ID: 955132593

View in Genome Browser
Species Human (GRCh38)
Location 3:56185950-56185972
Sequence TAGGGGCCACATCATGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955132593 Original CRISPR TAGGGGCCACATCATGTGCA AGG Intronic
901221607 1:7586788-7586810 GAGGGGCCCCATGCTGTGCAGGG + Intronic
902274582 1:15330353-15330375 CAGAGGCCACATGTTGTGCAGGG + Intronic
903047413 1:20575219-20575241 TGGGAGCCACAGCTTGTGCAGGG + Intergenic
904382689 1:30122050-30122072 TGGGAGCCCCATCATGAGCATGG + Intergenic
908452187 1:64266749-64266771 TAAGGGCCAGTTGATGTGCAAGG - Intronic
910436161 1:87208300-87208322 TAGAGGACACAGCGTGTGCAGGG - Intergenic
912449102 1:109758679-109758701 TAGGGGCCACATCTTTGACAAGG + Intronic
913234854 1:116770972-116770994 TAGAGGCAACAGCATGAGCAAGG + Intergenic
916715653 1:167444691-167444713 CAGGGGCCACAGCATGTGAGAGG + Intronic
922883351 1:228999236-228999258 TAAGGGCCATATCTTGTTCAAGG + Intergenic
922988453 1:229885022-229885044 GATGGTTCACATCATGTGCAGGG + Intergenic
923655261 1:235910424-235910446 CAGGGGCCACAGAATGTGGATGG - Intergenic
1063200079 10:3779542-3779564 GAGGTGCCTCTTCATGTGCAGGG + Exonic
1064415519 10:15146045-15146067 AAAGGGCCACATGATATGCAGGG - Intronic
1065385846 10:25132319-25132341 TAGAGGCCATATCCTCTGCATGG + Intergenic
1066300724 10:34093268-34093290 TAGGGGAGACAACATGTGAAAGG + Intergenic
1072748065 10:97955786-97955808 AGGGGTCCACATCATATGCATGG + Intronic
1075277999 10:121112767-121112789 TTGGGGCCCCAGCATGTGCCTGG - Intergenic
1090462845 11:126907263-126907285 TAGGTTCCACATCGTGTTCAGGG - Intronic
1090513487 11:127399826-127399848 TAGGTGCCAGATCAAGTGCAAGG - Intergenic
1092448212 12:8577702-8577724 TAGGGTCCTCACCATGTGCCAGG + Intergenic
1093757166 12:22865722-22865744 CAGGGGCCACAGCGTGAGCAGGG - Intergenic
1093930055 12:24947103-24947125 GAGGGGCCACATCCTGTGTCTGG + Intronic
1099735117 12:86557455-86557477 GAGGGCCCAGATAATGTGCATGG - Intronic
1101281745 12:103264499-103264521 TAGGGGACCTATCATGTGCCTGG - Intronic
1104832637 12:131764330-131764352 ATGGAGCCACATCATATGCAGGG - Intronic
1105817339 13:24049097-24049119 TAGGCTCCTCATCATGTCCAGGG - Intronic
1106301111 13:28466631-28466653 TATGGGCCACATACTGTGCTAGG + Intronic
1115822663 14:37228226-37228248 TGGGGGCCACCTCAGGTGAAAGG - Intronic
1116976229 14:51119230-51119252 TAGGGTCCACATGACATGCAGGG - Intergenic
1120390458 14:83900949-83900971 TAGGGGAAACATCATTTTCAAGG + Intergenic
1121625328 14:95381350-95381372 TATGGGCCAGGTCTTGTGCAAGG + Intergenic
1121831368 14:97055118-97055140 TAGGGGCCAGCTCCTGAGCATGG - Intergenic
1121841697 14:97139768-97139790 CAGGGGCTAAATCATGTGCTCGG - Intergenic
1122349839 14:101082723-101082745 TACAGGGCACATCCTGTGCATGG + Intergenic
1122940880 14:104980874-104980896 GAGGGGCCACTTCATTTGGATGG - Intergenic
1125175765 15:36819865-36819887 TAGGGGGCTCATCTTGTGCATGG - Intergenic
1129233700 15:74211068-74211090 GAGAGGCCACATGATGTGCCAGG + Intronic
1130702976 15:86204401-86204423 TAGGGGGCTCTGCATGTGCAGGG - Intronic
1132672635 16:1108031-1108053 CAGGGGCCACCCCATGTCCAAGG - Intergenic
1132777598 16:1604412-1604434 CAGGTGGCACAGCATGTGCAGGG + Intronic
1133127188 16:3654598-3654620 TGGGGGCCACCACACGTGCAAGG + Intronic
1139735253 16:68982246-68982268 TAGGGGCCTCATTATATGAATGG + Intronic
1142902311 17:3019775-3019797 GAGGTGCCATAACATGTGCATGG + Intronic
1144115181 17:12081955-12081977 TAGTGGCAACAGCATGTGCGTGG - Intronic
1146890447 17:36503126-36503148 TCGGGGCCAGAGGATGTGCAAGG + Exonic
1146927000 17:36752095-36752117 TGGGGGACACAGCAAGTGCAGGG + Intergenic
1152143054 17:78549841-78549863 CAGGGGCCGCAGCAGGTGCAGGG - Intronic
1158224118 18:55182761-55182783 TATTGGCCACCTAATGTGCAAGG + Intergenic
1160403700 18:78629720-78629742 TGCGGGCCACCTCAGGTGCAGGG - Intergenic
1161395929 19:4045001-4045023 TGGGGGCCACAGCCTCTGCATGG - Exonic
1161429440 19:4222909-4222931 TGGGGTCCACATCACATGCACGG + Intronic
1161788481 19:6343580-6343602 TGGGGGCCACATGATGGGTATGG - Intergenic
1166340614 19:42134667-42134689 TGGGGGCCACTTGAGGTGCAGGG + Intronic
925253358 2:2461384-2461406 TGGGGGCGACATGATGAGCAGGG - Intergenic
928546357 2:32332599-32332621 TAGAGGCCAGATGCTGTGCAAGG + Intergenic
928948963 2:36797858-36797880 TAGGCGCCACATATTATGCACGG + Intronic
929644923 2:43616755-43616777 TAGGGACCACCTCTTGTGAAGGG - Intergenic
931646659 2:64428307-64428329 GAAGGGCCATATCATGTTCATGG - Intergenic
934992132 2:98929319-98929341 CAGGGGCCACACCAGGTCCAAGG - Intronic
937765224 2:125653097-125653119 TTGGTGCAGCATCATGTGCAGGG - Intergenic
1170694733 20:18647954-18647976 TGGGGCCCACATCAGGAGCAGGG + Intronic
1171354308 20:24532461-24532483 AAGGAACCACATCATGGGCATGG + Intronic
1179537168 21:42060214-42060236 GAGGGGACACACCCTGTGCACGG + Intergenic
1180150378 21:45944169-45944191 TGGGGAGCACATCAGGTGCAGGG + Intergenic
1181378359 22:22478829-22478851 CTGGGGCCATATCATGTGAAAGG - Intergenic
949327958 3:2888386-2888408 AAGGGGCAGCATCAGGTGCATGG - Intronic
950839665 3:15955249-15955271 AAGAGGCCACATCTTGTGAAGGG + Intergenic
955132593 3:56185950-56185972 TAGGGGCCACATCATGTGCAAGG + Intronic
964141051 3:153400079-153400101 TGGGGACCACAGTATGTGCATGG + Intergenic
964661867 3:159128863-159128885 AAGGGGCTACATCATTTGGATGG - Intronic
967546799 3:190739478-190739500 TAGGGGACACATGAAGTGCAGGG + Intergenic
967661781 3:192120185-192120207 TAAGGAACACATGATGTGCAAGG + Intergenic
968755048 4:2411224-2411246 TAGGGGACACATCAAGTGGGGGG - Intronic
969223072 4:5773943-5773965 CAGGGGCCAGACCATGTCCAGGG + Intronic
970518745 4:16861795-16861817 CAGGGGGAACAGCATGTGCAAGG - Intronic
973981776 4:56314037-56314059 TAGGATCCACAACATGAGCAAGG + Exonic
975642295 4:76512531-76512553 TAGGGGTCACACCCTCTGCAGGG + Intronic
975712182 4:77171772-77171794 TATGGGCCAGATAATGTGCTGGG - Intronic
976980710 4:91223572-91223594 TAGGGCCCAGATAATTTGCAAGG + Intronic
977123861 4:93139404-93139426 TAGGGCCCACATAATCTGCCAGG + Intronic
983684419 4:170390915-170390937 TGGGAGCCACATCATGTGTTGGG + Intergenic
986856803 5:11878832-11878854 TTGGGGCACCATCATTTGCAAGG + Intronic
991152791 5:63390802-63390824 GAGAGGCCACAACACGTGCAGGG + Intergenic
991152842 5:63391810-63391832 TAGGTGCCATGTCCTGTGCATGG + Intergenic
992186329 5:74248306-74248328 TAAAGGCCAGATCATTTGCAAGG + Intergenic
1002087836 5:176786782-176786804 TTGGGATAACATCATGTGCATGG - Intergenic
1002569108 5:180129976-180129998 TTTGGGCCACATCATGGGCTGGG - Intronic
1006000652 6:30962594-30962616 TGTGGGCCACATGATGTGCCAGG - Intergenic
1006338983 6:33435627-33435649 AAGGGGACACAACCTGTGCAGGG + Intronic
1006555157 6:34859538-34859560 CAGGGACAACATCTTGTGCATGG - Exonic
1007582923 6:42969873-42969895 TTGGGGCCTCACCATGTACAAGG + Exonic
1008340080 6:50353625-50353647 TAGAGGCCATATCATTAGCAGGG - Intergenic
1008779114 6:55080781-55080803 GAGGGGCCACAGCATGTTCTGGG + Intergenic
1016280080 6:142406882-142406904 TAGGTGCCACAAAATGTGAATGG + Intronic
1019465413 7:1185538-1185560 TCGGGGCCACAGCATGACCATGG - Intergenic
1020215725 7:6188668-6188690 TAGGGGTCACATCAAGGGAAAGG - Intronic
1023127062 7:36965083-36965105 GAGTGGCCACATCAAGTGCTTGG - Intronic
1023541735 7:41273398-41273420 TATGGGCCAAATCCTGTGCAGGG + Intergenic
1028414759 7:90567774-90567796 TATTGGCCAGATCATCTGCAGGG + Intronic
1030078952 7:105760912-105760934 TCTGGGCCACATCCTGTGCCAGG - Intronic
1031606006 7:123768860-123768882 CAGGGGCAACATCATTTGCCTGG - Intergenic
1034410844 7:150941356-150941378 TAGTGGCCACATCAGGTCCTGGG + Intergenic
1041030284 8:53729552-53729574 TGGGGGCCACATGATGTGCTGGG + Intronic
1045118474 8:99010231-99010253 TAGGTACCACATAATATGCAAGG + Intergenic
1045153696 8:99440302-99440324 TGGGGGTCAGATCATGTTCATGG - Intronic
1045364105 8:101459777-101459799 TAGGGGCCACATGGTGGGCCTGG - Intergenic
1048959931 8:139568129-139568151 CAGGGGCCTCATCTTGTTCATGG - Intergenic
1049271128 8:141696863-141696885 TAGGAGGCACAGCCTGTGCAGGG + Intergenic
1059093595 9:111388494-111388516 AAGGGGCCACATTACGGGCAGGG + Intronic
1061401899 9:130373126-130373148 TAAGGGCCACATGATGTGATGGG + Intronic
1062205730 9:135335849-135335871 CAGGGGCCAGAGCAGGTGCAGGG + Intergenic
1203791121 EBV:152116-152138 CAGAGGCCCCAACATGTGCAGGG - Intergenic
1186194535 X:7097948-7097970 TAGAGCCCATGTCATGTGCATGG + Intronic
1186232751 X:7473443-7473465 TATGAGCCACATCTTGTGCTAGG - Intergenic
1186809455 X:13174060-13174082 TATGGGCCACTTAATGTTCAGGG - Intergenic
1187297237 X:18013655-18013677 GAGGTGCAACATCATGTGCCTGG - Intergenic
1192040578 X:67616759-67616781 TAGGGGCCAAGCCATGTGCTAGG + Intronic
1197330199 X:125144705-125144727 CAGGTGCCACATCCTGTGCTGGG - Intergenic