ID: 955132044

View in Genome Browser
Species Human (GRCh38)
Location 3:56179717-56179739
Sequence CCCAATCTTCCCTGTCTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 209}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955132044_955132052 -1 Left 955132044 3:56179717-56179739 CCACCAAGACAGGGAAGATTGGG 0: 1
1: 0
2: 1
3: 12
4: 209
Right 955132052 3:56179739-56179761 GAAGGAAAGGTGGGAGTTATGGG 0: 1
1: 0
2: 2
3: 40
4: 429
955132044_955132050 -10 Left 955132044 3:56179717-56179739 CCACCAAGACAGGGAAGATTGGG 0: 1
1: 0
2: 1
3: 12
4: 209
Right 955132050 3:56179730-56179752 GAAGATTGGGAAGGAAAGGTGGG 0: 1
1: 0
2: 4
3: 77
4: 960
955132044_955132051 -2 Left 955132044 3:56179717-56179739 CCACCAAGACAGGGAAGATTGGG 0: 1
1: 0
2: 1
3: 12
4: 209
Right 955132051 3:56179738-56179760 GGAAGGAAAGGTGGGAGTTATGG 0: 1
1: 0
2: 18
3: 303
4: 3816
955132044_955132053 14 Left 955132044 3:56179717-56179739 CCACCAAGACAGGGAAGATTGGG 0: 1
1: 0
2: 1
3: 12
4: 209
Right 955132053 3:56179754-56179776 GTTATGGGAACTAAGAGTTTTGG 0: 1
1: 0
2: 0
3: 8
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955132044 Original CRISPR CCCAATCTTCCCTGTCTTGG TGG (reversed) Intronic
901633698 1:10659929-10659951 CCCCACCTTGCCTGTCTTGAAGG + Exonic
902453332 1:16513514-16513536 CGCAGTCTCACCTGTCTTGGCGG - Intergenic
902473383 1:16666188-16666210 CGCAGTCTCACCTGTCTTGGCGG - Intergenic
902485420 1:16741254-16741276 CGCAGTCTCACCTGTCTTGGCGG + Intronic
902499151 1:16896731-16896753 CGCAGTCTCACCTGTCTTGGCGG + Intronic
903811754 1:26038601-26038623 CCAAATGTTCCCTTTCCTGGAGG - Exonic
905045184 1:34992328-34992350 CCCAATCTTCCCAGCCTTCCAGG - Exonic
906034827 1:42743781-42743803 CCAAATCTTCACTGTGTTTGAGG + Intergenic
909203794 1:72726949-72726971 CCCAATCTTTTCTGGCTTGTAGG - Intergenic
911464536 1:98234740-98234762 CCCAATCTTTTCTGGCTTGTAGG - Intergenic
911538480 1:99129434-99129456 CCCAATCTTCTCTGGTTTGTAGG + Intergenic
912285616 1:108365469-108365491 CCTAATGTTCCCTATTTTGGAGG - Intergenic
913217207 1:116630650-116630672 CCCAATCTTTACAGTCTAGGAGG + Intronic
913268264 1:117066482-117066504 CCCTAACTTCCCTGGGTTGGAGG + Intronic
915125560 1:153661178-153661200 CCAAACCTTCCTTGTCTTGTAGG + Exonic
917290064 1:173462565-173462587 CCCAATCTTTTCTGGCTTGTAGG - Intergenic
918959014 1:191246740-191246762 CCCAATCTCCTCTGGCTTGTAGG - Intergenic
920213835 1:204348322-204348344 CCCAACCTGCCCTGTGTTGAAGG - Intronic
921033408 1:211353780-211353802 CCCAATCTTCCCTTGCCTTGAGG + Intronic
921222668 1:212984392-212984414 CCCGCTCATCCCTGTCATGGAGG - Intronic
921947253 1:220894605-220894627 CGCCATCTTCCCTGTTGTGGTGG + Intergenic
922777994 1:228226229-228226251 CCCATGCCTCCCTGACTTGGTGG + Intronic
923532988 1:234826336-234826358 CCTAATTTACCCGGTCTTGGTGG - Intergenic
924453301 1:244198485-244198507 TCCTATCCTCCCTGGCTTGGAGG - Intergenic
1066251242 10:33634702-33634724 TCCAAGCTTACCTTTCTTGGAGG + Intergenic
1068299216 10:55117055-55117077 CACAGTTTTCCCTGTTTTGGGGG + Intronic
1072027004 10:91469417-91469439 CCCAATCTCTTCTGTCTTGAAGG - Intronic
1072826398 10:98611074-98611096 CCCCATTTTCCCAGTGTTGGGGG + Intronic
1073050354 10:100663110-100663132 CCCAAGCTTCCCAATTTTGGGGG + Intergenic
1073984328 10:109191214-109191236 CCCACTCATACGTGTCTTGGAGG + Intergenic
1075777119 10:124996276-124996298 CCCAGGCTGCCCTCTCTTGGCGG + Intronic
1077445278 11:2587868-2587890 CCCAATGTCCCCCGACTTGGGGG + Intronic
1077787777 11:5403150-5403172 CCCAATCTTATCTATCTTGTGGG + Exonic
1080036272 11:27715024-27715046 CCAAATGGTCCCTATCTTGGTGG - Intronic
1083094771 11:60239464-60239486 TCCAACCTGTCCTGTCTTGGGGG + Intronic
1083503286 11:63131606-63131628 CCCAATCTTTTCTGGCTTGTAGG + Intronic
1083876414 11:65526374-65526396 CCCAACCTGCCCTGTCCTGGAGG + Intronic
1084625262 11:70301302-70301324 CTCCATCTTCCCTGTGTTGGGGG - Intronic
1086964481 11:93013664-93013686 CCCAGACTTCCCTGTCTATGTGG + Intergenic
1088814405 11:113411428-113411450 CCCAATTTCCCCAGTCTTGGTGG + Intronic
1088814615 11:113412707-113412729 CCCATTCTTCTCTGGTTTGGCGG + Exonic
1088906952 11:114162344-114162366 CCCCATCTTCTCTGTCTTTGAGG - Intronic
1090612236 11:128481730-128481752 ACCAATCTCCGCTGTCATGGAGG - Intronic
1091356791 11:134943741-134943763 CCCAGTGCTCCCTGTCTTTGTGG + Intergenic
1094706551 12:32919999-32920021 CCCTATCTGCCCTGTCTGTGAGG - Intergenic
1098510083 12:71301488-71301510 CCCAATCATGACAGTCTTGGAGG - Intronic
1105508961 13:21035508-21035530 CCCAATTTTGCCTGGCTTGATGG - Intronic
1106000149 13:25714654-25714676 CCAAACCTTCACTTTCTTGGAGG + Intronic
1107715499 13:43195491-43195513 CCCAATAGTCCCTGTCTGAGGGG - Intergenic
1108789189 13:53946171-53946193 CCTTATTTTCCCTGTCTTGTAGG + Intergenic
1108800550 13:54090559-54090581 CCCAATCTTTTCTAGCTTGGAGG + Intergenic
1109150784 13:58844868-58844890 CCCAATCTTTTCTATCTTGTAGG - Intergenic
1110619396 13:77578321-77578343 CCCCCTCCTCCCTTTCTTGGTGG - Intronic
1112506452 13:99979205-99979227 CCCATTCTTCCCTGTCCTGGGGG - Intergenic
1113954386 13:114089392-114089414 CCTGATCTTCCCTGGCATGGAGG + Intronic
1116072985 14:40073067-40073089 CCCAGTCTTCTCTCTTTTGGAGG + Intergenic
1117999847 14:61512788-61512810 CCCAATTTTCTTTGTTTTGGGGG + Intronic
1118696569 14:68392200-68392222 CCCAATGTACCCTGTAGTGGTGG - Intronic
1119137258 14:72232306-72232328 CACCATCTTCCCTCTCCTGGAGG - Intronic
1120300834 14:82704675-82704697 CCCAATCTCTCTTGACTTGGAGG + Intergenic
1120582138 14:86265649-86265671 CCCAATCTCTCCTGGCTTGTAGG + Intergenic
1122087426 14:99317441-99317463 CCCACTCTTCCCTCGCATGGGGG - Intergenic
1123506648 15:20947731-20947753 CCCAATCTCTTCTGGCTTGGAGG + Intergenic
1123563873 15:21521476-21521498 CCCAATCTCTTCTGGCTTGGAGG + Intergenic
1123600127 15:21958760-21958782 CCCAATCTCTTCTGGCTTGGAGG + Intergenic
1125128151 15:36249080-36249102 ACCAAACTTCCCTGTCTTGAAGG - Intergenic
1126070885 15:44863952-44863974 CCAAGGCTTCTCTGTCTTGGAGG + Intergenic
1127711543 15:61604031-61604053 CCCAATATTGCCTGTCTTATTGG + Intergenic
1128618567 15:69129757-69129779 CCCCCTCTCCCCTGTCTAGGTGG - Intergenic
1128846769 15:70905624-70905646 CACAGTTTTCCCTGTTTTGGAGG - Intronic
1128983613 15:72203387-72203409 GCCAATTTCCCCTGTATTGGAGG - Intronic
1129566727 15:76631613-76631635 CCCAATCTTTTCTGGCTTGTAGG + Intronic
1202972233 15_KI270727v1_random:248571-248593 CCCAATCTCTTCTGGCTTGGAGG + Intergenic
1132558352 16:582519-582541 CCCATTCTGCCCTGTGTCGGAGG + Intronic
1134400258 16:13903420-13903442 CCCCATCATCCCTTTGTTGGGGG + Intergenic
1137701214 16:50499193-50499215 CCCAAATTTCCCTGTTTTAGGGG + Intergenic
1138098465 16:54232181-54232203 CCCATCCATCCCTGCCTTGGAGG - Intergenic
1139106911 16:63837021-63837043 CCTAATCTCTCCTGTCTTGTAGG - Intergenic
1141767453 16:86067952-86067974 CCCACCCCTCCCTGTCTGGGAGG - Intergenic
1143316319 17:6036053-6036075 GCCAATTATCCCTGTCCTGGAGG + Intronic
1146211167 17:30944953-30944975 CCCTATCTTCTCTGTCTGGAAGG - Exonic
1146366691 17:32234417-32234439 CCCAATCTTCATTGTTTAGGAGG - Intronic
1146655254 17:34631203-34631225 CCCATGCTTCCCAGACTTGGAGG - Intronic
1147461240 17:40570630-40570652 CCCAATCTCCTCTGGCTTGTAGG - Intergenic
1148858334 17:50591260-50591282 CCAAATCCTCACTATCTTGGAGG + Intronic
1151213865 17:72564200-72564222 CCCCGTCTCTCCTGTCTTGGTGG + Intergenic
1151608759 17:75156941-75156963 CCCAATCTTCCCACTCTTAAAGG + Intronic
1154497875 18:14975562-14975584 CCCAGTGCTCCCTGTCTTTGTGG - Intergenic
1155073500 18:22336177-22336199 GCCTAGCTCCCCTGTCTTGGTGG + Intergenic
1155536923 18:26828239-26828261 CCCATTCTTCCCTTTCTTCCTGG + Intergenic
1155779533 18:29813245-29813267 CCCAATCTCTCCTGGCTTGTAGG - Intergenic
1156781214 18:40853073-40853095 TCCTATCTCCCCTATCTTGGGGG - Intergenic
1157769780 18:50335616-50335638 CCCAATCTGCTCTGTCACGGTGG + Intergenic
1158510948 18:58090136-58090158 CCCAAACTTCCTTTTCTTAGAGG + Intronic
1158708139 18:59812610-59812632 TCCAAACCTCCATGTCTTGGTGG + Intergenic
1158903120 18:61984900-61984922 CCCATTCTTCCCAGTCATGATGG + Intergenic
1160237627 18:77098730-77098752 CCCACTCTGCCCTGCCTTGGCGG - Intronic
1161374387 19:3931793-3931815 CCCACTTTTCCTTGTATTGGTGG + Intergenic
1161470114 19:4453031-4453053 CCCAGTCCTGCCTGCCTTGGAGG - Intronic
1165186353 19:34025714-34025736 CCCTTTCTTCCCTGTGGTGGTGG - Intergenic
1165831603 19:38733416-38733438 CCTAATCTTCCCCTTCCTGGAGG + Intronic
1202705571 1_KI270713v1_random:21252-21274 CGCAGTCTCACCTGTCTTGGCGG - Intergenic
925404034 2:3594488-3594510 CCGAATCTTGCATGTTTTGGGGG - Intergenic
928179975 2:29062149-29062171 CCCCATCTTCCCTGGAGTGGGGG + Exonic
928900236 2:36309664-36309686 CCCAATCTCCTCTGGCTTGTAGG - Intergenic
929557104 2:42932300-42932322 CCGAATCTACCCTGTGCTGGAGG + Intergenic
930318520 2:49826655-49826677 CCCAATCTCCTCTGGCTTGTAGG + Intergenic
930951514 2:57148371-57148393 CCCAATCTCTTCTGTCTTGGAGG - Intergenic
931475129 2:62579809-62579831 TCCAATCTGCTCTGTCTTAGAGG + Intergenic
936795786 2:116202899-116202921 CCCAATCTCCTCTGGCTTGCAGG + Intergenic
937271072 2:120653275-120653297 CGCAAACTTCCCTGTATGGGAGG - Intergenic
938419505 2:131133009-131133031 CCCAAACTTCCCTCACCTGGAGG - Exonic
939260893 2:139807377-139807399 CCCATAATTCCCTGTCATGGAGG - Intergenic
947517074 2:230815296-230815318 CCCCACCTTCCCTGGCTTAGAGG + Intronic
1169209651 20:3758987-3759009 CCCACGCTGCCCTGGCTTGGTGG - Intronic
1170723371 20:18903692-18903714 CCCAGTCATTCCTGTCTTAGGGG + Intergenic
1171120684 20:22566740-22566762 CCTACTCTTCTTTGTCTTGGAGG - Intergenic
1171982544 20:31638051-31638073 CCCAGTGGTCCCTGTCTTAGAGG + Intronic
1172167691 20:32908940-32908962 CCCAATCTTTCCTGTCCTCCAGG - Intronic
1172269474 20:33645968-33645990 CACATTCTTCCCTGTCTTTTTGG + Exonic
1174553136 20:51375736-51375758 CCCAACCTTCCATCTCTTGCTGG + Intergenic
1174594106 20:51669686-51669708 CCCCATCTTCCCTATCTTCAGGG - Intronic
1175053435 20:56176305-56176327 CACAATTCTCCCTGCCTTGGAGG - Intergenic
1176987421 21:15454178-15454200 CCCAATCTTTTCTGGCTTGCAGG + Intergenic
1177280278 21:18973146-18973168 CCCAATCTTTTCTGGCTTGCAGG - Intergenic
1177474238 21:21597863-21597885 CCCAAACTTTCCTGTCCTGTAGG + Intergenic
1178028271 21:28493113-28493135 CCAATTCTAACCTGTCTTGGAGG + Intergenic
1180818566 22:18809041-18809063 CCCAATCTTTACAGTCTAGGAGG + Intergenic
1181204789 22:21243496-21243518 CCCAATCTTTACAGTCTAGGAGG + Intergenic
1182427951 22:30284740-30284762 CCCAGCCTTCCCTGTCATTGTGG - Intergenic
1182687264 22:32130884-32130906 CCCATTCTTCCTTTTCTTTGTGG - Intergenic
1185295079 22:50049154-50049176 CCCACTCTCCCATGTCCTGGGGG - Intronic
1203222136 22_KI270731v1_random:51919-51941 CCCAATCTTTACAGTCTAGGAGG - Intergenic
1203268695 22_KI270734v1_random:34894-34916 CCCAATCTTTACAGTCTAGGAGG + Intergenic
949650997 3:6159344-6159366 CCCTGTCTTCCCTGTCCTGATGG + Intergenic
949817206 3:8071042-8071064 CCCAGGCTTTCCTGCCTTGGTGG + Intergenic
950907454 3:16552230-16552252 CTCAATGCTCCATGTCTTGGGGG + Intergenic
955132044 3:56179717-56179739 CCCAATCTTCCCTGTCTTGGTGG - Intronic
955821153 3:62896874-62896896 ATCAATCTTCCCTCTATTGGTGG - Intergenic
955946514 3:64199596-64199618 CCAAATTTTCCCTATGTTGGTGG + Intronic
959423026 3:106151136-106151158 CCCACTCTTTCCTGGCTTGTAGG + Intergenic
966553118 3:181228227-181228249 CCCAATCTCTTCTGTCTTGTAGG + Intergenic
967574979 3:191078694-191078716 CCCAATCTCTTCTGTCTTGTAGG - Intergenic
969401053 4:6955790-6955812 CGCAATCCTCCCTGACCTGGTGG - Intronic
969873941 4:10122229-10122251 CCCAAGCTTCCATGACTTGCAGG - Intergenic
974539619 4:63217671-63217693 CCCAATCTTTTCTGGCTTGTAGG + Intergenic
978952735 4:114580863-114580885 CCCAATCTTTTCTGGCTTGTAGG + Intergenic
979208853 4:118076124-118076146 CCCAATCTTTTCTGGCTTGGAGG + Intronic
979968688 4:127107646-127107668 CCCAATCTGCTCTGGCTTGTAGG - Intergenic
981135768 4:141209190-141209212 TCCAGTCCTCCCTTTCTTGGTGG - Intronic
981161310 4:141502477-141502499 TCCAATGTTCCCAGTCCTGGTGG - Intergenic
983540879 4:168908167-168908189 CCCCTTCTTTTCTGTCTTGGGGG + Intronic
986122750 5:4857401-4857423 CCCATTATCCCCTGTTTTGGGGG + Intergenic
986635327 5:9816368-9816390 TCGAATCTTCACTGTCTTGTTGG - Intergenic
987243337 5:16023767-16023789 CCCTATCTTACCTGTCTAGGTGG - Intergenic
988273549 5:29050252-29050274 CCCATTCTTTTCTGTCATGGTGG + Intergenic
989070802 5:37509069-37509091 CCTAATTTTCCCTGAATTGGTGG + Intronic
989657240 5:43758399-43758421 CCCAATCTTTTCTGGCTTGTAGG + Intergenic
990366380 5:55074936-55074958 CCCACTCTACCCTGTGATGGTGG + Intergenic
991633379 5:68679365-68679387 CCCAAACTTACCAGACTTGGGGG + Intergenic
993291812 5:86081938-86081960 CCCACTCTCCTCTGTCTTGTAGG + Intergenic
996675884 5:126173744-126173766 CCCAGTCTTTTCTGGCTTGGAGG - Intergenic
997512592 5:134463769-134463791 CCCAAACTTGCCTGTCCTTGGGG + Intergenic
999731724 5:154480197-154480219 CCCAAGCCTCCCTGGCCTGGAGG + Intergenic
1006240931 6:32678407-32678429 CCCAATCTCCTCTGGCTTGTAGG + Intergenic
1006510192 6:34517276-34517298 CCCCATCTTCCCTCACCTGGGGG + Intronic
1006824464 6:36924189-36924211 CCTAGTCCTCCCTGCCTTGGCGG + Intronic
1007629199 6:43263339-43263361 CCCAACCTTACCTGTCTCTGTGG - Exonic
1013076698 6:106778086-106778108 CCCAAACTTGTCTGTTTTGGAGG + Intergenic
1014564201 6:122928908-122928930 CCCAATCTTTTCTGGCTTGTAGG + Intergenic
1015247653 6:131092774-131092796 CCCAATCTTTTCTGGCTTGTAGG - Intergenic
1018608939 6:165627569-165627591 CCCAAGCTGCCGTGACTTGGGGG + Intronic
1018725987 6:166613959-166613981 CCCCATCTTCCCCGTCTTTCTGG + Intronic
1020138237 7:5598373-5598395 CCCTTTCTTCTCTGGCTTGGGGG + Intronic
1020446008 7:8268698-8268720 CCCAATTGTCCCTGTGTAGGGGG - Intergenic
1021223345 7:17999812-17999834 CCCAATGTTCGCTATCTTTGGGG - Intergenic
1023359583 7:39401302-39401324 CCCACCCTTCCCTGTAGTGGTGG - Intronic
1023968682 7:44976731-44976753 CCCCATCTTGCCAGTCTTGGGGG - Intronic
1024558046 7:50620664-50620686 CCCATTTGTCCCTGTCTGGGAGG + Intronic
1025870297 7:65425070-65425092 CCCAATCTTTCATGGCTTGTAGG - Intergenic
1026083945 7:67247145-67247167 CCAAATCTTCCATTTCTTGCTGG - Intergenic
1026693087 7:72566882-72566904 CCAAATCTTCCATTTCTTGCTGG + Intronic
1026776143 7:73232084-73232106 CCCACCCTTGCCTGTCTTGTGGG + Intergenic
1027016999 7:74785455-74785477 CCCACCCTTGCCTGTCTTGTGGG + Intronic
1027071027 7:75160481-75160503 CCCACCCTTGCCTGTCTTGTGGG - Intergenic
1033709965 7:143932834-143932856 CCCAATCTTTCCTGGCCTGCAGG + Intergenic
1037768766 8:21787237-21787259 GCCTCTCCTCCCTGTCTTGGAGG + Intronic
1038591758 8:28845278-28845300 CCCAGTCTTCACTGACTTGTGGG - Intronic
1039102515 8:33956373-33956395 CCCAATCTTTTCTGGCTTGCAGG + Intergenic
1039800762 8:40952531-40952553 CCAAAACTTTCCTCTCTTGGGGG - Intergenic
1041016181 8:53594807-53594829 GCCAAGCTTCCCAGCCTTGGGGG + Intergenic
1042728865 8:71909155-71909177 CCCAATCTCTTCTGGCTTGGAGG + Intronic
1042976528 8:74476610-74476632 CCCAATCTTTTCTGGCTTGTAGG + Intronic
1044117025 8:88348560-88348582 CCCAATCTCTTCTGTCTTGTAGG + Intergenic
1049060300 8:140271503-140271525 CCCCATCTCTCCTGACTTGGAGG - Intronic
1050412992 9:5385678-5385700 CACCATCCTCTCTGTCTTGGGGG - Intronic
1051110433 9:13628960-13628982 CCCAATCTCTTCTGGCTTGGAGG - Intergenic
1057026988 9:91741443-91741465 CACCATCTTGCCAGTCTTGGTGG - Intronic
1060340324 9:122769413-122769435 CCCAATCTTTTCTGACTTGTAGG - Intergenic
1061628635 9:131857249-131857271 TCCAAACTTCCCTTTTTTGGGGG + Intergenic
1186404128 X:9286798-9286820 TTCAAGTTTCCCTGTCTTGGTGG + Intergenic
1186913199 X:14192092-14192114 CCCAATCTTTCCTGGCTTGTAGG + Intergenic
1187210816 X:17229724-17229746 CCCAGTGGTCACTGTCTTGGAGG + Intergenic
1187425467 X:19174078-19174100 CCCACTCTGTCTTGTCTTGGAGG - Intergenic
1187605383 X:20876397-20876419 CCCAATCTTTTCTGCCTTGTAGG - Intergenic
1187860247 X:23675622-23675644 GCCAATTTTCCCTGTCTGGTTGG + Intronic
1188000261 X:24973841-24973863 CACAAGCTTCCCTTTCTTGGGGG + Intronic
1188671690 X:32889063-32889085 CCCAACCTTCTCTGTTGTGGTGG - Intronic
1188706556 X:33340238-33340260 TCCAAGTTTGCCTGTCTTGGGGG + Intergenic
1188751829 X:33913764-33913786 CCCAATTTTCCTTGTATGGGGGG - Intergenic
1188860804 X:35252964-35252986 CCCAATCTCTCCTGGCTTGTAGG - Intergenic
1188869535 X:35357546-35357568 CCCAATCTTTTCTGGCTTGTAGG + Intergenic
1192539138 X:71953530-71953552 CCCAATCTTCAGTCACTTGGGGG - Intergenic
1192977110 X:76298454-76298476 CCCACTCTTTCCTGGCTTGTAGG + Intergenic
1193028891 X:76876539-76876561 CCCAATCTTCTCTGGCATGTAGG - Intergenic
1194060830 X:89195700-89195722 CCCAGTCTTTCCTGGCTTGTAGG - Intergenic
1194506238 X:94737509-94737531 CCCAATCTTTTCTGGCTTGTAGG + Intergenic
1194550738 X:95295588-95295610 CCCAATTTTCTCTGGCTTGTAGG - Intergenic
1196845923 X:119896604-119896626 CCCCATCTTCCCTCTCCTGTTGG + Intronic
1198974911 X:142325886-142325908 CCCAATCTCTTCTGTCTTGTAGG + Intergenic
1200247498 X:154533949-154533971 GCTACTCTTCCCTATCTTGGGGG - Intronic
1201178142 Y:11322246-11322268 CCCAACCTGCCCTGGCTTGTAGG + Intergenic
1201941679 Y:19466929-19466951 TCCTAACTTCCCTGTCTTAGAGG - Intergenic