ID: 955121552

View in Genome Browser
Species Human (GRCh38)
Location 3:56064798-56064820
Sequence CTGCAGCCCATGGGCCAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955121548_955121552 22 Left 955121548 3:56064753-56064775 CCTAGAGGCTGTAAGAACTTGTG 0: 1
1: 0
2: 1
3: 23
4: 198
Right 955121552 3:56064798-56064820 CTGCAGCCCATGGGCCAAACTGG 0: 1
1: 0
2: 2
3: 19
4: 198
955121549_955121552 -8 Left 955121549 3:56064783-56064805 CCAGAGTTGAGCAAACTGCAGCC 0: 1
1: 0
2: 1
3: 22
4: 183
Right 955121552 3:56064798-56064820 CTGCAGCCCATGGGCCAAACTGG 0: 1
1: 0
2: 2
3: 19
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955121552 Original CRISPR CTGCAGCCCATGGGCCAAAC TGG Intronic
900140825 1:1138959-1138981 CTGGACCCCAGGGGCCACACTGG + Intergenic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900606509 1:3525961-3525983 GTGCAGCCCCTGGGCTAACCTGG + Intronic
901089161 1:6629912-6629934 CTGCAGCCCCTGGGCCACACTGG - Intronic
901097222 1:6691721-6691743 CAACAGTCCATGAGCCAAACAGG + Intronic
901183748 1:7358988-7359010 CAGCAGCCCATGTGGCACACTGG + Intronic
901668273 1:10838696-10838718 CTGCAGCCTCTGGGCCAGGCAGG - Intergenic
902276194 1:15341238-15341260 CTACAGCCCACAGGCCAAATCGG - Intronic
903156186 1:21445388-21445410 CTGCAGGCCATGGGCGGCACAGG - Intronic
904314490 1:29651496-29651518 CTGCAGCCCAGGCCCCACACAGG + Intergenic
904384679 1:30133484-30133506 CTGCAGCCCAGGCCCCACACAGG - Intergenic
905322615 1:37128715-37128737 CTGCAGCTGAGGGGACAAACGGG - Intergenic
906256620 1:44355333-44355355 CTGCAGCCCATTGGTCAAAGGGG - Intergenic
906931330 1:50172495-50172517 CTACAGCTCATGGGCCAAATTGG + Intronic
907544341 1:55246528-55246550 CTGCTGCCCATTGGCCTAAAGGG + Intergenic
912311896 1:108631249-108631271 CTATAGCCCATAGGCCAAATTGG + Intronic
916575169 1:166060410-166060432 CAGCTCCCCATGGGCCAAGCAGG + Intronic
916830071 1:168481759-168481781 CTGCGGCTCATGGGCCAATCTGG + Intergenic
917480328 1:175406310-175406332 CTGCAGCACCTGGGCTGAACTGG + Exonic
918091389 1:181298081-181298103 CTGCAGCCCAAGTGCCATGCTGG - Intergenic
922891166 1:229062783-229062805 CTGCAGCCCATGGGAAGCACAGG - Intergenic
1067498084 10:46776354-46776376 GTGCAGTCCATGGGCCAGGCGGG + Intergenic
1067596562 10:47564060-47564082 GTGCAGTCCATGGGCCAGGCGGG - Intergenic
1068771668 10:60828414-60828436 CTGCTGCCCATGGGAGAAGCTGG - Intergenic
1070746829 10:78938818-78938840 CTGCAGCCCTTGGCCAACACTGG + Intergenic
1074450074 10:113552118-113552140 ATGCAGTCCACGTGCCAAACAGG + Intronic
1074643473 10:115417040-115417062 CTGGAGCCCAAGGCCCAAAGAGG + Intronic
1075292718 10:121244066-121244088 CTACAGCCTATGGGCCAATCTGG - Intergenic
1076639253 10:131902459-131902481 CTGCGCCCCCTGGGACAAACAGG + Intronic
1076763051 10:132615223-132615245 CCGCAGCCCGTGGGCCACAATGG + Intronic
1076877642 10:133224352-133224374 CTGCAGCCCCTGCGGCAGACTGG + Intronic
1077925828 11:6681453-6681475 CTCCACCCCTTTGGCCAAACTGG + Exonic
1078164211 11:8868902-8868924 CTGCGGCCCATGGGCCGCCCAGG + Intronic
1078649329 11:13172743-13172765 CTGCAGCCAGTGAACCAAACTGG + Intergenic
1078849627 11:15151804-15151826 CTGGAGCCCAGGGTCCACACAGG + Intronic
1080292325 11:30684860-30684882 CTGGCACCCAGGGGCCAAACAGG - Intergenic
1083156360 11:60825751-60825773 CTGGAGCCCATGGGCCACAGAGG - Intergenic
1089956347 11:122574728-122574750 CTACAGCCTGTGGGCCAAAGTGG + Intergenic
1091353336 11:134914992-134915014 CTGCAGGCCAAGGACCATACTGG + Intergenic
1095194834 12:39301600-39301622 CTGCAGCCACTGAGCAAAACTGG + Exonic
1095721858 12:45409439-45409461 CTGCAGCCTATGGGCAAACTGGG + Exonic
1096243169 12:49970219-49970241 CGGCAGCCCATGTGCCACAGTGG + Intronic
1096599482 12:52719130-52719152 ATGCAGGCCTTGGGCTAAACTGG - Intergenic
1101851023 12:108402346-108402368 CTGAAGCCCCTGGGCTAAAGGGG + Intergenic
1102563885 12:113781938-113781960 CTGTGACCCATGGGCCAATCTGG + Intergenic
1102935101 12:116889881-116889903 CTATAGCCTATGGGCCAATCTGG + Intergenic
1104183773 12:126408672-126408694 CTGCAGCCCAGGGTTCAAGCTGG + Intergenic
1105751461 13:23425373-23425395 CTGGGGCCTATGTGCCAAACTGG + Intronic
1110046820 13:70842131-70842153 CTGCTGCCCGTGGGCCAAGAAGG + Intergenic
1111058058 13:82974944-82974966 CTGCTGACCATCTGCCAAACTGG + Intergenic
1112422587 13:99266447-99266469 CTGCAGCCCATGGGCCACATGGG - Intronic
1112533949 13:100231367-100231389 CTGCAGCCCAAGGCCCAGGCAGG - Intronic
1114740937 14:25096416-25096438 CTGAAGTCCATGGGCCTAACAGG - Intergenic
1115784559 14:36809836-36809858 CTGCAGGCCACAGGCCAAACTGG + Intronic
1121652759 14:95571867-95571889 CTAAAGCCCATGGGCCATGCTGG - Intergenic
1121698504 14:95932796-95932818 CTGCAGCCCTGGGTTCAAACTGG + Intergenic
1122464650 14:101922994-101923016 CTGCAGCCCACGGGCAGACCCGG - Intronic
1122536986 14:102472227-102472249 CTGCAGCCATGGGGCCACACAGG + Intronic
1124250449 15:28103667-28103689 GTGTAACCCATGGGCCAATCTGG + Intergenic
1125878297 15:43168778-43168800 CTGCAGTCCTTGGGCAAATCTGG - Intronic
1126124362 15:45282123-45282145 CTGAAGCACATTGGCCAAAATGG + Intergenic
1128708761 15:69856685-69856707 CTGCAGGCCCTGGGCCCAAGGGG - Intergenic
1129717500 15:77860689-77860711 CTGCTGCCCCTGGGCCACTCTGG + Intergenic
1129731879 15:77937051-77937073 CTGCAGCCCAGGGGTCAGTCTGG - Intergenic
1130371527 15:83288747-83288769 AAGCAGCACTTGGGCCAAACTGG + Intergenic
1130461252 15:84159508-84159530 CTGCTGCCCCTGGGCCACTCTGG - Intergenic
1131268289 15:90931761-90931783 CAGTAGCCCCGGGGCCAAACTGG - Exonic
1131532379 15:93204915-93204937 CTGCATTCCATGGGCCAGGCCGG - Intergenic
1131564364 15:93472539-93472561 CTTCTGCCCAAGGGCCAAAAGGG - Intergenic
1132103918 15:99049312-99049334 TTACAGCCCATGGTCCACACTGG + Intergenic
1132502778 16:291965-291987 CTGGAGCCCAGCAGCCAAACGGG + Intronic
1136136468 16:28259396-28259418 CCGCAGCCCATGGGCCAGGCCGG - Intergenic
1136249567 16:28995309-28995331 CTCCAGCACATGGGCCAAAGTGG + Intergenic
1138603435 16:58071579-58071601 TGGCAGCCCATAGGCCAAAGAGG + Intergenic
1139480496 16:67227830-67227852 CTGCAGCCCAAGGGCAAAGTGGG + Exonic
1140156232 16:72429556-72429578 CTACAGCTCTTGGGACAAACAGG + Intergenic
1140628540 16:76823805-76823827 TTCCAGCCCATGGTCCAACCAGG + Intergenic
1141361885 16:83403052-83403074 CTGAAGCCCAAGGGGCAAACTGG + Intronic
1142518086 17:446364-446386 CTCCAGCTGATGGGCCCAACTGG + Intergenic
1142644913 17:1305343-1305365 CTGCAGCCCCTGGACCAGGCTGG + Intergenic
1142742036 17:1936958-1936980 CCGCAGCCCAGGGGACACACAGG + Exonic
1142742831 17:1940942-1940964 CTGCAGCCCAAGGGACGAAATGG - Intronic
1143086804 17:4422167-4422189 CTGCATTCCATTGGCCACACAGG - Intergenic
1143363502 17:6390111-6390133 AGACAGCCCATGGGCCAAATTGG - Intergenic
1143498387 17:7325189-7325211 CCCCACCCCATGGGCCATACTGG + Exonic
1143734451 17:8900688-8900710 CTGCAGCACAAGGGCCAGGCAGG - Intronic
1143995332 17:11001764-11001786 CTACATCCCGTGGGCCAATCTGG + Intergenic
1144788483 17:17844728-17844750 CTGCCGCCCAGTGGCCAAAAAGG + Intronic
1145960059 17:28881996-28882018 CTGCAGCTCATAGGCCAACTGGG + Exonic
1146180385 17:30694231-30694253 CGGCAGCCCTGGGGCCAAACTGG + Intergenic
1146705243 17:34996430-34996452 CTGAAGCCCCTGGGCCATAAGGG - Intronic
1147614358 17:41819583-41819605 CTGCAGCCCCTGGTCCATCCCGG - Exonic
1149601847 17:57898473-57898495 CTGCAGCTTATGGGGCAAGCAGG + Intronic
1149850454 17:60030675-60030697 CTGAAGCCCATGGACCACAATGG + Intergenic
1149859712 17:60115849-60115871 CTGAAGCCCATGGACCACAATGG - Intergenic
1151181128 17:72329480-72329502 CTGCAGAACATGGGCCATGCAGG + Intergenic
1152114535 17:78377458-78377480 CTGCAGCCTCTGGGGCTAACAGG + Intergenic
1152512647 17:80800980-80801002 CTGCTGTCCCTGGGCCACACGGG - Intronic
1153267553 18:3285973-3285995 CTGCAGCACTTCGGCCAAAAAGG + Intergenic
1155686383 18:28556848-28556870 CTGCAGCTCATGGGTCAAAGAGG + Intergenic
1156062825 18:33101577-33101599 CTGTATCCCATGGGCCAAGAAGG - Intronic
1157300378 18:46474723-46474745 GTGCAGCCCAGAGTCCAAACTGG - Intergenic
1157635479 18:49149290-49149312 CAACAGCCCATGGACCATACTGG + Intronic
1157711006 18:49849746-49849768 CGGCTGCCCATGGGCCGCACTGG - Intronic
1157901736 18:51524580-51524602 CTACAGCCTGTGGGCCAAATTGG + Intergenic
1160190008 18:76708136-76708158 CTGCAGCCCAACAGCCACACAGG + Intergenic
1160376459 18:78417024-78417046 CTGCAGCCCACACGCCAACCTGG - Intergenic
1161876676 19:6917176-6917198 CTGTGGCCTATGGGCCAATCTGG - Intronic
1162519702 19:11172604-11172626 CTGCAGCCCTGAGTCCAAACTGG + Intronic
1162667889 19:12230493-12230515 CTGCAGCCCAAGAGGCCAACTGG - Intronic
1162978215 19:14221306-14221328 CGGCAGCCCTGGGGCCAAACTGG - Intergenic
1164616219 19:29668239-29668261 CAGCAGCCCTGGGGCCACACTGG + Intronic
1166080800 19:40443214-40443236 CAGAAGCCCCTGGGCCAAATTGG - Intronic
1166382364 19:42361787-42361809 CTGCAGCCCCTTGCCCAACCTGG - Intronic
1166981006 19:46631961-46631983 CTCCAGCCCTTGGGCCAACCAGG + Intergenic
927510825 2:23642770-23642792 CTGCAGCCCGTGGGCCGAGTCGG - Exonic
929215944 2:39413423-39413445 GTGCAGCCCAGGGGACAGACTGG + Intronic
931416213 2:62083443-62083465 CTTCAGCCCATGGGCAAGTCTGG - Intronic
932033872 2:68220434-68220456 CATGATCCCATGGGCCAAACTGG + Intronic
933549007 2:83750567-83750589 CTGCAGCCCATGGTTCAAGGAGG + Intergenic
937878298 2:126843463-126843485 CTGCATGCCATTGGCCACACAGG + Intergenic
938341876 2:130541267-130541289 CCGCATCCCATAGGCCAAAAAGG + Intronic
938347954 2:130579444-130579466 CCGCATCCCATAGGCCAAAAAGG - Intronic
939035461 2:137125822-137125844 CTGTAGCCCATGGACCAAGGAGG - Intronic
939095887 2:137832601-137832623 CTGCATGCCATGGGCCCTACAGG - Intergenic
939311910 2:140490739-140490761 CAGCAGCCCATAGGCAAAACTGG + Intronic
939568022 2:143807828-143807850 CTGCAGCACATTTGCCTAACAGG + Intergenic
940079021 2:149779028-149779050 CTGCTGCCCATGGGTCGAAGAGG + Intergenic
940899858 2:159116700-159116722 CTACAGCCCAGGGGCCAAATTGG - Intronic
942452409 2:176116486-176116508 CTTCGGCCCCTGGGCCCAACCGG - Intronic
943616483 2:190098264-190098286 CTGTAGCCCATGGATCAAGCAGG - Intronic
947362767 2:229363284-229363306 CTGCAGCCCAGCAGCCACACAGG - Intronic
948029189 2:234802421-234802443 CTGCAGCTCATGGGCAGCACTGG + Intergenic
948316267 2:237030611-237030633 CAGCAGCCCATGGCCCCAAGCGG + Intergenic
1169030610 20:2403857-2403879 CTGCAGCTGATGGGCCATCCGGG - Intronic
1171134734 20:22686194-22686216 CTGCAGCGCATGGGCACAGCTGG - Intergenic
1171970489 20:31562015-31562037 CAGCATCTCATGGGCCAGACTGG + Intronic
1173217560 20:41100255-41100277 CTTCATCCTATGGGCCAAAAAGG + Intronic
1175088277 20:56479683-56479705 CTGCAGCCCATGGATCAAGGTGG - Intronic
1175443431 20:59005891-59005913 CTACAGCCCATGGCCTAACCTGG - Intronic
1178391260 21:32200249-32200271 CTACTCCCCATGAGCCAAACTGG - Intergenic
1179589655 21:42398018-42398040 CTGCACCTCATGGGCCACAAGGG + Intergenic
1179719021 21:43305095-43305117 CAGCAGCCCATGGGGGAAGCAGG - Intergenic
1179909246 21:44439197-44439219 CTGCAGCCCTGGGGACACACAGG - Intronic
1180137652 21:45871618-45871640 CTGCAGTCCCTGAGCCTAACCGG + Intronic
1181033354 22:20158557-20158579 CTGCTGCCCAAGGGCCCACCTGG - Intergenic
1182052939 22:27327065-27327087 TTGCAGCCCATTGGCCTACCTGG - Intergenic
1185153547 22:49179944-49179966 CTGCAGCCCAGGGGCAACACAGG - Intergenic
951768733 3:26230674-26230696 CTACATCCCATGGGCCACATTGG - Intergenic
952990058 3:38823957-38823979 CTGCAGCCCCAGGGCCCAGCAGG - Intergenic
954332263 3:49897368-49897390 CTCCTGCCCGTGGGCCAAAGAGG + Exonic
954577286 3:51683592-51683614 CTGCAACCCATGGCCCATCCAGG - Intronic
954794978 3:53156833-53156855 CTGTTTCCCATGGGCCAAGCTGG + Intronic
955121552 3:56064798-56064820 CTGCAGCCCATGGGCCAAACTGG + Intronic
956660151 3:71589418-71589440 CAGCAGCCCATGAGCCATCCTGG + Intergenic
956688458 3:71854431-71854453 CAGCAGCCCATGGGCCCTCCTGG - Intergenic
961513734 3:127420157-127420179 CTGCAGCCCATGGGCAGGAGGGG + Intergenic
962740478 3:138359684-138359706 CTGCAGGACATGGGCCAGCCTGG - Intronic
964373094 3:156022110-156022132 CTCCATCCTATGGGACAAACTGG - Intergenic
964762626 3:160148694-160148716 CTGTAGAACATGGGCCATACAGG - Intergenic
967825072 3:193871043-193871065 CTGAAGCCCATGAGCCAGCCAGG + Intergenic
969306886 4:6330905-6330927 CTGCAGCCCAGGGGCCCAAGGGG - Intronic
969341291 4:6543354-6543376 CTGCCTCCTATGGGCCAACCAGG + Intronic
971195974 4:24471954-24471976 CTGCAGCCCCTCGGCGCAACTGG + Intergenic
971543400 4:27851690-27851712 CTGCATTCCATTGGCAAAACGGG + Intergenic
976161223 4:82201496-82201518 CTGCAGTCCATGGGCAAGTCTGG + Intergenic
976938630 4:90671833-90671855 CTGCAGCCCATGGATCAAGAAGG - Intronic
982534148 4:156587346-156587368 CTGTAGCCCATAGGCCAATGTGG - Intergenic
984819496 4:183867886-183867908 CTGCATCCCCTGAGCCATACCGG - Intronic
986033601 5:3916816-3916838 CTGCAGACCATGGGCAAAGTAGG + Intergenic
994318468 5:98361169-98361191 ATGCAGACCCTGGGCCAAAGAGG - Intergenic
997634303 5:135393476-135393498 ATGCAGAACATGGGTCAAACAGG - Intronic
998197004 5:140082507-140082529 CTGAAGCCCATGGTCTTAACTGG + Intergenic
1001927333 5:175648010-175648032 CTCCATCACATTGGCCAAACTGG + Intergenic
1002334175 5:178466663-178466685 CTGCAGCCCCTTGGCCATGCTGG + Intronic
1003520023 6:6850516-6850538 CTCCAGCACAGGGGCCAAGCAGG - Intergenic
1003564207 6:7208696-7208718 CTGCAGTCCTTGAGCAAAACTGG + Intronic
1004658000 6:17683378-17683400 CTGCAGCCCATGGATCAAGGAGG - Intronic
1005137256 6:22583927-22583949 CTGATGCCCATGGGCCACATAGG + Intergenic
1006837486 6:37007769-37007791 CTGCAGCTCATGGGCGTAGCTGG - Intronic
1011263411 6:85491184-85491206 CTGCAGTCCATGAGATAAACAGG - Intronic
1011699544 6:89942762-89942784 CAGCAGGCCAAGGGCCAAACAGG + Intronic
1013172773 6:107652079-107652101 CTGCAGCCCATGGATCAAGGAGG + Intronic
1014264464 6:119260233-119260255 CTACAGCCCTTTGGCCAAATTGG - Intronic
1016344054 6:143092456-143092478 CTGCAGCCCATGGATCAAGAGGG - Intronic
1017060724 6:150482425-150482447 TTGCAGCCCATGGCCCAGCCAGG - Intergenic
1018146891 6:160900104-160900126 CTGCAGCCCAAGGGCAATAAGGG - Intergenic
1019479041 7:1257610-1257632 CTGCTACCCAGGGGCCAACCAGG - Intergenic
1019745930 7:2700390-2700412 CTGCTGTCCATGGGCCACCCGGG - Exonic
1019756136 7:2771600-2771622 CTGCAGCATATGGGCGAATCTGG - Intronic
1020376646 7:7494988-7495010 CAGCAGCCCGTGAGCCCAACAGG + Intronic
1024116117 7:46195505-46195527 CTGCATTCCATGGGCCACAGGGG - Intergenic
1029126341 7:98297389-98297411 CTGCAGCCCAAGGGAAAAAGTGG - Intronic
1032154908 7:129459704-129459726 CTGCAGTCCTTTGGCCAAATAGG + Intronic
1032796132 7:135277518-135277540 CTGCAGCCCATGGTGAAATCTGG + Intergenic
1032820097 7:135516446-135516468 CTGCAGCCCACAGGCCACATGGG + Intergenic
1032844006 7:135737165-135737187 CTGCCGCCCACCGGCCAAAGAGG - Exonic
1033536943 7:142321063-142321085 CTGGAGCCCATGGCACAAAGGGG - Intergenic
1035017773 7:155781609-155781631 CTGCAACCCAGCGGCCAATCTGG - Intergenic
1036708485 8:11062047-11062069 CTGCATTCCATGGGACAGACAGG + Intronic
1040737156 8:50522155-50522177 CTGCAGCCCATGGATGAAAAAGG - Intronic
1043271017 8:78333544-78333566 CTGAAGCACATGGGCCATCCAGG + Intergenic
1049268188 8:141680743-141680765 CTGAGGCCCATGGGCCTGACTGG + Intergenic
1049356922 8:142193566-142193588 ATGCATCGCATGGGCCACACCGG + Intergenic
1051731616 9:20149243-20149265 CTGAATCCCAACGGCCAAACTGG - Intergenic
1054994584 9:71371190-71371212 CTGCAGCCCATGGATCAAGGAGG + Intronic
1057196836 9:93120138-93120160 CTGCAGGCCATGGCCAAATCAGG + Intergenic
1060959734 9:127671578-127671600 CTGCACCCAATGGGCAAGACAGG - Intronic
1061135236 9:128729929-128729951 ATGCAGCCCATCTGCCAAGCTGG + Exonic
1061876158 9:133545193-133545215 CTGCACCCCTTGGGCCACAGTGG + Intronic
1189174649 X:38943653-38943675 CTGCAGCCCATGGATCAAGGAGG + Intergenic
1191252724 X:58267140-58267162 CAGCAGCCCCTGGGCCAGGCTGG - Intergenic
1192759913 X:74086203-74086225 CTGCAGCTACTGGGCCACACTGG + Intergenic
1195980441 X:110571632-110571654 CTACAGCTCATAGGCCAAATCGG - Intergenic
1196619014 X:117800634-117800656 CTGCAGCCCATGGATCAAGGTGG - Intergenic
1199079048 X:143556091-143556113 CTCCAGGCCATGGACCAGACCGG + Intergenic
1199213849 X:145245109-145245131 CTCCAGGCCATGGACCAGACCGG - Intergenic
1200743091 Y:6876792-6876814 CTGCTGCCACTGGGCCAAAAAGG + Intergenic
1202378004 Y:24255636-24255658 CTGCTGCCCCTGGGCCACTCTGG + Intergenic
1202492778 Y:25414485-25414507 CTGCTGCCCCTGGGCCACTCTGG - Intergenic