ID: 955128088 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:56134796-56134818 |
| Sequence | CACTGTCATATAACACATCT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 135 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 8, 4: 126} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 955128086_955128088 | 18 | Left | 955128086 | 3:56134755-56134777 | CCTTCTCTGGCTTATTTGGGACA | 0: 1 1: 0 2: 1 3: 15 4: 192 |
||
| Right | 955128088 | 3:56134796-56134818 | CACTGTCATATAACACATCTTGG | 0: 1 1: 0 2: 0 3: 8 4: 126 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 955128088 | Original CRISPR | CACTGTCATATAACACATCT TGG | Intronic | ||