ID: 955141004

View in Genome Browser
Species Human (GRCh38)
Location 3:56269961-56269983
Sequence CCACATTGGAAGCCGTTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 54}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955140996_955141004 16 Left 955140996 3:56269922-56269944 CCCACCCCATCAGTTAATGAAGC 0: 1
1: 0
2: 0
3: 8
4: 100
Right 955141004 3:56269961-56269983 CCACATTGGAAGCCGTTCCAAGG 0: 1
1: 0
2: 0
3: 6
4: 54
955140999_955141004 11 Left 955140999 3:56269927-56269949 CCCATCAGTTAATGAAGCACTGC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 955141004 3:56269961-56269983 CCACATTGGAAGCCGTTCCAAGG 0: 1
1: 0
2: 0
3: 6
4: 54
955140998_955141004 12 Left 955140998 3:56269926-56269948 CCCCATCAGTTAATGAAGCACTG 0: 1
1: 0
2: 0
3: 13
4: 116
Right 955141004 3:56269961-56269983 CCACATTGGAAGCCGTTCCAAGG 0: 1
1: 0
2: 0
3: 6
4: 54
955141000_955141004 10 Left 955141000 3:56269928-56269950 CCATCAGTTAATGAAGCACTGCA 0: 1
1: 0
2: 0
3: 13
4: 109
Right 955141004 3:56269961-56269983 CCACATTGGAAGCCGTTCCAAGG 0: 1
1: 0
2: 0
3: 6
4: 54
955140997_955141004 15 Left 955140997 3:56269923-56269945 CCACCCCATCAGTTAATGAAGCA 0: 1
1: 0
2: 1
3: 4
4: 103
Right 955141004 3:56269961-56269983 CCACATTGGAAGCCGTTCCAAGG 0: 1
1: 0
2: 0
3: 6
4: 54
955140995_955141004 23 Left 955140995 3:56269915-56269937 CCTTTTTCCCACCCCATCAGTTA 0: 1
1: 0
2: 4
3: 30
4: 254
Right 955141004 3:56269961-56269983 CCACATTGGAAGCCGTTCCAAGG 0: 1
1: 0
2: 0
3: 6
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955141004 Original CRISPR CCACATTGGAAGCCGTTCCA AGG Intronic
900013111 1:132773-132795 CCACCTTGGAAGGCGTCCCTGGG - Intergenic
900043177 1:488760-488782 CCACCTTGGAAGGCGTCCCTGGG - Intergenic
900064614 1:723757-723779 CCACCTTGGAAGGCGTCCCTGGG - Intergenic
900506327 1:3031447-3031469 CCAGATAGGAAGACGTCCCAGGG - Intergenic
907191828 1:52655866-52655888 CCCCACTGGAGGCCGTTCCAGGG + Intronic
911383086 1:97140331-97140353 CTACATTGAAAGCCCTGCCAAGG + Intronic
917964844 1:180172001-180172023 CCTCAGTTGAAGCCGTTCTAGGG - Intronic
918707998 1:187692418-187692440 CCACATTTGAAGTCTTTCCTAGG - Intergenic
922029045 1:221780505-221780527 CCACCTTGGAAGCAGATCCCAGG + Intergenic
922572613 1:226642924-226642946 CCACACTGGGACCCCTTCCAAGG - Intronic
1067042373 10:42961904-42961926 CCACAGTGGAGGCCGAGCCAAGG - Intergenic
1070992632 10:80745918-80745940 CCAAATTGTAAGCCATTACACGG + Intergenic
1076092433 10:127699500-127699522 CCACTCTGGAAGGAGTTCCAGGG - Intergenic
1076969448 11:124977-124999 CCACCTTGGAAGGCGTCCCTGGG - Intergenic
1084146888 11:67269767-67269789 CCACCTTGGCAGCCCCTCCATGG + Intronic
1088674493 11:112179365-112179387 CCACAGTGGAAGAGGCTCCACGG + Exonic
1100883954 12:99048821-99048843 CCAGATTTCAAGCTGTTCCAGGG - Intronic
1104448014 12:128848469-128848491 CCACATTGGACGTAGTTTCAAGG + Intergenic
1111461209 13:88544829-88544851 CCACATAGGAAGCCACTTCAGGG + Intergenic
1118174714 14:63426844-63426866 CCCCAATGGAAGCCCATCCATGG - Intronic
1118454439 14:65931804-65931826 CCATATTGGAAGGAGTTTCATGG + Intergenic
1118781687 14:69012881-69012903 CCACAGTGCCAGCCGTGCCAGGG + Intergenic
1129708003 15:77805626-77805648 CCAGTTTGGAAGCCCTGCCATGG - Intronic
1137711848 16:50572104-50572126 CCACAGTGAAAGCTGCTCCAAGG - Intronic
1140891727 16:79290705-79290727 CATCATTGGAAGCTGTTGCACGG - Intergenic
1149884462 17:60327380-60327402 CCACATTGACAGCTGTGCCATGG - Intronic
1154337824 18:13479983-13480005 CCACATTGGAAACAGTTTGACGG + Intronic
1160646253 19:194903-194925 CCACCTTGGAAGGCGTCCCTGGG - Intergenic
1161112107 19:2476322-2476344 CCACAGTGGATGCGGCTCCACGG - Exonic
1162300881 19:9844282-9844304 CCACGTTGGAGCCTGTTCCAAGG - Intronic
1163594218 19:18211511-18211533 CCAGACTGGAAGCCCCTCCAGGG + Intronic
1167556000 19:50196115-50196137 CCACACTAGCAGCCCTTCCAGGG - Intronic
927335663 2:21921020-21921042 CCACAGAGGAAATCGTTCCAAGG + Intergenic
944974599 2:205034285-205034307 CCACATTGTAAGCTGTTTGATGG - Intronic
1171037662 20:21729008-21729030 ACACATTGGGAGCTGTTCCTGGG + Intergenic
1175173216 20:57093997-57094019 CCACATTGGAAGGAGATCCAAGG - Intergenic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1177510817 21:22085097-22085119 CCACAGTGAAAGCCTTTCAAGGG - Intergenic
1182115917 22:27756329-27756351 CCACATTGGAACCTGGTCCGCGG - Intronic
1184256446 22:43289780-43289802 CCACGCTGGAAGCCTTCCCATGG - Intronic
950993479 3:17467401-17467423 ACACCTAGGAAGCAGTTCCAAGG + Intronic
952352182 3:32550825-32550847 CCACATTGAAAACCATTCCATGG + Intronic
954915853 3:54148252-54148274 CCACATTGTGAGCCCTTCAAGGG - Intronic
955141004 3:56269961-56269983 CCACATTGGAAGCCGTTCCAAGG + Intronic
955145485 3:56314179-56314201 CCACATTGGAGGCCCATTCAAGG - Intronic
968371428 3:198224623-198224645 CCACCTTGGAAGGCGTCCCTGGG + Intergenic
987444624 5:18002386-18002408 CCATATTGGAAGCCATTCAAGGG + Intergenic
991494094 5:67210882-67210904 CCAGATTGGATTCTGTTCCAGGG + Intergenic
992984615 5:82215228-82215250 CCATATTGTAAGACGTTCTATGG - Intronic
1002730666 5:181330169-181330191 CCACCTTGGAAGGCGTCCCTGGG + Intergenic
1002753864 6:143935-143957 CCACCTTGGAAGGCGTCCCTGGG - Intergenic
1018644493 6:165934745-165934767 CCACATTGGGAGCCCATCCATGG - Intronic
1031491628 7:122396744-122396766 CCACAGTGGAAACCTGTCCAGGG - Intronic
1036631741 8:10520767-10520789 CTACATTGGAAGAGATTCCAAGG + Intergenic
1040079215 8:43270743-43270765 CCACATTGGAAGAGGATGCAAGG + Intergenic
1041318540 8:56589874-56589896 CCCCATTGGAAGCTGTTCAAAGG - Intergenic
1060214472 9:121730424-121730446 CCATATTGGTAGCCATTCCTTGG + Intronic
1062755075 9:138282679-138282701 CCACCTTGGAAGGCGTCCCTGGG + Intergenic
1187885136 X:23882590-23882612 CCAGAATGGAAGCCCTTTCAGGG - Intronic
1189597326 X:42583285-42583307 CCACAATGAAAGGCTTTCCAAGG - Intergenic
1191902144 X:66052608-66052630 CCATTTTGGAAGCTATTCCAAGG + Intergenic