ID: 955130989

View in Genome Browser
Species Human (GRCh38)
Location 3:56168340-56168362
Sequence TAATAGCCACAAAAGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 243}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955130989 Original CRISPR TAATAGCCACAAAAGGAGCA GGG Intronic
910561271 1:88594464-88594486 TATCAACCAAAAAAGGAGCATGG + Intergenic
911488212 1:98528598-98528620 ACATGGCCAGAAAAGGAGCAGGG - Intergenic
912221406 1:107681372-107681394 CAATAGCCACATGAGGATCAAGG + Intronic
913492052 1:119390168-119390190 TAATAGTCACCAAAACAGCATGG - Intronic
913959619 1:143328288-143328310 AACTAGGCACAAAAGGAGCAAGG - Intergenic
913978248 1:143483136-143483158 TAATAGTTACAAAATAAGCAAGG + Intergenic
914053978 1:144153861-144153883 AACTAGGCACAAAAGGAGCAAGG - Intergenic
914072655 1:144308781-144308803 TAATAGTTACAAAATAAGCAAGG + Intergenic
914106499 1:144657575-144657597 TAATAGTTACAAAATAAGCAAGG - Intergenic
914125168 1:144812504-144812526 AACTAGGCACAAAAGGAGCAAGG + Intergenic
914342972 1:146776084-146776106 TAACAGCCAAAAAAGGAACGTGG - Intergenic
915214372 1:154330056-154330078 TAATAGCAGCAAAAGGGGCTGGG + Intronic
916294317 1:163200418-163200440 TCCAAGCCACAAAAGGAACATGG - Intronic
916979889 1:170123246-170123268 TAATAGGCACAAAATGAATATGG - Intergenic
917229328 1:172819093-172819115 TAATAGTCTCAAAAAGTGCATGG - Intergenic
917390003 1:174525421-174525443 AAATAGCCAAAAAAGCATCAAGG - Intronic
918192162 1:182186082-182186104 TATTATCCTCAAAAGCAGCAGGG + Intergenic
919631441 1:199963766-199963788 TAATGGCCACAAAAAGAAAACGG - Intergenic
920925204 1:210334589-210334611 TATTACCCACAGAAGGAGCAGGG - Intronic
921591702 1:217011779-217011801 GAGTAGCCACAAGAGGAGGAAGG - Intronic
1063201663 10:3790213-3790235 TAAGAGCCACACAAAAAGCAAGG - Intergenic
1065502429 10:26395218-26395240 TAATAGGCAAAAAAAGAGAAAGG - Intergenic
1066074463 10:31859149-31859171 CAATAGACACAATAGGAACATGG + Intronic
1067022309 10:42812152-42812174 AACTAGGCAGAAAAGGAGCAAGG - Intronic
1068304531 10:55189110-55189132 TCATGGCTACACAAGGAGCATGG + Intronic
1068717018 10:60199714-60199736 CAACAGCCACAAAAGGAAAATGG - Intronic
1069725697 10:70576441-70576463 TAATACCCACAAAAAGAGAGAGG - Intergenic
1069825992 10:71255488-71255510 GAATTGACACAAAAGGAGCTTGG + Intronic
1070308416 10:75254914-75254936 TAATAGCCAAAAAATGGGCCTGG + Intergenic
1071932681 10:90490506-90490528 AAATAGCCAGAAAAGGAGACAGG + Intergenic
1071997181 10:91160925-91160947 TGACAGCCGCAAAAGGAGAATGG - Intergenic
1072502828 10:96035623-96035645 TCATAGACACAAAAGTAGCAAGG - Intergenic
1074038792 10:109767521-109767543 TGATATGCCCAAAAGGAGCAAGG + Intergenic
1075654058 10:124149751-124149773 TAGCAGCCACAATAGGAGCTAGG - Intergenic
1076620747 10:131785805-131785827 TAATTGACACAAAAGGCCCAGGG - Intergenic
1077561389 11:3263869-3263891 TAAAAGTCAGAAAAGGAGGAGGG + Intergenic
1077567285 11:3309698-3309720 TAAAAGTCAGAAAAGGAGGAGGG + Intergenic
1077759762 11:5081023-5081045 TTATAGTAACAAAAGCAGCATGG + Intergenic
1078489694 11:11757539-11757561 TAATAGGTACAAGAGGACCACGG - Intergenic
1078549857 11:12272549-12272571 TCATAGGCACACAAGAAGCAAGG + Intergenic
1078843356 11:15099661-15099683 TAAGAGACACAACAGCAGCAAGG - Intergenic
1079804573 11:24912980-24913002 TAATAGTGACATAAGGATCATGG + Intronic
1079923523 11:26461772-26461794 TAATAAGCAAAAAAGGAACATGG - Intronic
1082245719 11:49919622-49919644 AACTAGCCACAATAGGATCAGGG + Intergenic
1084719787 11:70897306-70897328 TATAACCCACAAAAGGAGCCAGG + Intronic
1085765746 11:79280297-79280319 AGATGGCCACAAAAGGAGGAAGG - Intronic
1087977799 11:104571349-104571371 TAATACACAAAAAATGAGCATGG - Intergenic
1088683976 11:112269578-112269600 TCATAGCCTCCACAGGAGCAGGG - Intronic
1088946436 11:114517910-114517932 TTATAGCCACACAAGTACCAGGG + Intergenic
1090937387 11:131355775-131355797 GAATAGCCAGAAAAGAAGAAAGG - Intergenic
1091035272 11:132227528-132227550 TAATAGCCAGTAAAGGACCAAGG - Intronic
1093551300 12:20415197-20415219 TGAGAGCCAAAAAAGGAGCGTGG - Intronic
1095573945 12:43713410-43713432 AAATGTCCACAAAAGGAACATGG - Intergenic
1095837901 12:46658414-46658436 GAATAGCTAAAAAAGCAGCAAGG - Intergenic
1097465973 12:59924933-59924955 TTATAGTCACCAAAGCAGCATGG - Intergenic
1097631200 12:62064800-62064822 TAATAGCTTCCAAATGAGCATGG + Intronic
1100179394 12:92068680-92068702 TAATAGCAAGAAAAGGAGAAGGG + Intronic
1100500269 12:95167154-95167176 TAATAGTCAAAAAAGTAGAAAGG - Intronic
1101315892 12:103628546-103628568 TAGAAGCTTCAAAAGGAGCATGG - Intronic
1104691823 12:130832318-130832340 TATTAGGCACAATAGGAGCCTGG - Intronic
1105028342 12:132864998-132865020 TAGTAGCCACAAAATGCACATGG + Intronic
1105221099 13:18328323-18328345 TAATAGTTACAAAATAAGCAAGG - Intergenic
1108273299 13:48783858-48783880 AAATATCCACAAAAGGAGCAAGG + Intergenic
1109346491 13:61120445-61120467 AAATAGTAACAAAAAGAGCAGGG + Intergenic
1110283822 13:73726267-73726289 TATTAGCCACAAAAGAAAGAAGG - Intronic
1111251662 13:85608896-85608918 TAATAGGCAAGAAAGGAGGAAGG - Intergenic
1113248243 13:108422719-108422741 TTATGATCACAAAAGGAGCAGGG + Intergenic
1115174344 14:30545409-30545431 AAATAGTAACAAAAGGAGAATGG - Intergenic
1117328799 14:54692468-54692490 TGAGAGTCCCAAAAGGAGCACGG - Intronic
1117791023 14:59342511-59342533 TACTATGCACAAAAGGAGCTGGG + Intronic
1117924721 14:60766385-60766407 GAATACCCAAAAAAGGAGTAAGG - Intronic
1118134911 14:63012942-63012964 TAATAACCATAAGAGGAACAAGG + Intronic
1120784254 14:88516572-88516594 TAATAGGGACAAAAGCAGAAAGG - Intronic
1122405750 14:101499886-101499908 TAATAGCCAAGAAAGGCGCTTGG - Intergenic
1123423425 15:20149045-20149067 AACTAGGCAGAAAAGGAGCAAGG - Intergenic
1123532646 15:21155566-21155588 AACTAGGCAGAAAAGGAGCAAGG - Intergenic
1125007791 15:34837575-34837597 TAATAAATACAAAAGGATCAAGG + Intergenic
1125117135 15:36107570-36107592 CTCTAGCTACAAAAGGAGCAAGG + Intergenic
1125145929 15:36468413-36468435 TAATAACCCCAAAACGAGCAGGG - Intergenic
1126149584 15:45511184-45511206 TGATAGCCACAAAGCAAGCAGGG + Exonic
1127789068 15:62382132-62382154 TCATTTCCACAAAATGAGCATGG - Intergenic
1127834461 15:62779439-62779461 TAGCACCCACAAAAGGAGGAAGG + Intronic
1128947025 15:71831761-71831783 TAACAGGCACAAAAGGAGACAGG + Intronic
1128960954 15:72003926-72003948 TAATTGCAGAAAAAGGAGCAAGG + Intronic
1130310092 15:82745833-82745855 TTAAAGCCACAAAAGGGGCCGGG + Intergenic
1130775293 15:86973235-86973257 AAATAGCCACATGAAGAGCATGG + Intronic
1134511709 16:14853764-14853786 TAATAGCTACAAAAAGGGCAAGG + Intronic
1134699352 16:16252260-16252282 TAATAGCTACAAAAAGGGCAAGG + Intronic
1134972477 16:18542412-18542434 TAATAGCTACAAAAAGGGCAAGG - Intronic
1136861396 16:33706561-33706583 AACTAGGCAGAAAAGGAGCAAGG + Intergenic
1138617438 16:58181136-58181158 AAATAACCGTAAAAGGAGCAGGG + Intronic
1138853140 16:60654755-60654777 TTATAGCTACAAAAGAAGGATGG + Intergenic
1139991014 16:70939244-70939266 TAACAGCCAAAAAAGGAACGTGG + Intronic
1140630109 16:76841797-76841819 CAATAGCCACAAAAAGAATAAGG - Intergenic
1141752771 16:85970243-85970265 GTATAGCCACAAAAGGTGCTGGG - Intergenic
1203122895 16_KI270728v1_random:1554752-1554774 AACTAGGCAGAAAAGGAGCAAGG + Intergenic
1147306176 17:39565935-39565957 CAATAACCAAAAAATGAGCAAGG + Intergenic
1147361289 17:39932237-39932259 TAATATCCACAACATGAGGAGGG - Intergenic
1148321413 17:46757218-46757240 TAAAAGCCACAAAATAAGCTAGG - Exonic
1148532294 17:48405854-48405876 TAATAGCCACAGACAGAGAATGG + Intronic
1149221965 17:54425330-54425352 CATTACCCAGAAAAGGAGCATGG - Intergenic
1150896458 17:69216480-69216502 TAATAGTCACAAAATGTGTATGG - Intronic
1151381549 17:73729178-73729200 TAATAGCCACACATGGCCCATGG - Intergenic
1153820865 18:8830312-8830334 TTCCAGCCACAAAAGCAGCAGGG + Intronic
1155839359 18:30627859-30627881 TAAAGGCCACAAAAAGAGGATGG - Intergenic
1156570442 18:38246262-38246284 TGATATCCAGAAAAAGAGCAAGG - Intergenic
1156626001 18:38909778-38909800 AAATGGCCACAAAAGTAGAAAGG + Intergenic
1156692608 18:39726539-39726561 ATAGAGCCACAGAAGGAGCAGGG - Intergenic
1157740413 18:50087919-50087941 TAAGAGCCACAAGAGCAGCAGGG + Intronic
1157899948 18:51505164-51505186 GAATAGCCAGAAAAGTAGAAGGG + Intergenic
1159470330 18:68845932-68845954 TAATAGCCACAATATGAAGATGG + Intronic
1159533955 18:69691637-69691659 TGATAGCCAAACAAGGAGAATGG + Intronic
1165710251 19:38005730-38005752 TAATAGTGACATAAGGAGAAAGG + Intronic
1202693457 1_KI270712v1_random:106541-106563 AACTAGGCACAAAAGGAGCAAGG - Intergenic
925061985 2:898409-898431 AAATATCTAGAAAAGGAGCAGGG + Intergenic
925635692 2:5939953-5939975 TAATAAACACAAAAGGAGGCCGG + Intergenic
926598892 2:14820557-14820579 TAATAGCTACAAAAAGAAAATGG + Intergenic
926989259 2:18659886-18659908 TAATAACAAGAAAAGGAGAAAGG - Intergenic
929237389 2:39620530-39620552 TAATGGAAACTAAAGGAGCAAGG - Intergenic
929371994 2:41236706-41236728 CAATAGCCAAAGGAGGAGCAAGG + Intergenic
929752551 2:44730893-44730915 TAATAGCCATACAAAGAACATGG + Intronic
930095995 2:47567623-47567645 AGACAGCCACAAAAGTAGCAGGG - Intronic
932473794 2:71986414-71986436 TAATAGACAGAAAATCAGCAAGG - Intergenic
933953115 2:87348041-87348063 AACTAGGCAGAAAAGGAGCAAGG + Intergenic
934182957 2:89644144-89644166 TAATAGTTACAAAATAAGCAAGG + Intergenic
934237346 2:90244386-90244408 AACTAGGCAGAAAAGGAGCAAGG + Intergenic
934293245 2:91718331-91718353 TAATAGTTACAAAATAAGCAAGG + Intergenic
934459771 2:94207680-94207702 AACTAGGCAGAAAAGGAGCAAGG + Intergenic
936666362 2:114601093-114601115 GAATCGCCACAAAGAGAGCAAGG + Intronic
936703824 2:115045703-115045725 TAATATCAAGAAAAGAAGCATGG - Intronic
938546999 2:132343093-132343115 TCACAGCCAAAAATGGAGCATGG + Intergenic
939090324 2:137772766-137772788 TAATAGCTACAACAGTAGTAGGG - Intergenic
940695801 2:156976821-156976843 AAATGGCAACAAAAAGAGCAAGG - Intergenic
940910417 2:159205174-159205196 AAAGAGCCACAAAAGGGGAAAGG - Intronic
942090086 2:172481320-172481342 AAATAGCCACATAAGGACTAGGG + Intronic
942947666 2:181687287-181687309 AAAGAGCCACAAAAGTATCAAGG + Intergenic
944155629 2:196604325-196604347 TCATAGGCACAAAGGGAGGAGGG - Intergenic
944758606 2:202790054-202790076 TTATAGACAGAAAAGGACCAGGG - Intronic
947051652 2:226051034-226051056 TAATAACCACACAATAAGCATGG - Intergenic
1169510897 20:6262580-6262602 TGATAGCCACGAGAAGAGCAGGG - Intergenic
1169561743 20:6808900-6808922 TTATAGTGACAAAAGGAGAATGG - Intergenic
1171721262 20:28565407-28565429 AAATAGGCACAAAAAGAACATGG + Intergenic
1171862855 20:30417419-30417441 AAATAGGCACAAAAAGAACATGG - Intergenic
1173864071 20:46303091-46303113 TGAAAGCCACACAAGGAGCTTGG - Intronic
1174729944 20:52906255-52906277 CAATAGCCACAAGTGGTGCAGGG + Intergenic
1176960193 21:15150731-15150753 TTATTGCAACAAAATGAGCAAGG - Intergenic
1177289083 21:19086806-19086828 CCATAGGGACAAAAGGAGCAAGG - Intergenic
1177476090 21:21625581-21625603 TAATATCCACAAAGGGTGTAAGG - Intergenic
1181356428 22:22298776-22298798 AACTAGGCAGAAAAGGAGCAAGG - Intergenic
949978405 3:9481836-9481858 TAATAGCCACAAGACCAGCATGG + Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953277111 3:41512887-41512909 TAATAGTCACCAAAACAGCATGG + Intronic
954859269 3:53674141-53674163 TAATAGACACAAAATGACAAGGG - Intronic
955130989 3:56168340-56168362 TAATAGCCACAAAAGGAGCAGGG + Intronic
955543270 3:60000562-60000584 TAGTAGCCACAAAATTAGGATGG - Intronic
956457220 3:69434161-69434183 TAACACCCACTAAAGAAGCAAGG - Intronic
957511758 3:81198271-81198293 AAATATCCACAAAGGGAGCTTGG + Intergenic
959679545 3:109077712-109077734 AAATAACAACAAAAGAAGCAAGG + Intronic
960322005 3:116248289-116248311 TAACAGCTAGAAAAGGAGAAAGG + Intronic
960459800 3:117919744-117919766 TCATAGCCACAGAAGGAATAAGG - Intergenic
960707812 3:120497388-120497410 AAATAGCCAGAAAAGGGGGAAGG - Intergenic
961202880 3:125058178-125058200 TAAAGGCCAGAAAAGAAGCAAGG - Intergenic
961334366 3:126161449-126161471 CAGGAGTCACAAAAGGAGCAAGG + Intronic
961655056 3:128436634-128436656 TCATAGTCACCAAAGCAGCATGG + Intergenic
961794598 3:129400756-129400778 GAATAGCCACAGATGCAGCAGGG - Intergenic
962496064 3:135939990-135940012 CAATAGTAACAAAAGTAGCATGG - Intergenic
962538522 3:136354208-136354230 GAATAGCCAAAAAAGGAGGAAGG + Intronic
963713129 3:148770563-148770585 AAATAGGCAGAAAAGCAGCAAGG + Intergenic
964336795 3:155662983-155663005 TTATAGCCAAAAAAGAAGAAAGG - Intronic
965631050 3:170733140-170733162 TAATAACAACATAAGGAGGATGG + Intronic
965979224 3:174666866-174666888 TCATAGAAACAAAAGGAGAATGG - Intronic
966582483 3:181583704-181583726 TAATAGACACAAAAGCTACAGGG - Intergenic
970229514 4:13894278-13894300 TAATAGCTACATAAGGATGAGGG - Intergenic
971297560 4:25411285-25411307 TAATAGCCAAAATAGCAACAGGG - Intronic
971551888 4:27967697-27967719 TAAAAGCCAAAAAAGGTGAAAGG - Intergenic
971745932 4:30580966-30580988 AAATAGCCAAAAAAGGAGATTGG - Intergenic
971754052 4:30684826-30684848 TAATAGGCACAAAAGGAAAAAGG + Intergenic
972262212 4:37420708-37420730 AAAAAGGCACAAAAGGAGCAGGG + Intronic
972439483 4:39072744-39072766 TAATAGGAACAAAAAGAGTAAGG + Intronic
974808273 4:66911043-66911065 TATAAGCCATAAATGGAGCATGG + Intergenic
976855744 4:89603687-89603709 TAACAACAACAAAATGAGCAAGG + Intergenic
977021027 4:91760465-91760487 TAATAAACACCAAAGGAGGAGGG + Intergenic
977247692 4:94652893-94652915 CAAGAGTCACAAAAGGAGAAAGG - Intronic
977570465 4:98623729-98623751 TGAAAGCCACCAAAGGAGTAAGG - Intronic
978041888 4:104075994-104076016 AAATAGACAGAAAAGTAGCAGGG + Intergenic
978782583 4:112572162-112572184 TCATAGCCACCAAAACAGCATGG + Intronic
979593996 4:122512680-122512702 TAATAGTCAAAAAAGGAAGAAGG - Intergenic
980734242 4:136863911-136863933 AAATAGCCACAGAGGGAGCTTGG + Intergenic
982362393 4:154533995-154534017 TAATAGAAACAAAGGGAGGAGGG - Intergenic
982686718 4:158499271-158499293 TAAGAGCCAAGAAAGGAGAAAGG + Intronic
984724480 4:183007749-183007771 TCATAGACACAAAAGTAGAATGG + Intergenic
985329290 4:188810719-188810741 TGTTAACCACAAAAGGATCATGG + Intergenic
987185517 5:15413716-15413738 CAATAGTCACCAAAGCAGCATGG + Intergenic
989997867 5:50857100-50857122 CAATTGCCACAAAAGGAGTTAGG + Intergenic
992445055 5:76825891-76825913 TAAAGACCAAAAAAGGAGCAAGG - Intronic
993161672 5:84299256-84299278 TAATATCGAAAGAAGGAGCATGG + Intronic
994235444 5:97357228-97357250 AAATAGCCTCAACAGGAGAATGG - Intergenic
995130852 5:108629110-108629132 TGAGAGCCACAAGAGGAGAAGGG - Intergenic
995682902 5:114740652-114740674 CAATAGCCACACAAGGTCCATGG - Intergenic
995920791 5:117308714-117308736 TGATATACACAAAATGAGCATGG - Intergenic
997724437 5:136108643-136108665 TAACAGCAACAAAAAAAGCAAGG + Intergenic
998688768 5:144562241-144562263 CTATATCAACAAAAGGAGCATGG - Intergenic
999220905 5:149976646-149976668 AAATAGCCAGAAAAAGAGAAAGG - Intronic
1000714106 5:164619863-164619885 TAATAGTCACAAAAAGAGGGAGG + Intergenic
1002405850 5:179030391-179030413 TCACTGCCACAAAAGGAGGAGGG + Intronic
1002679943 5:180953550-180953572 TAAAAGTCAAAAAAGTAGCAGGG - Intergenic
1006001979 6:30972339-30972361 TCACAGTCACAAAAGAAGCAGGG + Intergenic
1006009605 6:31031439-31031461 TCACAGTCACAAAAGAAGCAGGG + Intronic
1007586886 6:42996166-42996188 TAAGAGCCAAAAAAGGGGCCAGG + Intronic
1008795848 6:55302139-55302161 TAATAGCCATCCTAGGAGCACGG + Intergenic
1009937253 6:70248681-70248703 TATTACCAACAAAAGCAGCATGG + Intronic
1010880169 6:81157834-81157856 TAATAGCTACCAAAATAGCATGG + Intergenic
1012196213 6:96344216-96344238 TAAAAGCCTCCAAAGGAGCAGGG + Intergenic
1012208014 6:96485127-96485149 TTATAGTCACCAAAGCAGCACGG - Intergenic
1012561771 6:100590054-100590076 TAATAGCTAGAAAACAAGCAAGG + Exonic
1013890795 6:115024526-115024548 TCTTAGCCACAAAAAGATCATGG + Intergenic
1015907943 6:138136739-138136761 TAAGGGCCAGAAAAGGAGAAAGG + Intergenic
1016909687 6:149185675-149185697 CAATAGCCACCAAAACAGCATGG - Intergenic
1020246785 7:6435546-6435568 TAAAGGCCACAGAAGGAACAGGG + Intronic
1020404123 7:7812729-7812751 TAAAAACCACAAAATCAGCAGGG + Intronic
1020521343 7:9191230-9191252 TAATATACACAAAAATAGCATGG - Intergenic
1022495684 7:30851729-30851751 ACACAGCCACTAAAGGAGCACGG + Intronic
1027150638 7:75731135-75731157 CAATACCCACTAAAGGAGCAAGG + Intronic
1027514476 7:79124952-79124974 TAAAAGCCACGAAAGGTGGAGGG + Intronic
1029031888 7:97477373-97477395 CAAATGCCAGAAAAGGAGCAGGG + Intergenic
1030900018 7:115111854-115111876 TCAGAGCCACAAAAGAAACATGG + Intergenic
1031220227 7:118956423-118956445 TAATAGCCAAGAAAGAAGGAAGG + Intergenic
1031429050 7:121643517-121643539 TAATAGCAACAGAAGAAACAAGG + Intergenic
1034514811 7:151567527-151567549 TAATAGGAACAGAGGGAGCATGG - Intronic
1038925063 8:32129362-32129384 TGATCGCCACCAAAGAAGCAAGG - Intronic
1041115436 8:54531388-54531410 TAATGGCCATGAAAAGAGCAAGG + Intergenic
1042411520 8:68472040-68472062 AAAAAGCCAGAAAAAGAGCATGG - Intronic
1044702312 8:94975821-94975843 TTATATCCACAAAATGAGAATGG - Intronic
1045570285 8:103361764-103361786 TAATAGCCACAATAAGAAAAGGG + Intergenic
1049271001 8:141696280-141696302 TATTTGCCCCAAGAGGAGCAAGG - Intergenic
1051831040 9:21277084-21277106 TAAGAGACACAAAGGAAGCAAGG - Intergenic
1052042045 9:23749884-23749906 TAGTAGGCACCAAAGGAGGAAGG - Intronic
1053095263 9:35321510-35321532 TAATAGTAACAAGAGGAGCCAGG - Intronic
1053690274 9:40583493-40583515 AACTAGGCAGAAAAGGAGCAAGG + Intergenic
1054301525 9:63384454-63384476 AACTAGGCAGAAAAGGAGCAAGG + Intergenic
1055777506 9:79782193-79782215 TAATAGCCAGGAAAGGAGAGAGG + Intergenic
1056706345 9:88955378-88955400 TACTAGCCTCTCAAGGAGCAGGG + Intergenic
1058099776 9:100905965-100905987 TAAAAGACAGAAAAAGAGCATGG - Intergenic
1059393724 9:114017465-114017487 AAATATCCAGAAAAGGAGCTGGG - Intronic
1059616238 9:115954325-115954347 TAAGAGCTAGAAAAGAAGCAAGG - Intergenic
1060006099 9:120001178-120001200 TAATAGAAACAGAAAGAGCATGG - Intergenic
1193469568 X:81883188-81883210 TCATAGCCACCAAAGCAGCATGG - Intergenic
1193722376 X:85002666-85002688 CAATATTCACAACAGGAGCAAGG - Intergenic
1194093665 X:89608669-89608691 TAATAGCTACAAAAATACCAAGG + Intergenic
1194306665 X:92257129-92257151 ACATGGCCAGAAAAGGAGCAAGG + Intronic
1195053258 X:101117746-101117768 TAATAGCTACAAAGGGAGGCAGG - Intronic
1195299385 X:103512083-103512105 CCATAGACTCAAAAGGAGCAAGG + Intronic
1195812282 X:108847766-108847788 CAATAGTCACAAAAACAGCATGG + Intergenic
1196597594 X:117563318-117563340 TCATTGTCACAAAGGGAGCATGG - Intergenic
1197610115 X:128628694-128628716 TAGTACTCACAAAAAGAGCATGG + Intergenic
1197644023 X:128998046-128998068 TAGAAGCCATAAAAGGATCATGG + Intergenic
1197665877 X:129222922-129222944 GAAGAGCCACAACAGTAGCAGGG - Intergenic
1198069165 X:133130789-133130811 TAATAGACACAAACAGAGGAAGG - Intergenic
1199025796 X:142936204-142936226 TAATAGCAACAATAGAAGCCAGG - Intergenic
1200087282 X:153613441-153613463 TCTCAGCCACAAAAGGATCACGG + Intergenic
1200446295 Y:3264795-3264817 TAATAGCTACAAAAATACCAAGG + Intergenic
1201554389 Y:15253641-15253663 TAATAGCCAAGAAAGAAGGAAGG - Intergenic
1201734904 Y:17248748-17248770 AAATGGCCACAAAAAGTGCAAGG - Intergenic
1202390805 Y:24368607-24368629 GAATAGCCAGAAAACAAGCAGGG + Intergenic
1202479979 Y:25301509-25301531 GAATAGCCAGAAAACAAGCAGGG - Intergenic