ID: 955128088

View in Genome Browser
Species Human (GRCh38)
Location 3:56134796-56134818
Sequence CACTGTCATATAACACATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955128086_955128088 18 Left 955128086 3:56134755-56134777 CCTTCTCTGGCTTATTTGGGACA 0: 1
1: 0
2: 1
3: 15
4: 192
Right 955128088 3:56134796-56134818 CACTGTCATATAACACATCTTGG 0: 1
1: 0
2: 0
3: 8
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955128088 Original CRISPR CACTGTCATATAACACATCT TGG Intronic