ID: 955128833

View in Genome Browser
Species Human (GRCh38)
Location 3:56143105-56143127
Sequence AAGTGTGAGGAGGGGGAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 534
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 488}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955128823_955128833 -4 Left 955128823 3:56143086-56143108 CCCTGGAGTCCCCTAGTCTAAGT 0: 1
1: 0
2: 0
3: 8
4: 89
Right 955128833 3:56143105-56143127 AAGTGTGAGGAGGGGGAATATGG 0: 1
1: 0
2: 2
3: 43
4: 488
955128824_955128833 -5 Left 955128824 3:56143087-56143109 CCTGGAGTCCCCTAGTCTAAGTG 0: 1
1: 0
2: 0
3: 6
4: 106
Right 955128833 3:56143105-56143127 AAGTGTGAGGAGGGGGAATATGG 0: 1
1: 0
2: 2
3: 43
4: 488

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955128833 Original CRISPR AAGTGTGAGGAGGGGGAATA TGG Intronic
901832611 1:11902286-11902308 AAGTGTGAGGATGGACAATTCGG - Intergenic
904758602 1:32784448-32784470 AAAGGTGAGGAGGGGGATTATGG - Intronic
905298744 1:36971800-36971822 AGGTGTCAGGTGGGGGAATGTGG - Intronic
907217358 1:52876128-52876150 AAGTTTGAGGAGAGAGAATTAGG + Intronic
907709272 1:56863636-56863658 AAGTTTGAAGTGGGGGAACATGG - Intronic
908058161 1:60315123-60315145 GTTTGTGGGGAGGGGGAATAAGG + Intergenic
909213889 1:72860835-72860857 AAGTGAGATGAGGGGGCAAATGG - Intergenic
909458682 1:75882416-75882438 AAGTGGGGGGAGGAGGAAGAGGG - Intronic
910149186 1:84121570-84121592 AAGTGTGAAGAAGGGGAAGTTGG + Intronic
910581158 1:88826576-88826598 AAGGGTGAGGAGGTGGAAGGGGG - Intronic
910667243 1:89738980-89739002 AAGTGAGGGGAGGAGGTATACGG - Intronic
910734987 1:90443737-90443759 TACTGTGAGGCGGGAGAATAGGG - Intergenic
910793790 1:91077131-91077153 AAGCGTGATGAGGAGGCATAAGG - Intergenic
911224543 1:95290890-95290912 CAGAGGGAGGACGGGGAATAGGG - Intergenic
911333639 1:96554996-96555018 AAGGCTGTGGAGGGGGAATAAGG - Intergenic
911620670 1:100063987-100064009 AAGTGTGGGGAAAGGGAAAATGG - Intronic
911754937 1:101543106-101543128 TAGAGTGAGGAGAAGGAATAAGG + Intergenic
912138517 1:106692065-106692087 CAGGGTAAGGAGGGGGAATGAGG + Intergenic
912595748 1:110874187-110874209 AAGTATGAGGATTGGGAACAGGG + Intronic
912725547 1:112056377-112056399 AAGGGTGAGGAGGGGAGAGAAGG - Intergenic
912821176 1:112869034-112869056 AAGTGTGAGGAACGTGACTAGGG - Intergenic
913714168 1:121517201-121517223 AAGTGTATAAAGGGGGAATAAGG - Intergenic
914256362 1:145963192-145963214 AAGTATGAGGAAGGTGGATATGG + Intronic
914505113 1:148281962-148281984 AAGTGTGAGGAAAGGCAATCTGG + Intergenic
914507451 1:148302186-148302208 AAGTGTGAGGAAAGGCAATCTGG - Intergenic
914684677 1:149967859-149967881 TGGTGGGAGGAGAGGGAATAAGG + Intronic
914959585 1:152194649-152194671 AGGGGTGAGGAGGGGGGATGGGG - Intergenic
915331643 1:155116482-155116504 GAGTTTGGGCAGGGGGAATAGGG - Intergenic
915508784 1:156374397-156374419 GAGTGGGGGAAGGGGGAATAGGG - Intronic
915816942 1:158977499-158977521 GAATGTGAGAAGAGGGAATATGG - Intergenic
916188769 1:162158885-162158907 AAGTGAGAGAAGAGGGAATATGG + Intronic
916332087 1:163628370-163628392 AAGGGGGAGGAGGGGGGATGGGG - Intergenic
916427270 1:164692639-164692661 AGGTGTGAGCGTGGGGAATAGGG + Intronic
918216969 1:182400246-182400268 AAGAGTGAGGAGGATGAACATGG + Exonic
918637915 1:186801077-186801099 AAGTATGAGAAGGGGAAATGTGG - Intergenic
918914108 1:190612860-190612882 AAGAGTGAGGTGGGGGCATTGGG + Intergenic
919373732 1:196764341-196764363 AAGTGTGGGGAGAGGGGAAAGGG + Intergenic
919380173 1:196849018-196849040 AAGTGTGGGGAGAGGGGAAAGGG + Intronic
919827265 1:201512166-201512188 AAGTGTGGGGAGGGGAAAGCAGG + Intergenic
920210242 1:204322700-204322722 ATGTGTGAGGAGTGTGATTATGG - Intronic
920552000 1:206869803-206869825 CAGAGTGAGGTGGGGGAAGAAGG - Intergenic
921956174 1:220985271-220985293 GGCTGGGAGGAGGGGGAATAGGG - Intergenic
922146006 1:222945161-222945183 AAGAGTGAGGAGGGGGAAAGAGG + Intronic
923051018 1:230391562-230391584 AGGTGTGAGGAGGAGGGAGAGGG - Intronic
923051985 1:230395760-230395782 GAGTGTGAGGAGGGGGGAGGAGG - Intronic
923101997 1:230824248-230824270 AAGTGTGAGGGGGGGGCAGGGGG - Intergenic
923482427 1:234397416-234397438 AGGGGGGAGGAGGGGGAAGAGGG + Intronic
923482436 1:234397435-234397457 AGGGGGGAGGAGGGGGAAGATGG + Intronic
923482581 1:234397740-234397762 AAGAGGGGGGAGGGGGAAGAGGG + Intronic
924309539 1:242725683-242725705 AAGGAGGAGGAGGAGGAATAGGG + Intergenic
924444653 1:244118011-244118033 AGGTGTGAGGAAGGGGATTTGGG + Intergenic
924778598 1:247128008-247128030 AAGAGTTAGGCTGGGGAATACGG - Intronic
1063386564 10:5619835-5619857 AGGGCTGAGGAGGGGGAAGAGGG + Intergenic
1063488734 10:6443958-6443980 AGCTGTGGGGAGGGGGAATAGGG + Intronic
1065589757 10:27252473-27252495 AAGAGCGAGGAGGAGGAGTACGG - Intergenic
1066276614 10:33875196-33875218 GAGTGGGAGGAAGGGGAAGAGGG + Intergenic
1066628457 10:37434024-37434046 CAGTGTGGGGAGGGTGAGTATGG + Intergenic
1067241639 10:44500255-44500277 AAGTGGGAGGATGGGGAAATGGG - Intergenic
1067436378 10:46282184-46282206 AAGTCTGATGAGGGGGAAGTTGG - Intergenic
1067766075 10:49088464-49088486 AAGTGTTTGAAGGGGGAATCTGG - Intronic
1069599207 10:69692645-69692667 AAGGGTGATGAGGGAGGATAAGG + Intergenic
1069599434 10:69693918-69693940 AAGGGTGATGAGGGAGGATAAGG - Intergenic
1070487558 10:76945038-76945060 AAGTGAGAGGAGAGGGAAAGAGG + Intronic
1070702453 10:78613525-78613547 AAGGGAGGGGAGGGGGAATAGGG + Intergenic
1071065194 10:81624272-81624294 AAGGGTGAGGAGGTGGAAGGGGG + Intergenic
1071264497 10:83952873-83952895 AAGAGTGAGAAGAGGGAAGAGGG + Intergenic
1071513950 10:86284784-86284806 GAGTCTGAGGACGGGGCATAGGG + Intronic
1072490972 10:95905898-95905920 AACAGTGAGGAGAGGGAAAAGGG + Intronic
1073860577 10:107733415-107733437 AAGTGGGATGAGAGAGAATAGGG + Intergenic
1075301698 10:121330580-121330602 AAGTGAGGGGAGGGGGGAGAGGG - Intergenic
1078471880 11:11594466-11594488 GAGTGTGGGGATGGGAAATAGGG - Intronic
1078822368 11:14894793-14894815 AAATGCAAGAAGGGGGAATAAGG - Intergenic
1079196453 11:18331763-18331785 AAGTATTAGGAAGGGGAGTACGG - Intronic
1079304292 11:19308779-19308801 AAGAGTGAGGAGTGGGCAGAGGG - Intergenic
1080102556 11:28476207-28476229 CAGTGTGAAGAGGGGGACAATGG - Intergenic
1080302220 11:30797352-30797374 AAGTGTGTGGATGGGGGAGAGGG + Intergenic
1080465067 11:32488741-32488763 AAATGTGTGGAGTGGGAATTTGG - Intergenic
1080896425 11:36452287-36452309 AAGTGAGAAGAGGGGGCATCAGG - Intronic
1081492923 11:43581170-43581192 AAGTGTGTGGAGGGCGAGAAGGG - Intronic
1082907001 11:58319170-58319192 ATTTGTGGGGAGGGAGAATAGGG + Intergenic
1082921316 11:58497712-58497734 AAGGGTGAGAAGGAGGAAGAGGG + Intergenic
1082965968 11:58966477-58966499 CAGTGTGTGGAGTGGGAATCAGG - Intronic
1083278907 11:61613510-61613532 AGATGTGAGGTGGGGGAATGTGG + Intergenic
1084441474 11:69176553-69176575 AAGAATGAGGAGGAGAAATAAGG - Intergenic
1084596154 11:70118190-70118212 GAGGGGGAGGAGGGGGAAGAGGG - Intronic
1084655410 11:70512934-70512956 AAATTTGAGGTTGGGGAATAAGG + Intronic
1084804682 11:71570606-71570628 AAGTGTGTGGAGGGTGTATGGGG + Intergenic
1084941476 11:72615519-72615541 GAGTGTGGGGAGGGGGAGGATGG + Intronic
1084983744 11:72849147-72849169 ATGTGTGAGAAGGGGCAATGCGG - Intronic
1086359371 11:86041364-86041386 TAGTGGCAGGAGGAGGAATATGG - Intronic
1086529364 11:87765569-87765591 AAGTGAGAGGAGTGGGTCTAGGG - Intergenic
1086875642 11:92092360-92092382 AATTGTGGGGAAGGGGAATGAGG + Intergenic
1087412474 11:97809086-97809108 AAATGTGAGGAGGGAGATTTGGG + Intergenic
1088542911 11:110931696-110931718 AAATGGGAGGAGGGGAAAGAAGG - Intergenic
1089490774 11:118882489-118882511 AGGTGTGAAGAGGGGAAAGAGGG + Intergenic
1089558518 11:119330438-119330460 GAGAGAGAGGAGGGGGAAGAAGG - Intergenic
1089845825 11:121457240-121457262 AAGAGTAAGGAGGCGGAATTTGG + Intronic
1090702344 11:129308149-129308171 AAGAGTCAGGAGGGAGAAGAGGG - Intergenic
1090986095 11:131767487-131767509 AAGTCTTAGGAGGGGGACTCTGG + Intronic
1091315443 11:134610972-134610994 AAGTGTGGGGATGGGAAACACGG - Intergenic
1091337122 11:134780619-134780641 AAGAGTGAGGAGGAGGAGGAGGG - Intergenic
1093750811 12:22797775-22797797 AAGTGTGAGGAGAGAAAAAAAGG + Intergenic
1094493827 12:30977310-30977332 GAGTGTGGGCAGGGGGGATACGG - Intronic
1096489309 12:52005114-52005136 AGGTGGGAGGAGGGAGAAGAAGG + Intergenic
1096692996 12:53332738-53332760 AAGGGGGAGGAGGAGGAAGAAGG + Intronic
1097238198 12:57554081-57554103 AAATGTGAGGAGGGGGGATATGG + Intronic
1097859104 12:64500396-64500418 GAGGGTGACGAGGGGAAATATGG - Intronic
1098323745 12:69278860-69278882 AAGTGAGAGTGGGGGGAATGGGG - Intergenic
1100661073 12:96699372-96699394 AAGTATGAGGCAGGAGAATAGGG - Intronic
1100669991 12:96801747-96801769 AATAGGGAGGAGGGGTAATAAGG + Intronic
1101448572 12:104755931-104755953 AAGGGTGAGGAGTAGGAATCAGG + Intronic
1102045244 12:109825770-109825792 AAATCAGAGGAGGGGGAAGAGGG + Intronic
1102810487 12:115819955-115819977 AAGTGTGAGGAGAGAGAACATGG + Intergenic
1102858934 12:116318840-116318862 CAGTGTGGGGAGGGGGGGTAGGG - Intergenic
1102976912 12:117213404-117213426 AAGAGTGAGCAGGGGAAATTGGG + Exonic
1103565576 12:121813748-121813770 AAGGATGATGAGGGTGAATACGG - Intronic
1104078942 12:125413491-125413513 AAGAGTGAGGATGGGGGAAATGG - Intronic
1104282718 12:127392455-127392477 AAGGGAGAGGAGGAGGAAAAAGG + Intergenic
1104902552 12:132197294-132197316 AGGTGGGGGGAGGGGGAACAAGG - Intronic
1105819454 13:24066694-24066716 AAGAGTGAGGAGGGGAATGAAGG - Intronic
1105927272 13:25018981-25019003 ACATGTGAGGAGGGGCAATCGGG + Intergenic
1106481448 13:30140195-30140217 AAGTGTGTGGAGGGAGAGGAAGG - Intergenic
1106658925 13:31778064-31778086 AAGTGACAGTAGGGGGAATTTGG - Intronic
1106781046 13:33059441-33059463 AAGTCTAAGGAGGGAGAATGTGG - Intronic
1108126992 13:47255480-47255502 AAGTGAGAGGAGGTGGGATCAGG + Intergenic
1109621701 13:64916804-64916826 AAGAGTGAGGAGGAGGAAGGAGG - Intergenic
1109857810 13:68156277-68156299 GAGAGTGTGGAGGGGAAATATGG - Intergenic
1110528719 13:76571545-76571567 AAGTAGGAGGTGGGGGAAAAGGG - Intergenic
1111713995 13:91854533-91854555 TAGTTTGGGGAGGGGGAAGAGGG - Intronic
1111873716 13:93866718-93866740 GAGTGTGAAGAGTGGGAGTAGGG + Intronic
1112173408 13:96996192-96996214 AATTGTGGGGAGAGGGAATGAGG + Intergenic
1112311079 13:98318019-98318041 AAGAGGGAGGAGGAGGAAGAAGG - Intronic
1113339918 13:109412432-109412454 CAGTGTGAGGGAGGGGAAGAGGG - Intergenic
1114317515 14:21522399-21522421 AGGAGAGAGGAGGGGGAAGAAGG + Exonic
1114673721 14:24428229-24428251 GAGGGTGGGGAGGGGGAAGAAGG - Intronic
1114814246 14:25937760-25937782 AAGTGGAAGGAGGGGGAACCAGG + Intergenic
1115359038 14:32481261-32481283 AACTGTGAGGCAGGAGAATAGGG - Intronic
1115400353 14:32952315-32952337 ATGAGTGATGAGGGGGAAAAAGG - Intronic
1115718789 14:36136584-36136606 AAGTATGAGGAAGGGAGATAGGG + Intergenic
1115746806 14:36446418-36446440 AAGGGAGAGAAGGAGGAATAAGG + Intergenic
1115779006 14:36748848-36748870 AAGTCTGTGGAGGGAGAATCTGG - Intronic
1115803197 14:37019599-37019621 ATGTGTTAGGAGGGGAAATGAGG + Intronic
1116327730 14:43553263-43553285 AGGAGTAGGGAGGGGGAATATGG + Intergenic
1116430839 14:44843717-44843739 AAGTAGGAGGAGGTGGAACAAGG - Intergenic
1116991055 14:51276946-51276968 AATTGTGAGGCAGGAGAATAGGG - Intergenic
1117130708 14:52684009-52684031 ATGTGGGAGGAGGGAGGATAAGG - Intronic
1117834344 14:59786633-59786655 AAGAGGGAGGATGGGGAAGAAGG + Intronic
1118171884 14:63396019-63396041 AAGAGAGGGGAGGGGGAAGATGG + Intronic
1118294309 14:64554832-64554854 AAGTGTGTGGAGTGGGTAAAGGG + Intronic
1118462603 14:66000538-66000560 AGGGGTGAGGAGGTGGCATAGGG + Intronic
1119330721 14:73791443-73791465 AAGTCTGAGGAGAGGGGTTATGG + Intergenic
1119679729 14:76583775-76583797 AATTCTGAGGATGTGGAATAGGG - Intergenic
1119850161 14:77861293-77861315 AAGGGGGAGGAGGAGGAAGAGGG - Intronic
1120392046 14:83921413-83921435 AAGTGTGAGGGGTGGGGAAATGG + Intergenic
1120581655 14:86257832-86257854 AATTTTGGGGTGGGGGAATATGG - Intergenic
1120714367 14:87824265-87824287 CAGTGTGATGAGGGGGATTGGGG - Intergenic
1120963962 14:90151011-90151033 AAGTGTGAACAGGAGGAAGAAGG - Intronic
1121613857 14:95299703-95299725 AAGTGGGAGGTGGTGGCATAGGG - Intronic
1121833136 14:97069103-97069125 AAGGGTGAGGAGGGGGCTTCAGG + Intergenic
1122064573 14:99163323-99163345 ATGTGTGAGGAGGTGGGATAAGG - Intergenic
1122201851 14:100127633-100127655 AAGTGTGAGGAAGGAGGAAAAGG - Intronic
1122651678 14:103230046-103230068 GAGAGAGAGGAGGGGGAATGAGG + Intergenic
1122723873 14:103737723-103737745 AAGTGTGAGGAGATGGAGGAAGG - Exonic
1122882539 14:104696571-104696593 GAGTGTGAGGGAGGGGAATGGGG + Intronic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1202854599 14_GL000225v1_random:42798-42820 AGGTGTCAGGAGGGGCAACACGG - Intergenic
1125456517 15:39865548-39865570 AAGGGTGAGGAGGTGGAAGGAGG + Intronic
1125928798 15:43584955-43584977 TACTGTGAGGAGGTGGAAAAGGG - Intronic
1125941964 15:43684790-43684812 TACTGTGAGGAGGTGGAAAAGGG - Intergenic
1126376711 15:48004291-48004313 AAGAGTAAGGTGGGGGAAAATGG + Intergenic
1126408330 15:48345896-48345918 GTGTGTGAGGAGGGTGTATATGG - Intergenic
1126658455 15:51006721-51006743 ATGTGGGAGGAGGGAGTATATGG - Intergenic
1127996568 15:64156375-64156397 AAGGGTGAGGAGGAGGAAGAGGG + Exonic
1129508792 15:76104735-76104757 ATGTGTGAGGAGAGGGGAGAAGG + Intronic
1130241332 15:82195679-82195701 AAGTTTGAGCAGGAGGAAAATGG - Intronic
1130459091 15:84145474-84145496 AAGTTTGAGCAGGAGGAAAATGG + Intergenic
1131908482 15:97170426-97170448 AACTGTGAGGATTTGGAATATGG + Intergenic
1132662801 16:1069106-1069128 AGGTGTGAGGAGGGAGATCAGGG - Intergenic
1133548087 16:6827640-6827662 AAGGGTGAGGAGGGGGAAGGAGG - Intronic
1134208795 16:12259046-12259068 GAGAGAGAGGAGGGGGAATCTGG - Intronic
1134379591 16:13711590-13711612 AAAAATGAGGAGGGGGAAAAAGG + Intergenic
1134511365 16:14850347-14850369 AAGAGGGAGGAGGGGGACTTCGG + Intronic
1134699009 16:16248844-16248866 AAGAGGGAGGAGGGGGACTTCGG + Intronic
1134972828 16:18545829-18545851 AAGAGGGAGGAGGGGGACTTCGG - Intronic
1136269405 16:29139592-29139614 AAGTGTGTGAAGGGGGAGAAGGG + Intergenic
1137691985 16:50434862-50434884 AACTGTGTGTAGGGGGTATATGG + Intergenic
1138869539 16:60865596-60865618 AAATGTGAGAATGGTGAATATGG + Intergenic
1139030982 16:62879854-62879876 AAGTGTGAGGAAGATGAATATGG + Intergenic
1139492064 16:67291521-67291543 CAGTGTGAGGAGGGGGAGAGGGG + Intronic
1140940600 16:79718431-79718453 AACTGTGAAGAAGAGGAATATGG + Intergenic
1141009641 16:80385536-80385558 CAGTGTGGGGTTGGGGAATAGGG + Intergenic
1141210172 16:81972379-81972401 AAGTGGGGGGAGGGGGAAGAAGG - Intergenic
1141667758 16:85474655-85474677 AAAGGAGAGGAGGGGGAAGAGGG - Intergenic
1141703628 16:85653308-85653330 AAGTGGGAGGAGGAGGAGGAGGG - Intronic
1141710696 16:85697291-85697313 AAGTGTGTGTTGGGGGAACATGG - Intronic
1141891769 16:86930911-86930933 GAGGGGGAGGAGGGGGAAGAAGG - Intergenic
1142072883 16:88100862-88100884 AAGTGTGTGAAGGGGGAGAAGGG + Intronic
1142875304 17:2848897-2848919 AAGACAGAGGAGGGGGAAGAGGG - Intronic
1143373786 17:6455702-6455724 AAGGGAGGGGAGGGGGAAGAGGG + Intronic
1144425027 17:15133582-15133604 CACTGTGAGGCGGGAGAATAGGG - Intergenic
1144664549 17:17093006-17093028 AAGGGTGGGGAGGGGTAAGAGGG + Intronic
1145289325 17:21530726-21530748 AGGTGTGAGGGAGGGGAATCTGG - Exonic
1147309672 17:39587850-39587872 AAGAATGAGGGGGAGGAATATGG + Intergenic
1147737628 17:42650525-42650547 AAGTGTGAGGTGGCGGAATGAGG - Intergenic
1147904888 17:43816335-43816357 GAGTGTGAGCAGTGTGAATAGGG + Intronic
1148225662 17:45896430-45896452 GAATGTGAGGAAGGGGCATAAGG + Intronic
1148508529 17:48147920-48147942 AAGTGTGAGAAGGGGGACATGGG + Intronic
1149358059 17:55864607-55864629 CAGTATGAGGAGGTGGAATAAGG - Intergenic
1149392125 17:56202574-56202596 AAGGGTGTGGAGGGGGGAAATGG - Intronic
1149733371 17:58969195-58969217 AAGTTGGGGGAGGGGGGATAGGG - Intronic
1149864752 17:60145127-60145149 GAGGGTGATGAGGGGGAATTGGG - Intergenic
1149983452 17:61329741-61329763 GAGGGTGAGGAGGAGGAAAAGGG + Intronic
1150157720 17:62868361-62868383 CAGTGGGAGGAGTAGGAATAGGG - Intergenic
1150186842 17:63190985-63191007 AATTGTAATGAGGGGGAAAAAGG + Intronic
1151063931 17:71129313-71129335 AAGTGTGGGAAGGGAGAATATGG + Intergenic
1151432777 17:74075528-74075550 ATGGATGAGGAGGTGGAATAGGG + Intergenic
1153185250 18:2478905-2478927 AAGAGGGAGGAGGAGGAAGAAGG + Intergenic
1153706387 18:7749637-7749659 CAGTGTGAGGAGGTGGTGTATGG + Intronic
1155744828 18:29341808-29341830 AAGTTTGAGGAAGGAGCATATGG - Intergenic
1156111419 18:33731847-33731869 ATGTGTGAGGAGGAGGAAGGGGG - Intronic
1156463238 18:37333353-37333375 AAGGGAGAGGAGGGGGAAGAGGG - Intronic
1156747184 18:40406629-40406651 ATGTGTGATGCTGGGGAATATGG + Intergenic
1156874413 18:41990513-41990535 AAGTGTGATGATAAGGAATATGG + Exonic
1157225742 18:45862485-45862507 TAGTGTGAGGTGGCTGAATATGG + Intronic
1157451988 18:47795711-47795733 AAGTACGATGAGGGGGAAGATGG + Intergenic
1159146678 18:64463471-64463493 AAGCTTGAGGAGTTGGAATAGGG + Intergenic
1159730659 18:72023135-72023157 ATGTGTGAGTTGGGGGAAGAGGG - Intergenic
1160527524 18:79546281-79546303 GAGTGTGAAGAGGGTGAATGTGG - Intergenic
1161253100 19:3291753-3291775 GAGAGGGAGGAGGGGGAACATGG + Intronic
1161257301 19:3316494-3316516 CAGAGTGAGGAGGGGGAGAAAGG + Intergenic
1161345954 19:3768814-3768836 CAGAGTGAGGAGGGGGAGGAGGG - Intergenic
1161623200 19:5310055-5310077 CAGAGTGAGGAGGGGGAGGAGGG - Intronic
1161625608 19:5324834-5324856 CAGTGTGAGGATGGGGATGATGG - Intronic
1161663640 19:5561955-5561977 AAGTGTATGGAGGGGGATGATGG + Intergenic
1162263306 19:9549994-9550016 AAGTGGGATGAGGGGCAACATGG - Intergenic
1162502076 19:11059837-11059859 GAGAGTGAGGAGGAGGAAGAGGG + Exonic
1164551691 19:29217532-29217554 ATGTGTGTTGAGGGGGCATAGGG + Intergenic
1165286813 19:34849588-34849610 AACAGTGAGGAAGGGGTATACGG + Intergenic
1165698330 19:37918180-37918202 GAGGGTGAGCAGGGGGACTAAGG + Intronic
1166681696 19:44771813-44771835 AAGGGTGTTGAGGGGAAATAGGG - Intergenic
1166976902 19:46610108-46610130 AAGGGTGGGGAGAGGGAAGATGG + Exonic
1167812989 19:51851591-51851613 AAATGTGAGGTGTGGGGATATGG - Intergenic
925173718 2:1767933-1767955 AAGTGTGGGGTGGGGGTAGAGGG + Intergenic
927667722 2:25043623-25043645 AAGTGGGAGGAGGGGGAGGTTGG + Intronic
927913707 2:26920236-26920258 AAGTTTGAGTAGTGGAAATATGG + Intronic
929277364 2:40040968-40040990 AAGTGTTGGGAGGGGGATGAGGG - Intergenic
929407969 2:41665131-41665153 AAATGTGAGGAGGGGAACTGAGG - Intergenic
930058707 2:47271686-47271708 ACGTGTGAGGTGTGGGAAGATGG + Intergenic
930709279 2:54534867-54534889 AAGAGTGAGGTGCAGGAATAGGG - Intronic
931306403 2:61033649-61033671 GAGTGTCAGGAGGAGGAACAGGG + Intronic
931673520 2:64671259-64671281 AAGTTTTAGGAGCTGGAATATGG + Intronic
931714109 2:65015165-65015187 AACTGTGAGGAGGGGAAAGTAGG + Intronic
932018533 2:68058749-68058771 GAGTGTGATGTTGGGGAATAGGG - Intronic
932609445 2:73187917-73187939 TAGTGTGGGAAGGGGGATTATGG - Intergenic
934113630 2:88764902-88764924 ACGTGTGAGGAGGGGCAATCGGG - Intergenic
934636400 2:95992768-95992790 AGGTGTGAGGAGGGGCAATCGGG + Intergenic
934653263 2:96104224-96104246 AAGGAGGAGGAGGGGGAAGAGGG - Intergenic
934797245 2:97112658-97112680 AGGTGTGAGGAGGGGCAATCGGG - Intergenic
934836163 2:97590781-97590803 AGGTGTGAGGAGGGGCAATCGGG + Intergenic
935047891 2:99498323-99498345 ACGTGAGAAGAGGGGGAATTTGG - Intergenic
935152546 2:100450688-100450710 AAGGGAGGGGAGGGGGAACAGGG - Intergenic
937765588 2:125656970-125656992 AGGGGTGAGGGGGAGGAATAGGG + Intergenic
939327203 2:140708606-140708628 AAGTGAGAGGATGGGCAATGAGG - Intronic
940481700 2:154240966-154240988 CAGTGGGAGGAGGCGGAATTTGG - Intronic
940893216 2:159055427-159055449 AACTGAGGGTAGGGGGAATAGGG - Intronic
941369150 2:164643071-164643093 AAATGTGAGGATGGGTAAAATGG - Intergenic
941443789 2:165574243-165574265 AAGCGAGAGGAGGGGGCAGAAGG + Intronic
941475918 2:165951974-165951996 ACGTGTGTGGAGGGAGAATGAGG - Intronic
941841587 2:170090813-170090835 AAGGGAGAGGAGAGAGAATATGG + Intergenic
942023362 2:171889071-171889093 AAGGAGGAGGAGGGGAAATAGGG - Intronic
942863628 2:180646299-180646321 AAGTGTTTTGAGGGGGAAAAGGG - Intergenic
943156315 2:184183489-184183511 ATTGGGGAGGAGGGGGAATAGGG + Intergenic
945066522 2:205952323-205952345 AAATGTGGGGAGGGGGAGTTAGG + Intergenic
945070222 2:205981919-205981941 ACATGTGAGTAGGGGAAATAAGG - Intergenic
945194714 2:207227380-207227402 AGGTGGGGGGAGGGGGAAGATGG + Intergenic
945564060 2:211374307-211374329 TAGTTTGAGGATGTGGAATAAGG + Intergenic
945591864 2:211743327-211743349 TTGAGTGAGGAGGGGGAAAAAGG - Intronic
945827829 2:214746193-214746215 AAGTTAGTGGAGGTGGAATAGGG - Intronic
946104054 2:217353626-217353648 AAATGTGGGGAGGGGGAATAAGG - Intronic
946118695 2:217489682-217489704 AGGTCTGAGCTGGGGGAATACGG - Intronic
946178273 2:217935170-217935192 CAGGGTGAGGAGGGGGAGGAAGG + Intronic
946768608 2:223063718-223063740 AAGAGTGAGGAGGGAGGATGAGG - Intronic
947497879 2:230651884-230651906 GGGTGTGAGGCGGGAGAATAGGG - Intergenic
948204285 2:236154364-236154386 AAGTGACAGGAAGGAGAATAAGG - Intergenic
948862411 2:240759077-240759099 AAGAGTGAGGAGGGTGAGTGTGG + Intronic
949066531 2:241994065-241994087 AAGAGTGAGGATGGGGAATTTGG + Intergenic
1168988884 20:2077445-2077467 ATGTGGGAGCAGGGGAAATATGG + Intergenic
1170607255 20:17883522-17883544 GAGTGTGTGGAGGGGGAGTTTGG + Intergenic
1170691236 20:18617016-18617038 AAAAGTGAGGAAGGAGAATAAGG - Intronic
1170953932 20:20961414-20961436 ATGGCTGAGGAGGAGGAATAGGG + Intergenic
1171019632 20:21573557-21573579 ATGGGTGAGGAGTGGGAATTGGG + Intergenic
1171079070 20:22159647-22159669 GAGAGGGAGGAGGGAGAATAAGG - Intergenic
1171384303 20:24757946-24757968 AAGGATGAGAAGGGGGAATTAGG + Intergenic
1171407206 20:24919510-24919532 AAGTGTGAGGAACGTGACTAGGG - Intergenic
1172083125 20:32358307-32358329 AAGAGTGAGGAGGGGGAGTGTGG - Intergenic
1173069212 20:39745271-39745293 AAGCCTGAGGAGGGGGCAGAAGG - Intergenic
1173822860 20:46030175-46030197 AACTGAGAGGAGGGGGAAAGAGG - Intronic
1173845638 20:46186709-46186731 AAGGGTGAGGAGGGGATAGAGGG + Intronic
1173865878 20:46312464-46312486 AAGCGGGAGGAGGGGGAGGAAGG - Intergenic
1173871423 20:46344420-46344442 TAGCATGAGGAGGGGGAAGAGGG - Intergenic
1174353439 20:49983504-49983526 GTGTGTGAGGAGGGGGATTGGGG + Intronic
1174363991 20:50045195-50045217 AGGAGTGTGGTGGGGGAATAAGG - Intergenic
1175638853 20:60609829-60609851 GAGGGTGAAGAGGGGGAAGAGGG + Intergenic
1176142257 20:63549936-63549958 AGGTGCAAGGAGGGGGAAGATGG - Intronic
1176211871 20:63928155-63928177 AAGTGTGAGACGGCAGAATACGG - Intronic
1177259190 21:18706936-18706958 AAGGGGGAAGAGGGGGAAGACGG - Intergenic
1177741364 21:25158064-25158086 AAGTGTGGGGAGAGAGAAAAAGG + Intergenic
1178613822 21:34112561-34112583 AGGTGTGGGGAGGGAGAATTGGG - Intronic
1179090276 21:38258801-38258823 AAGTGTGAGGAGAGGAAATTGGG - Intronic
1183538655 22:38417325-38417347 AGGTGAGAGGAGGGAGGATATGG - Intergenic
950177240 3:10883360-10883382 GAGTGAGAGGAGCGGGAATCTGG - Intronic
950804854 3:15591419-15591441 GAGGAGGAGGAGGGGGAATAGGG - Intronic
951257134 3:20463003-20463025 AAGTGAGAGGAAAGAGAATAAGG - Intergenic
951524840 3:23643944-23643966 AGGTGAGAGAAGAGGGAATACGG - Intergenic
952002350 3:28800646-28800668 AAGGGAGAGGAGGAGGAAGAAGG - Intergenic
953118146 3:40013129-40013151 AGGTGTGAGGAGGGGGACATGGG - Intronic
953185997 3:40638951-40638973 AAGGGTGAGGAGGTAGAATAGGG - Intergenic
953824956 3:46243609-46243631 AAGTGAGAGTGGTGGGAATAAGG + Intronic
954689839 3:52389787-52389809 AAATGTGGGGAGAGGGATTAGGG + Intronic
954709665 3:52499209-52499231 TAGTGGGAGGAAGGGGCATAGGG - Intronic
955128833 3:56143105-56143127 AAGTGTGAGGAGGGGGAATATGG + Intronic
956019930 3:64923449-64923471 CACAGTGTGGAGGGGGAATATGG - Intergenic
956665416 3:71637543-71637565 GAGGGGGAGGAGGGGGAAAAGGG + Intergenic
956849702 3:73217721-73217743 AAGGGAGGGGAGGGGGAAGAGGG - Intergenic
956933240 3:74070358-74070380 GGGTGGGAGGAGGGAGAATATGG + Intergenic
957048909 3:75396641-75396663 ACGTGTGAGGAGGGGCAATCGGG + Intergenic
957683462 3:83469854-83469876 AGGGGAGAGGAGGGGGAAGATGG + Intergenic
957885802 3:86286252-86286274 AAGTGTGGGTAGGGGGTAAAGGG - Intergenic
960284731 3:115815042-115815064 AAATTAGAGGAGGGGAAATACGG + Intronic
960435137 3:117617188-117617210 AAGTGAGAAAAGGGAGAATATGG + Intergenic
960966220 3:123106682-123106704 AAGAGGGAGGTGGGGGAATCAGG - Intronic
962670571 3:137702611-137702633 AAGGGTGAGTAGGAGGAATGGGG + Intergenic
962821741 3:139055018-139055040 AGGTGTGCAGAGGGGGAAGACGG + Intronic
962907151 3:139814333-139814355 CAGTGGGAGGTGGGGCAATAAGG + Intergenic
963327340 3:143877116-143877138 AGGTGTGGGGAGGGGGAGGAGGG - Intergenic
963422911 3:145084778-145084800 AAGTATGAAGAGGGGGAATTAGG - Intergenic
963442112 3:145354231-145354253 AAGTGAGAAGAGAGGGAAGAGGG + Intergenic
965630430 3:170727033-170727055 AAGTGGGAGTTGGGAGAATAGGG - Intronic
965699044 3:171440515-171440537 AAGTGTATGGAGGTGGAATGGGG + Intronic
965867377 3:173221288-173221310 AAGTGTGAGTAGGCTGATTAGGG + Intergenic
966083768 3:176040785-176040807 AAGTGTCCTGAGGGGGAAAAAGG + Intergenic
967006755 3:185391223-185391245 GTGTGTGGGGAGGGGGAATGGGG - Intronic
967115542 3:186334275-186334297 CAGGGTGGGGTGGGGGAATATGG - Intronic
967579132 3:191131429-191131451 AGCTGAGAGGAGGGGAAATAGGG + Intergenic
968248131 3:197176224-197176246 GTGTGTGAGCAGGGGGCATATGG - Intronic
968254981 3:197261603-197261625 AAATGTTAGGAGGAGGAATGGGG - Intronic
969307149 4:6332352-6332374 CAGTGTGAGGAGGGGGCCTGAGG + Intronic
969307737 4:6335463-6335485 AGGAGTGAGCAGGGGGAACAGGG + Intronic
969884907 4:10206697-10206719 CAGTGTGAGGTGGGGGATGACGG + Intergenic
970125954 4:12811520-12811542 AAGAGTGAAGAAGGGGAACAAGG - Intergenic
971266584 4:25101226-25101248 AAGGGTGAGGAGGTGGAAGAGGG - Intergenic
972040994 4:34598908-34598930 AATTGTAAGGAGGCAGAATAAGG - Intergenic
972287458 4:37662773-37662795 AGGTGGGAGGTGGGGGAAGATGG - Intronic
972612196 4:40666442-40666464 AAAAGTCAGGAGGGGGAAGAGGG - Intergenic
972756278 4:42050359-42050381 CAGTGGGAGGAGAGGGGATAGGG + Intronic
974362391 4:60899109-60899131 AACTGTGAGGAGGAAGAAAAAGG - Intergenic
974989974 4:69075420-69075442 AAGTGTGTAGAGGGAGAAAAAGG - Intronic
975207095 4:71657363-71657385 GAGGTTTAGGAGGGGGAATAAGG + Intergenic
976128616 4:81859803-81859825 AAGTGTGAGGCAGTAGAATATGG - Intronic
976173701 4:82331246-82331268 CTGTTTGAGGAAGGGGAATACGG + Intergenic
976681137 4:87757427-87757449 GAGTGTGAGGAGAAGGAAAAGGG + Intergenic
978036484 4:104001606-104001628 AAGTTTTAGGAGTGAGAATAGGG - Intergenic
978736979 4:112094611-112094633 AAGTGTTTGCAGGGGGAATAGGG + Intergenic
978949963 4:114546249-114546271 AAATGTGAGGTGGGGGACAATGG - Intergenic
980103353 4:128563824-128563846 TCGTGAGAGGAGGGGGAACAGGG + Intergenic
980331054 4:131411825-131411847 TAGGGTGGGGAGGGGGGATAAGG - Intergenic
981085304 4:140677183-140677205 AAGATTGAGGAGGTGGAAAATGG - Intronic
982026751 4:151259051-151259073 TAGTGGGAGAATGGGGAATATGG - Intronic
982660508 4:158201147-158201169 AAGAGTGAGGATTGGGAAGAAGG - Intergenic
982884272 4:160758658-160758680 AAGTGGGAGGAAGGGGAGCAAGG - Intergenic
984495959 4:180497480-180497502 AAGTGTGAGGAAAGGGCACACGG - Intergenic
985171437 4:187154189-187154211 AAGTGTGAGGAGAGTGAAGGAGG + Intergenic
987704939 5:21450779-21450801 CATTGGGAGGAGGGGGAATTAGG - Intergenic
988264241 5:28928528-28928550 ACGTGTGAGGAGGGGCAATCGGG + Intergenic
988509521 5:31854037-31854059 AAGTGTCAGGAGTGGAAAAATGG + Intronic
988737840 5:34040428-34040450 AAGTGGGAGGAGGGAGAAATGGG + Intronic
989511639 5:42294739-42294761 AACTGGGAGGAGGGAGAAAAAGG + Intergenic
991292174 5:65043684-65043706 AAGTGTGAGGCTGGTGAACAGGG - Intergenic
991944684 5:71888697-71888719 AAATGAGAGGAGGGGAAAAAAGG + Intergenic
992071691 5:73154677-73154699 AAGGGAGAGGAAGGGGAACAGGG - Intergenic
994172446 5:96672324-96672346 AAATCTGAGCGGGGGGAATATGG + Intronic
995455666 5:112349197-112349219 AAATGGGAAAAGGGGGAATAAGG + Intronic
995851136 5:116546835-116546857 AAGTGAGAGGAGAGGGAATCAGG - Intronic
996171689 5:120300598-120300620 AGGTTTGAGGAGGTGGAATGGGG + Intergenic
996821978 5:127639608-127639630 AAGAGAGAGGAGAGGGAAGAAGG - Intergenic
996974092 5:129409350-129409372 AAATGTGAGGAGGGAGGAGATGG + Intergenic
997361046 5:133295120-133295142 AAGTCTGAGGAGGGAGAAGAAGG - Intronic
997530099 5:134576733-134576755 AAGTGAGAGGAGGAGGGAGATGG - Intronic
997631933 5:135375237-135375259 AGCTCTGAGGAGAGGGAATATGG - Intronic
998171237 5:139873033-139873055 AAGTGAGAGGAGGAGGAGGAGGG + Intronic
998389240 5:141776547-141776569 AAGTGTGAGGGGGCCCAATAAGG - Intergenic
998476308 5:142424971-142424993 AAGGGTGAGGAAGGAGAAAAGGG + Intergenic
998562121 5:143181424-143181446 AGGTGTAAGGAGGGGGAAGCAGG - Intronic
998565575 5:143213326-143213348 GAGTGTGGGGAGGAGGAAGAAGG - Intronic
999673379 5:153976454-153976476 AAGAGTGAGGAGAGGGAGGATGG - Intergenic
1000194268 5:158942850-158942872 AAGGAGGAGGAGGGGGAAGAAGG + Intronic
1000647405 5:163775541-163775563 AAATCGGAGGAAGGGGAATAAGG - Intergenic
1000895269 5:166847605-166847627 AAGATAGAGGAGGGGGAAAATGG + Intergenic
1000959640 5:167584658-167584680 AGGTGTGAGGCGGGAGAATACGG - Intronic
1001420040 5:171579290-171579312 AAGGGTCAGGAAGGGGAAGAGGG - Intergenic
1001838473 5:174852873-174852895 GAGTGTGAGGAGGAGAGATAGGG + Intergenic
1001923906 5:175622322-175622344 GAGTTTGAGGAGGGAGAAGAGGG - Intergenic
1001960158 5:175875194-175875216 AAGTGAGAGGGGTGGGATTAAGG + Intronic
1002520956 5:179793102-179793124 CAGAGTGGGGAGGGGGACTACGG - Intronic
1003516297 6:6821600-6821622 ACGGGGGAGGAGGGGGAAGAGGG + Intergenic
1005088094 6:22027514-22027536 CAGTGTGGGGAGAGAGAATAGGG + Intergenic
1006304760 6:33212279-33212301 ACGTCTGAGGAGGGGGTAAAAGG - Exonic
1006812774 6:36830836-36830858 ATGGGACAGGAGGGGGAATAAGG - Intronic
1007590618 6:43018595-43018617 AAGTGTCAGGAGTGTGAAGAGGG - Intronic
1008596131 6:53043816-53043838 AAGTATGTGGAGGGGAATTAAGG + Intronic
1008824646 6:55678798-55678820 AAGTGAGAGGTGGAGGAGTAAGG + Intergenic
1010089315 6:71961348-71961370 TAGGGTGAGGAAGGGGAAGACGG - Intronic
1011407051 6:87026502-87026524 AAGTGAGGGGAGGGGGAAGGTGG + Intergenic
1011589605 6:88959210-88959232 AAGTGTGGAGAGGGGGGATGAGG + Intronic
1012519916 6:100109180-100109202 AAATTTGAGTAGGGGGGATATGG - Intergenic
1013080595 6:106808631-106808653 AAGAGAGAGCAGGGGGAAAAGGG - Intergenic
1013176063 6:107677937-107677959 AAGTGGGAGAAGGGGGAAAGGGG + Intergenic
1013182272 6:107728269-107728291 AAGTGTGGGAATGGGGAACAAGG + Intronic
1013501439 6:110755874-110755896 AAGTTTGAGGAGGGTGGATGAGG + Intronic
1014165191 6:118216442-118216464 AAGTGGGGGTAGGGGGAAGAAGG - Intronic
1014848176 6:126306119-126306141 TAGTATGAGGAGGGGGCATGTGG + Intergenic
1015450598 6:133362826-133362848 GAGTCCGAGGAGGGGGAATCAGG - Intronic
1016733547 6:147451805-147451827 TAGCATGAGGAGGGGGAGTAAGG + Intergenic
1016813499 6:148282855-148282877 GAGTTTGGGGAGGGGGACTAGGG - Intronic
1016828181 6:148407231-148407253 AGATGTGAGGAGGGGAAATAGGG - Intronic
1017999928 6:159570032-159570054 AGGAGTGGGGAGGGGGAAAAGGG - Intergenic
1018038092 6:159898710-159898732 AAGAGGGAGGAGGAGGAAGAGGG - Intergenic
1018425334 6:163674882-163674904 CAGAGTGAAGAGGGGGAAGATGG + Intergenic
1019151732 6:170010953-170010975 AAGGGAAAGGAGAGGGAATAAGG + Intergenic
1019517465 7:1446277-1446299 AGGGGGGAGGAGGGGGAAAAAGG + Intronic
1019517503 7:1446383-1446405 AGGGGGGAGGAGGGGGAAAAAGG + Intronic
1021668771 7:23014063-23014085 CAGTGAGAGGAGGGGGAAGATGG - Exonic
1021946407 7:25732156-25732178 AAGTGTGAGGAAAGGAAATCTGG + Intergenic
1022473389 7:30695046-30695068 AACGGGGAGGAGGGGGAAGAGGG + Intronic
1023018195 7:35986388-35986410 AAGTGAGAGGAGGGAGAAGAAGG + Intergenic
1023229604 7:38012815-38012837 AAGGGTGAAGAGTGGGAAGAGGG - Intronic
1023244825 7:38190365-38190387 AAGGTTGGGGAGGGGGATTATGG + Intronic
1023878732 7:44306902-44306924 CGGTGTGAGCAGGGGGAAGAGGG + Intronic
1024470471 7:49764570-49764592 AGGTGTGGGGAGGGGAAACAAGG - Intergenic
1026737961 7:72960824-72960846 AAGGGTGAGGAGGGTAAATGAGG + Intronic
1026788994 7:73319619-73319641 AAGGGTGAGGAGGGTAAATGAGG + Intronic
1027105773 7:75404244-75404266 AAGGGTGAGGAGGGTAAATGAGG - Intronic
1027199622 7:76055243-76055265 TAGTATGAGGATGGGGAAGAGGG + Intronic
1027421979 7:78025726-78025748 AAGTTTGGGGAGAGGGAACAAGG + Intronic
1027711171 7:81603237-81603259 AAATATGAGGAGTGGGGATATGG + Intergenic
1028912719 7:96226175-96226197 GGCTGTGAGGAGGGGGAATGGGG - Intronic
1029584780 7:101463519-101463541 AAGGGGGAAGAGGGGGAAGAGGG - Intronic
1031215166 7:118881256-118881278 AAGTGTGTGAAGGGGGAACAAGG + Intergenic
1031854634 7:126907312-126907334 AAGAGGAAGGAGGGGGAAGAAGG + Intronic
1032156145 7:129470019-129470041 ATGAGTTAGGAGGGGAAATAAGG - Intronic
1032345838 7:131115706-131115728 AAGTTTGAGGAAGAGAAATAAGG - Intronic
1032663551 7:134012529-134012551 AAGTGTGTGGAGGGCGGAGAGGG + Intronic
1033168140 7:139059175-139059197 AAATGTTAGGTGGGGGAAAAAGG - Intronic
1034160026 7:148986846-148986868 AAATGGGATGAGGGTGAATAGGG - Intergenic
1034228969 7:149504475-149504497 AATTCTGAGGAGGGAGAATTAGG + Intergenic
1034822164 7:154226116-154226138 AAGTGGGAGGAAGAGGAACAGGG + Intronic
1037257294 8:16969736-16969758 ATATGTGAGGAGGGGGAAAGTGG + Intergenic
1037443562 8:18942102-18942124 AGGAGTGAGGAGGGAGAAAAAGG + Intronic
1038919190 8:32063947-32063969 AAGTGTGGGCAGGGAGAATGTGG + Intronic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1040697938 8:50024760-50024782 AAGTAGGAGGAGGGTGAGTACGG - Intronic
1040738773 8:50546305-50546327 AAATGTGATGAGGGGGAAAGGGG + Intronic
1041796891 8:61754336-61754358 AAGAGGGAGGAGGGGAAAGAAGG - Intergenic
1042703992 8:71647405-71647427 AAGTGGGAGGAGGGTGAGGATGG + Intergenic
1042803010 8:72741559-72741581 AAGAGTGAGGGGGTGGAATGAGG - Intronic
1043831946 8:84999720-84999742 AGGTGTGTGGATGGGGAACATGG - Intergenic
1045711686 8:104992168-104992190 AAGTGAGAGGAAGGGTAATTGGG - Intronic
1046201620 8:110934999-110935021 AAGTGGGGGGAGGGGTAATATGG + Intergenic
1046516630 8:115270707-115270729 AAAAGTGGGGAGGTGGAATAAGG - Intergenic
1046548723 8:115684888-115684910 AATTCTGAGAAGGGGGATTACGG + Intronic
1046696372 8:117344267-117344289 AAATGTGAGGTGGGGTAAGAGGG - Intergenic
1047171798 8:122500895-122500917 ATGTGTGAGCAGGGGCAACAGGG - Intergenic
1048007613 8:130431953-130431975 AAGGAGGAGGAGGGGGAAGAAGG + Intronic
1048067504 8:130985031-130985053 AAGTGTTTGGAGGAGGAAGAGGG + Intronic
1048102422 8:131368224-131368246 GAGTATGAGGAAGGGGAAGATGG + Intergenic
1048357780 8:133667581-133667603 GAGTGGGAGGAGGAGGAAGAGGG - Intergenic
1048490520 8:134888060-134888082 GAGGGCGAGGTGGGGGAATAGGG - Intergenic
1049122057 8:140747735-140747757 AAGTAGGAGGAGGGGGAGGAAGG + Intronic
1049251474 8:141591420-141591442 AGGTGGGAGGAGGAGGAATGAGG - Intergenic
1051111199 9:13638719-13638741 AAGTTTGAGGAGGGTGAAAAAGG + Intergenic
1051208256 9:14713020-14713042 AAGTGGGAGAATGGGGTATAGGG + Intergenic
1051441868 9:17093386-17093408 AAGTATGAGGAGATGGAATCTGG + Intergenic
1052938080 9:34110107-34110129 GAGTGGGAGCAGGGGGAAGAAGG + Intronic
1053464795 9:38297938-38297960 TAGTGTGGGGCGGGGGAATCAGG + Intergenic
1053715675 9:40885079-40885101 ACGTGTGAGGACGGGCAATCGGG + Intergenic
1054076875 9:60545659-60545681 ACGTGTGAGGAGGGGCAATCAGG - Intergenic
1054408031 9:64778908-64778930 AAGTAGGAGGAGGAGGAAGAGGG + Intergenic
1054908487 9:70431626-70431648 AAGTGAGGTGATGGGGAATATGG + Intergenic
1055903852 9:81270567-81270589 AAATGTGAGGAGGAGGTATGTGG - Intergenic
1056226668 9:84502290-84502312 GAGGGTGAGGAGGGGGAAGTGGG + Intergenic
1056544249 9:87600830-87600852 GGGTGTGAGGAGGGGGCAGAAGG + Intronic
1056546798 9:87620344-87620366 TAGTCTGAGGAGGGGGAAGAAGG - Intronic
1056654202 9:88495854-88495876 AACTGTGAGGAGGTGGACTTGGG + Intergenic
1057384979 9:94599034-94599056 AGGTGTTGGGAGGGGGAATGGGG - Intergenic
1057895142 9:98903322-98903344 AAGAGTGGGGAAGGGGAAGAAGG - Intergenic
1058107421 9:100988558-100988580 AAGAGAGAGGAGGGAGACTAGGG + Intergenic
1059989952 9:119855499-119855521 AGGTGTGATGATGGGGATTATGG + Intergenic
1060535718 9:124386113-124386135 AATTGTGAGGAGGGGAAAATCGG - Intronic
1060556838 9:124512359-124512381 CAGTGTGGGGAGGGGGGCTAGGG + Intergenic
1061063819 9:128265295-128265317 AAGTCCTAGGTGGGGGAATATGG - Intronic
1061933549 9:133845532-133845554 AAGTGCAGGGAGGGGGAAGAGGG - Intronic
1062255868 9:135620210-135620232 AAGGGGGAGTAGGGGGAAAAGGG - Intergenic
1203767816 EBV:35435-35457 AGGTATGAGCAGGGGGAATCAGG - Intergenic
1185490942 X:516579-516601 CAGTGAGAGGAGGGGGGAGAAGG - Intergenic
1185927543 X:4163936-4163958 AAGGGTGAGGAGGGGGGCCAGGG + Intergenic
1186087591 X:6007311-6007333 AAGTGTCAGGAGGTGGAAGGAGG + Intronic
1186173633 X:6902894-6902916 AAGTAGGAGGAGGGGGAAAAAGG + Intergenic
1186751755 X:12628736-12628758 TAGTCTGAGGATGGGGAAAATGG - Intronic
1187356192 X:18574079-18574101 CAGTGTGAGAAGGAGGAAAATGG - Intronic
1187675319 X:21710735-21710757 AACTGTGAAGAGGGGGAAGCTGG + Intronic
1188491509 X:30742937-30742959 GAGGGAGAGGAGGGGGAACAGGG + Intergenic
1189803490 X:44713154-44713176 TGGAGTGAGGATGGGGAATAGGG - Intergenic
1189921297 X:45905444-45905466 GAGGGTGAAGAGTGGGAATATGG - Intergenic
1191033635 X:56002342-56002364 AAGTGTGATGAGTGTGAATGAGG - Intergenic
1191054993 X:56232337-56232359 AAGTGGGAGGAGGTGGAGAAGGG - Intergenic
1191806535 X:65141653-65141675 AAGAGTGGGAAGGGGGAAAAAGG - Intergenic
1191918999 X:66234052-66234074 AAATGTGAGGGGTGGGAAGAGGG - Intronic
1192163210 X:68804106-68804128 AAGTATAAGAAGGGGGAAGATGG - Intergenic
1192866546 X:75139176-75139198 AATTTTGAGCAGAGGGAATAAGG - Intronic
1193825281 X:86217853-86217875 AATTGTAAGGAGAGTGAATATGG + Intronic
1193852117 X:86550924-86550946 AAGGGTGCAAAGGGGGAATATGG + Intronic
1194436507 X:93874061-93874083 AAATGGGAGGAAGAGGAATAAGG - Intergenic
1194794713 X:98197508-98197530 ATGTGTGTGGAGGGGGAGCATGG - Intergenic
1195711802 X:107778925-107778947 TGGTGTGTGTAGGGGGAATAGGG + Intronic
1195930348 X:110068220-110068242 AAGTGTTAGGTAGGGGAAAAAGG + Intronic
1196939225 X:120759429-120759451 AAATGTGAGGTGGGGGAAAAGGG + Intergenic
1197251163 X:124217771-124217793 AAATGTAAGGAGAGGGAATAAGG - Intronic
1197263911 X:124346465-124346487 AAGTGTGAGAAGGAGGTTTAAGG + Exonic
1197299324 X:124758870-124758892 AGTTGAGAGGAGGGGGAAGAGGG + Intronic
1198011512 X:132560786-132560808 AAGAGTGAGGAGTGGGACTTAGG - Intergenic
1198264643 X:134998114-134998136 AAGGGTAAGCAGGGGGAAAATGG - Intergenic
1198376085 X:136041490-136041512 AAGGGAGAGGAGGGGCAACATGG - Intronic
1199233386 X:145465100-145465122 AAGTGTGAGGATGAAGAAAAAGG - Intergenic
1200781330 Y:7218749-7218771 AAGTGGGGGGAGGGGGAGCAAGG + Intergenic