCTGAATTGCAGGATGCCCAGG - Intergenic
953186441 3:40642354-40642376 TGCTGAGGTGCAGGTTGTTCTGG + Intergenic
955118991 3:56036751-56036773 TCCTGATTTGCAGGTTGTACAGG - Intronic
955296601 3:57740988-57741010 TCCTGAGTAGCAGGGAGTACAGG - Intergenic
955358017 3:58247696-58247718 TCCTGAGTTGCAGGGACTACAGG + Intronic
957220497 3:77376276-77376298 TCCTGAGTAGCAGGTATTACAGG + Intronic
957826788 3:85457287-85457309 TCCTGAGTTGCTGGGAGTACAGG - Intronic
957850783 3:85805062-85805084 TCCTGATTAGCTGGGAGTACAGG + Intronic
959061804 3:101623041-101623063 TCCTGAGTTGCAGGGCCTACAGG + Intergenic
960242466 3:115361584-115361606 TGCAGTTTTGCAGGCTGTACAGG + Intergenic
961014164 3:123454623-123454645 TCCTGAGTAGCTGGTTTTACAGG - Intergenic
961139943 3:124547434-124547456 TCCTGAGTAGCTGGTTCTACAGG + Intronic
961192280 3:124971910-124971932 TCCTGAGTAGCTGGATGTACAGG + Intronic
962387926 3:134947912-134947934 TCCTGAATAGCTGGTTCTACAGG + Intronic
963181644 3:142362892-142362914 TCCTGATTAGCTGGGAGTACAGG + Intronic
963601349 3:147381323-147381345 TCCTGGGATGCAGGTTGTTCTGG - Intergenic
968445079 4:648350-648372 TCCTGACTTGCAGGAGGCACAGG + Intronic
969091581 4:4697950-4697972 TCCTGATTAGCAGGGACTACAGG + Intergenic
971635842 4:29056334-29056356 TCCTGAGTTGCAGGGATTACAGG - Intergenic
975723421 4:77269751-77269773 TCTTGATTTGCAGGTTTGAGCGG + Intronic
977725928 4:100296822-100296844 TACTGTTCTGCAGGCTGTACAGG - Intergenic
979243346 4:118469706-118469728 TCCTGAGTTGCTGGGAGTACAGG - Intergenic
981447064 4:144852160-144852182 TCCTGATTTGGTGGTTGTTCAGG - Intergenic
981621226 4:146701062-146701084 TCCTGAGTTGCAGGGATTACAGG - Intergenic
982697810 4:158623376-158623398 TCCTGATTTGCTGGGATTACAGG - Intronic
983581637 4:169315365-169315387 TCTTGATTTACAGCCTGTACTGG + Intergenic
985897809 5:2759581-2759603 TCTTGGTTTTCAGGCTGTACAGG - Intergenic
986048379 5:4063360-4063382 TATTGTTGTGCAGGTTGTACAGG - Intergenic
987183206 5:15387537-15387559 CACGGTTTTGCAGGTTGTACAGG + Intergenic
988096667 5:26621645-26621667 CCCTGTTTTGTAGGTTGTAATGG - Intergenic
988519087 5:31930126-31930148 CACTGTTCTGCAGGTTGTACAGG - Intronic
988566901 5:32326648-32326670 TCCTGAATTGCTGGTATTACAGG - Intergenic
990773010 5:59271295-59271317 TCCTAAATTGCAGGTATTACAGG + Intronic
991059105 5:62352674-62352696 TCCTTTTTTGCAGCTTGAACTGG - Exonic
992426305 5:76661509-76661531 TCCTGAGTTTCAGGTAGTACTGG - Intronic
993927827 5:93893141-93893163 GCCTGATTTGCAGGTGTTCCTGG + Intronic
994359407 5:98832916-98832938 TCCTGAGTAGCTGGTAGTACAGG - Intergenic
994361916 5:98861623-98861645 TCCTGAGTAGCTGGTTCTACAGG + Intronic
994575975 5:101580163-101580185 TCAGGGTTTGCAGGCTGTACAGG - Intergenic
998496068 5:142590613-142590635 TCCTGGTATGCAGCTTATACAGG - Intergenic
999286018 5:150394791-150394813 TCCTGAGTTGCTGGGAGTACAGG - Intronic
999322922 5:150625873-150625895 TCCTGAATGGCAGGTGGCACTGG + Intronic
999405871 5:151306099-151306121 TCCTGATTTGCTGGGATTACAGG - Intergenic
1001855646 5:175008141-175008163 GACTGATTTGCAGGTTGAAATGG + Intergenic
1003538461 6:6997098-6997120 TCCTGAATTTTAGATTGTACAGG - Intergenic
1004323776 6:14654824-14654846 TCATGTTCTGCAGGCTGTACAGG + Intergenic
1005765444 6:29006799-29006821 TCCTGAAATGTAGTTTGTACAGG + Intergenic
1007346717 6:41236596-41236618 TCCTGATCTGCAGGTGCCACAGG + Exonic
1008175883 6:48267661-48267683 TCCTGAGTAGCAGGGAGTACAGG + Intergenic
1008188437 6:48423988-48424010 TCCTTATTTGCAGGTTTCAAGGG - Intergenic
1008657728 6:53633040-53633062 TCCTGATTAGCTGGGAGTACAGG + Intergenic
1009906908 6:69881123-69881145 TCCCATTTTGCAGGTCGTACTGG + Intronic
1010205894 6:73322434-73322456 TCCTGAGTAGCTGGTTCTACAGG - Intergenic
1011044967 6:83071328-83071350 TCCTGATTAGCTGGTATTACAGG + Intronic
1011166925 6:84458822-84458844 TCCTGATTTCCTGGCAGTACTGG + Intergenic
1015874280 6:137807293-137807315 CACAGATCTGCAGGTTGTACAGG - Intergenic
1016372779 6:143392063-143392085 TTATGTTTTGCAGGCTGTACAGG - Intergenic
1016851081 6:148619641-148619663 TCCTGGTTTGGAGGGTGTAGCGG + Intergenic
1020198826 7:6063422-6063444 TCCTGATTAGCTGGGTCTACAGG - Intergenic
1020890866 7:13876458-13876480 TCAAGTTTTGCAGGCTGTACAGG + Intergenic
1022577130 7:31508247-31508269 TACTATTCTGCAGGTTGTACAGG - Intergenic
1022858243 7:34338568-34338590 CCCAGTTTTGCAGGCTGTACAGG + Intergenic
1025855083 7:65269512-65269534 TCCTGGTTTCCAGGATGTCCTGG - Intergenic
1027140484 7:75653528-75653550 TCCTGATTAGCTGGTACTACAGG - Intronic
1027433869 7:78143075-78143097 TCCTGAGTTGCTGGTTTTATTGG - Intronic
1027543054 7:79492455-79492477 TACAGTTTTGCAGGCTGTACAGG - Intergenic
1028486812 7:91368022-91368044 TCCAGATTTGCAGGGGGTAGAGG - Intergenic
1029939744 7:104467488-104467510 TTGTGAAGTGCAGGTTGTACAGG + Intronic
1030873115 7:114781971-114781993 TACAGTTCTGCAGGTTGTACAGG + Intergenic
1031051586 7:116950776-116950798 TCCTGAGTAGCTGGTAGTACAGG + Intergenic
1032258739 7:130317585-130317607 TCCTGAGTAGCTGGTAGTACAGG + Intronic
1033834855 7:145297688-145297710 TCCAGATTTACAAATTGTACTGG - Intergenic
1034636676 7:152572812-152572834 TCCTGATTAGCAGGGACTACAGG - Intergenic
1035085890 7:156257634-156257656 TCGTGGTCTGCAGATTGTACAGG + Intergenic
1035181796 7:157094721-157094743 TCCTGAGTTGCTGGGAGTACAGG + Intergenic
1036008357 8:4692715-4692737 TCCTGATTTGCACGTTATCGGGG - Intronic
1037996589 8:23356891-23356913 TCTTGTCTTGCAGGTTGTAAGGG + Intronic
1038428716 8:27482703-27482725 TCACGGTTTGCAGGCTGTACAGG - Intergenic
1038580195 8:28741572-28741594 TCCTGAGTAGCAGGCAGTACAGG + Intronic
1038751658 8:30301687-30301709 TCCTGATTAGCTGGGTCTACAGG - Intergenic
1039803367 8:40978906-40978928 TTCTGAATTGCAGGTTGTAAGGG - Intergenic
1041236835 8:55811635-55811657 TCCTGAGTTGCTGGGAGTACAGG - Intronic
1043178906 8:77058778-77058800 TCTTGATTTGCTGGGTCTACAGG - Intergenic
1043232350 8:77818997-77819019 TCCTGAATGGCAGGTTGAAATGG + Intergenic
1044128271 8:88485706-88485728 TCCTGGTTTGAAGGTTGCAGTGG + Intergenic
1044515767 8:93136674-93136696 TCGTGGTCTGCAGGCTGTACAGG + Intronic
1045312050 8:101011425-101011447 TCCTGAGTAGCTGGGTGTACAGG + Intergenic
1045453647 8:102354195-102354217 TCCAGATTTGCAGGTTTTCTTGG + Intronic
1046046111 8:108966764-108966786 TTATGATCTGCAGGCTGTACAGG - Intergenic
1046060115 8:109128940-109128962 TCCTGAGTAGCTGGGTGTACAGG - Intergenic
1046537325 8:115531944-115531966 TTCTGAGTTGCTGGTTGTATGGG + Intronic
1047401182 8:124548885-124548907 TCATGATTTGGAAGTTGTGCTGG + Intronic
1048038080 8:130696486-130696508 TCCTGTTTTGCAGGCTGTACAGG - Intergenic
1050235123 9:3569706-3569728 TCCTGCTTAGCAGGATGTAGAGG - Intergenic
1052021456 9:23530509-23530531 TCCTGAGTAGCTGGTTCTACAGG - Intergenic
1052180227 9:25517669-25517691 TCCTGAGTAGCAGGGTCTACAGG - Intergenic
1053375943 9:37606371-37606393 GTCTGATTTGCTTGTTGTACTGG + Intronic
1054810307 9:69429040-69429062 CCGTTATGTGCAGGTTGTACAGG + Exonic
1054901948 9:70378176-70378198 TCATGCTCTGCAGGCTGTACAGG - Intergenic
1055055919 9:72024010-72024032 TCATGGTCTGCAGGCTGTACAGG + Intergenic
1055691887 9:78841063-78841085 TGCTGATTTTCAGGGTGGACTGG + Intergenic
1056165032 9:83932804-83932826 TCCTGAAATGCAGTTAGTACAGG + Intergenic
1059032262 9:110711437-110711459 TCCAGCCTTGCAGGTTGTAAGGG + Intronic
1059387470 9:113975948-113975970 TCCTAAATTGCAGGTTGAATGGG + Intronic
1059509087 9:114827210-114827232 TCTTGATGAGCAGGTTGTAGAGG - Intergenic
1060019721 9:120118545-120118567 TCATGTTCTGCAGGCTGTACAGG - Intergenic
1060649566 9:125313723-125313745 TCCTGAGTTGCTGGTCTTACAGG + Intronic
1062039990 9:134400161-134400183 TCCTGAGATGCAGGGTGCACAGG + Intronic
1062520649 9:136956371-136956393 TCCTGCTGGGCAGGCTGTACAGG + Intronic
1186518288 X:10183667-10183689 GCCTGATTTACAGATTGCACAGG - Intronic
1190104638 X:47550741-47550763 TCCTGATTAGCTGGGTTTACAGG - Intergenic
1190153957 X:47972800-47972822 TACTGTTCTGCAGGCTGTACAGG + Intronic
1192394308 X:70762908-70762930 TCCTGAGTTGCTGGGAGTACAGG - Intronic
1193119273 X:77806528-77806550 TCCTGATTTGCTGGGATTACAGG + Intergenic
1193192219 X:78584137-78584159 TACAGTTCTGCAGGTTGTACAGG - Intergenic
1193371736 X:80706769-80706791 TCCTGCGTAGCAGGGTGTACAGG - Intronic
1193478897 X:82002413-82002435 TACTAATTTGGAGGTTGTAATGG - Intergenic
1195735187 X:108005289-108005311 TCATGGTCTGCATGTTGTACAGG - Intergenic
1196371615 X:114985477-114985499 TCCTGCTTTACAGTTGGTACAGG - Intergenic
1197401141 X:125992356-125992378 CCCTGACCTGCAGGTGGTACTGG - Intergenic
1197809873 X:130431758-130431780 TCCTGAGTAGCTGGTAGTACAGG + Intergenic
1201017274 Y:9618538-9618560 TCCTGATTAGCAGGGACTACAGG - Intergenic
1201480358 Y:14432308-14432330 TTCTGATCTGCAGGTTGAGCCGG - Intergenic