ID: 955146555

View in Genome Browser
Species Human (GRCh38)
Location 3:56325788-56325810
Sequence TCTCATCTGTAGAAAGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 750
Summary {0: 1, 1: 1, 2: 21, 3: 140, 4: 587}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955146555_955146560 14 Left 955146555 3:56325788-56325810 CCATCCCCTTTCTACAGATGAGA 0: 1
1: 1
2: 21
3: 140
4: 587
Right 955146560 3:56325825-56325847 AGAGAAAAGTCACTTGCTCAAGG 0: 1
1: 1
2: 20
3: 149
4: 818

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955146555 Original CRISPR TCTCATCTGTAGAAAGGGGA TGG (reversed) Intronic
901679429 1:10904579-10904601 TCTCATCTGTAAAATGGGCATGG + Intergenic
901761705 1:11476233-11476255 TCTCATCTATAAAGTGGGGATGG - Intergenic
901776319 1:11562884-11562906 TCTCATCTGTAAAATGGGAGTGG + Intergenic
901809571 1:11759834-11759856 CCTCATATGTAAAAGGGGGATGG - Intergenic
902765163 1:18609496-18609518 TCTCATCTTTAAAAAGGAAATGG - Intergenic
903137726 1:21320286-21320308 TCTCATTTATAAAATGGGGATGG + Intronic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903260783 1:22130666-22130688 CCTCATCTGTAGTAAGAGAAGGG + Intronic
903497990 1:23784014-23784036 CCTCATCTGTAAAATGGGAATGG - Intronic
903542882 1:24106863-24106885 TCTCATCTGTAAAATTGGGCTGG - Intronic
903740355 1:25555089-25555111 CCTCATCTGTAAAATGGGGGTGG + Intronic
903817792 1:26077664-26077686 TCTCATCTGTAAAATGGGGATGG - Intergenic
903857795 1:26346844-26346866 TCTCATCTGTGAAATGGGCATGG + Intronic
903972770 1:27129878-27129900 CCTCAGCTGTAGAATGAGGAGGG - Intronic
904054589 1:27661829-27661851 TCTGATCTGCAGAAGGGGTAGGG - Intergenic
904416221 1:30362598-30362620 TTTCTTCTGTAAAATGGGGATGG - Intergenic
904434741 1:30487046-30487068 TCTCCTGTGTACACAGGGGAAGG - Intergenic
904611084 1:31726742-31726764 TCACATCTGTGAAATGGGGATGG - Intergenic
904926081 1:34049221-34049243 CCTCATCTGTAGACAAGAGAGGG + Intronic
905206620 1:36346333-36346355 TCTCATCTGTAAAATAGGGATGG - Intronic
905346952 1:37317879-37317901 CCTCATCTGTAAAGAGGTGATGG + Intergenic
905444057 1:38013378-38013400 CCTCATCTGTATAATGGGAATGG - Intronic
905520574 1:38596392-38596414 TCTCATCTATAGTATGGGGTCGG + Intergenic
906066458 1:42984630-42984652 TCTCACCTGCAGAATGGGGAGGG - Intergenic
906118740 1:43373273-43373295 TCTCTTCTTGAGAAAGAGGATGG - Intergenic
906226389 1:44125866-44125888 TCTCTTCAGTGGGAAGGGGAGGG + Intronic
906369949 1:45245045-45245067 GCTCATCTTTAGAAGGGAGAGGG - Intronic
906635423 1:47406524-47406546 TCTCATCTGTAAATTGGGGATGG + Intergenic
907046435 1:51302860-51302882 TCTCATCTGTGAAATGGGGGTGG - Intronic
907738554 1:57140327-57140349 CCTCATCTGTAGAATGAGGGAGG - Intronic
908029826 1:59987416-59987438 TCTCACCTGTACAATGGGCATGG + Intronic
908321591 1:62983869-62983891 TCTCATCTGTAGAATGGGGATGG + Intergenic
908648921 1:66310835-66310857 TCTTATCTGTAAAATGGGGAAGG + Intronic
908983030 1:69981902-69981924 CCTCATCTATAAAATGGGGATGG - Intronic
910743504 1:90547880-90547902 CCTCATCTGTAAAATGGGGCTGG + Intergenic
910928398 1:92419150-92419172 TCTCATCTGTAAACTGGGGATGG + Intergenic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
911834343 1:102596984-102597006 TTTCATCTCAAGAAAAGGGAAGG + Intergenic
912466584 1:109878876-109878898 TCTCTTCTGTAAAATGGGAAGGG - Intergenic
913355565 1:117917560-117917582 CCTCATCTCTAAAATGGGGATGG - Intronic
913451537 1:118996103-118996125 TCTCATGTGTAAAATGGGGCCGG - Intergenic
915128182 1:153679966-153679988 ACTCAGCTGTAGAAAGGGCCAGG - Intronic
916078166 1:161215188-161215210 TCTCTTGTGCAGGAAGGGGAAGG + Intergenic
916314116 1:163428436-163428458 TCTCAACTGGAGAAGGAGGAGGG + Intergenic
916459514 1:165008878-165008900 TGTCATTTGTGGAAAGTGGAAGG - Intergenic
916673844 1:167049672-167049694 CCTCATCTGTAAAATGGAGAGGG + Intergenic
916695960 1:167236708-167236730 GTTCATTTATAGAAAGGGGATGG + Intronic
916874910 1:168958797-168958819 TCTCATGTTGAGATAGGGGAAGG - Intergenic
917495916 1:175540072-175540094 TCTCAGATGTAGAGTGGGGAGGG + Intronic
918458935 1:184755544-184755566 TCTCGTCTGCAAAAGGGGGATGG - Intergenic
919338965 1:196278957-196278979 TCTCATCTGGTGGAAAGGGAAGG - Intronic
919378697 1:196826955-196826977 TTTCATGTGTAGAACGGGGCTGG + Exonic
919388394 1:196950978-196951000 TTTCATGTGTAGAACGGGGCTGG + Exonic
920092893 1:203466683-203466705 CCTCATCTGTAAAGTGGGGATGG + Intergenic
920501702 1:206489746-206489768 TCTCATCTATAAAATGGGGAGGG - Intronic
920712370 1:208307330-208307352 TCTCATCTGTAAAAGGGGCTTGG - Intergenic
921036428 1:211383229-211383251 TCACAACTGTAGGAAGCGGAAGG - Intergenic
921307407 1:213810817-213810839 TCTTATCTGTAAAATGAGGATGG - Intergenic
921374331 1:214458575-214458597 TCTTATCTGTAAAATGGAGATGG - Intronic
921476033 1:215610772-215610794 TTTCATCTGTAAAATGGAGATGG + Intronic
921715174 1:218410417-218410439 ACTGTTCTGTAGAGAGGGGAGGG - Intronic
922230794 1:223683907-223683929 TCTCACCTGTAGAATGTGGCTGG - Intergenic
922350772 1:224733211-224733233 TCTCATCGGTGAAATGGGGATGG - Intronic
923220882 1:231891882-231891904 TCTGCATTGTAGAAAGGGGAAGG - Intronic
923719696 1:236456320-236456342 ACTCACCTCTAGTAAGGGGATGG + Intronic
1062843959 10:690334-690356 CCCCATCTGTGAAAAGGGGATGG + Intergenic
1064281189 10:13953027-13953049 TCTCTTCTGTAGGATGAGGATGG + Intronic
1066670524 10:37833106-37833128 TCTCATTTCTAGAAAGGAAATGG - Exonic
1067688231 10:48480750-48480772 TCTCATCTGTAAAATGTGGTTGG - Intronic
1069132925 10:64728617-64728639 TCTGATCTGTAAAATGGGGATGG + Intergenic
1069603453 10:69724633-69724655 TGGGATCTGTAGGAAGGGGAAGG - Intergenic
1069754348 10:70764109-70764131 TCTCCTCTGGAGGAATGGGAAGG - Intergenic
1070208552 10:74289858-74289880 TCTCCTTTGTAGAAAAAGGAGGG + Intronic
1070544383 10:77441148-77441170 TCTCATGTTTGGAAAGGTGAAGG + Intronic
1070545991 10:77452966-77452988 TCTCATCTGGAAAACAGGGATGG + Intronic
1070726567 10:78795516-78795538 TATCATCTGTAAGATGGGGATGG + Intergenic
1071549260 10:86553713-86553735 TCTCATCTGAAGACTGGGGATGG + Intergenic
1071782478 10:88861736-88861758 TCTCATCTGTTAAAAGGGGATGG - Intergenic
1071882533 10:89915064-89915086 TCTCATCAGTACAAAGGGGTAGG - Intergenic
1072043107 10:91628112-91628134 TCTCAGCTTTAAAATGGGGAAGG - Intergenic
1072170070 10:92849820-92849842 CCTTATTTGTAGAATGGGGAGGG + Intronic
1072202525 10:93173778-93173800 TCTCATCTATAAAATGGAGATGG + Intergenic
1072618965 10:97067478-97067500 TCTCCTTTGTATAATGGGGATGG - Intronic
1072620059 10:97073798-97073820 TCTCATCTGCAACATGGGGATGG + Intronic
1072626033 10:97112575-97112597 CCTCATCTGTGAAATGGGGATGG - Intronic
1072733378 10:97863224-97863246 CCTCACCTGTAAAATGGGGATGG + Intronic
1073044893 10:100631146-100631168 CCTCATCTGTAAAACAGGGATGG + Intergenic
1073919596 10:108443614-108443636 TCTCACCTGTAGAATGGCCATGG + Intergenic
1074102666 10:110365728-110365750 CCTCATCTGTAAAATGGGAATGG + Intergenic
1074226002 10:111484814-111484836 TCTCATCTGTAAAATGGGGGTGG + Intergenic
1074424539 10:113339239-113339261 CCCCATCTGGAGAAAGGTGAAGG - Intergenic
1074446402 10:113524688-113524710 ACCCATCTGTACAATGGGGATGG - Intergenic
1074500347 10:114017976-114017998 TCTATTCTGTAGGAAGTGGAGGG - Intergenic
1074596945 10:114876453-114876475 CCTTATCTGTAAAATGGGGATGG + Intronic
1074913886 10:117937647-117937669 TCTCATCTGTAAAATGTTGATGG - Intergenic
1074921323 10:118016820-118016842 CCTCATCTGTAAAATGGAGATGG + Intronic
1075672505 10:124272159-124272181 TTTCATCTGGATAAAGGGGAGGG + Intergenic
1075739087 10:124682511-124682533 TCTCATCTGTAAAATGAGGTTGG - Intronic
1077540077 11:3142518-3142540 CCTCATCTGTAAAAAGGGAGGGG - Intronic
1078349489 11:10580933-10580955 TCTCATCTGTAAAAGAGAGAGGG + Intronic
1078577846 11:12516811-12516833 TCTTATCTGTAAAACAGGGATGG - Intronic
1078779126 11:14420577-14420599 CCTCATCTGTAGAACAAGGATGG + Intergenic
1078850196 11:15156681-15156703 CTCCATCTGTAGAATGGGGATGG + Intronic
1079004016 11:16779961-16779983 TTTCATCTCTAAAACGGGGAGGG + Intronic
1079032357 11:16995123-16995145 CCTCATCTGAAAAATGGGGATGG - Intronic
1079148673 11:17877483-17877505 GCTCATCTTTAAAATGGGGAGGG - Intronic
1080302654 11:30801292-30801314 TCTCATCTGTAAAATGGAAATGG - Intergenic
1080612849 11:33919818-33919840 TCCCAGCAGTAGAAAGAGGAAGG - Intergenic
1080682643 11:34490650-34490672 TCTCCTCTGTAGAATGGGGTGGG + Intronic
1080801169 11:35611643-35611665 ACTCATCTGTAGAATGGAGATGG - Intergenic
1080913083 11:36625406-36625428 TCTTATCTGTAGAGTGGTGAGGG - Intronic
1081658600 11:44874169-44874191 CCTCATCTGTAAAAAGGAGATGG + Intronic
1081679657 11:44992709-44992731 TCTCATCTGTAAAATAGGGTTGG + Intergenic
1082013207 11:47464889-47464911 GCTCATCTGTAAAACGAGGATGG + Intergenic
1082205080 11:49423449-49423471 GCTCATTTATAGAAAGGGGATGG + Intergenic
1082790770 11:57345487-57345509 TCTCATCTGTCGAATGGGAATGG + Intronic
1083138304 11:60700644-60700666 TCTCATCTGTAAAACTGGGCGGG + Intronic
1083237937 11:61363847-61363869 TCTCATCTGTAAAATGGGGAAGG + Intronic
1083622857 11:64057536-64057558 TCTCATCTGTAAAATGGGCGTGG - Intronic
1083889262 11:65587843-65587865 CCTCATCTGTAAAGTGGGGAGGG + Intronic
1084069259 11:66723530-66723552 TCTCTTTAGGAGAAAGGGGAGGG - Intronic
1084102206 11:66957264-66957286 TCTCAGCTGGAGAACGGGTAAGG + Intronic
1084146584 11:67268131-67268153 TCTCATCTGTGAAATGTGGATGG + Intronic
1085445221 11:76596948-76596970 ACTCATCAGTAAAAAGGAGATGG - Intergenic
1085485503 11:76860345-76860367 TCTCTTCGGTACAAAGGGAAAGG - Intergenic
1085640160 11:78188441-78188463 TCCCATCTGTGAAATGGGGATGG - Intronic
1085740056 11:79070720-79070742 TCTCATCTGTCAGATGGGGATGG - Intronic
1086001277 11:81988444-81988466 TCATATCTCTGGAAAGGGGAAGG - Intergenic
1086455536 11:86955696-86955718 TCTCACCTGCAGAAGGGGGCAGG - Intergenic
1086650015 11:89277096-89277118 GCTCATTTATAGAAAAGGGATGG - Intronic
1086840726 11:91681014-91681036 TCTCATCTACAGAATGGGGGTGG - Intergenic
1087789901 11:102394780-102394802 TGTCATCTGTAAAATGGGGATGG - Intergenic
1088368189 11:109060740-109060762 TCTCACCTGTAAAATGGGGTTGG + Intergenic
1088607053 11:111541881-111541903 TCTCATTTGCAGGAAGGCGAAGG - Intronic
1088890319 11:114038882-114038904 TCTCATCTGTAAAATGGAGCTGG - Intergenic
1089075204 11:115733141-115733163 TCTCATCTTTAGGAAGGGAGTGG + Intergenic
1089117801 11:116110619-116110641 TTCCACCTGTAGAAAGGGGATGG - Intergenic
1089480666 11:118802360-118802382 TCTCATCTGTTTAATGGGGATGG + Intergenic
1089617314 11:119702160-119702182 TCTCATCTCTAGACACTGGAGGG + Intronic
1089712967 11:120330184-120330206 GCGCATCTGTAGCAAGGGGTTGG - Exonic
1090358320 11:126155565-126155587 TTCCATCTGTAAAATGGGGATGG - Intergenic
1090674067 11:128972832-128972854 TCTCCACTGTAGAAACGGGGTGG + Exonic
1091121605 11:133062600-133062622 TCTCATCTGTAGGGAAAGGAGGG - Intronic
1091645152 12:2267558-2267580 TCTCATCTGTAAAATGGGCATGG - Intronic
1092039776 12:5374026-5374048 CCTCATCTGTAAGATGGGGATGG - Intergenic
1092477036 12:8828340-8828362 ACTCCTCTGTGAAAAGGGGAAGG - Intronic
1094038867 12:26102045-26102067 CCTTATCTATAGAATGGGGATGG - Intergenic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1094075365 12:26466692-26466714 TCTCATCTATAAAAATGTGATGG - Intronic
1094179829 12:27580425-27580447 CCACATCTGTAAAATGGGGATGG + Intronic
1096290262 12:50336282-50336304 CCTCTTCTGTAGAATGAGGATGG - Intronic
1096670375 12:53195013-53195035 CCTCATCTGTAAAATAGGGATGG + Exonic
1096815410 12:54198821-54198843 CCTCATCTATAAAACGGGGATGG - Intergenic
1097454669 12:59783173-59783195 TTTCATATGTAGAATGTGGAAGG + Exonic
1098133938 12:67381702-67381724 CCTCATCTGTAGACTGGAGATGG - Intergenic
1098613048 12:72485580-72485602 CCTCACCTGTAGAATGGGGAGGG - Intronic
1098615921 12:72522092-72522114 CCTCATCTGTAAAATGGAGATGG - Intronic
1098621715 12:72608951-72608973 TTTGATCTGTAGAATGGGGATGG + Intronic
1098815833 12:75160624-75160646 TCCCATCTGTAAAAAGATGAAGG + Intronic
1098890544 12:76006125-76006147 TCTCATCTTCAGAATAGGGATGG - Intergenic
1099832563 12:87863727-87863749 TCTTTTCTTTTGAAAGGGGATGG + Intergenic
1100362344 12:93890216-93890238 TATCATCTGTAGAATGGGGAGGG + Intronic
1100367683 12:93936630-93936652 TCTCATCTGTAAGATGGAGATGG - Intergenic
1100459500 12:94785185-94785207 TCTAATCTGTAAAATGGAGATGG + Intergenic
1100820889 12:98428544-98428566 TCTTATCTCTAAAACGGGGATGG - Intergenic
1100857739 12:98773011-98773033 TTTAATCTGTTGAAAGGGGGTGG + Intronic
1101013277 12:100473212-100473234 CCTCATCTGTAGAATGGATATGG - Intergenic
1101347783 12:103902402-103902424 TCTCATCTGTAAAATGAGAATGG - Intergenic
1101438491 12:104684433-104684455 TATCATCTGTAAAAAGGGGATGG + Intronic
1101827537 12:108232235-108232257 TCTCATCTGTAAAATGGGTTGGG + Intronic
1101841579 12:108331249-108331271 TCCCATCTGTGAAATGGGGATGG - Intronic
1101885477 12:108657557-108657579 CCTCATCTGGGGAAGGGGGATGG - Intronic
1101889639 12:108701663-108701685 TCTTATCTGTAAAAGGGGAAGGG - Intronic
1101915659 12:108893781-108893803 TCTCATCTGTAGACAGAGCTGGG + Intronic
1102016652 12:109652435-109652457 CCTCATCTGTAAAATGGGGCGGG + Intergenic
1102131978 12:110538750-110538772 CCTCATCTGCAAAACGGGGATGG + Intronic
1102187911 12:110964327-110964349 CCACATCTGTAGAATGGAGATGG - Intergenic
1102560225 12:113756789-113756811 TCCCATCTGTAAAATGGGGCTGG - Intergenic
1102818384 12:115887334-115887356 TCTCAACTGTAGAGAGGGCCAGG + Intergenic
1102844134 12:116160542-116160564 TCTGATCTGTAGGAAGAGGCTGG + Intronic
1102946648 12:116995294-116995316 TCTCTTCTGTAAAATGAGGAGGG + Intronic
1103079358 12:118011089-118011111 TCACATCTGTAAAATGGGCAGGG - Intergenic
1103140535 12:118544280-118544302 TCTCATCTGTAATATGGGGCTGG - Intergenic
1103446847 12:121000339-121000361 TCTCATCTGTAAAATGGGGGTGG - Intronic
1103526951 12:121575457-121575479 CCTGATCTGGAGCAAGGGGAAGG + Intronic
1103598479 12:122038804-122038826 TTTAATCTGTAGAATGGGGATGG + Intronic
1103913722 12:124365421-124365443 GCTCATCTGCAGGAAGGAGATGG - Intronic
1103956078 12:124577615-124577637 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1104152118 12:126093905-126093927 TCTCATCTGCTAAATGGGGATGG - Intergenic
1104379586 12:128295434-128295456 TCTCATCTGTAAAATGGGGATGG - Intronic
1104481115 12:129109344-129109366 TCTCCTCTGCAAAATGGGGATGG + Intronic
1104656469 12:130577188-130577210 TCTCATCTGTAAAACAGGGATGG + Intronic
1106025671 13:25953318-25953340 TTTCTTCTGTAAAATGGGGACGG + Intronic
1106327922 13:28711902-28711924 TCTCATCTGTAAAATGGGCGTGG - Intronic
1107303531 13:38993144-38993166 TCTCATCTGTAAAATGGGGATGG + Intergenic
1107583337 13:41816228-41816250 TCTCATCTGTAAAATGGGAACGG - Intronic
1108912734 13:55577144-55577166 TGTGATATGCAGAAAGGGGAAGG - Intergenic
1108962104 13:56247216-56247238 CTTTATCTGTGGAAAGGGGAGGG - Intergenic
1109352098 13:61195840-61195862 TCTAATGTTTAGAAAGGAGAAGG + Intergenic
1110311314 13:74052768-74052790 TCTCAGCTGTAGTAATGGGAGGG - Intronic
1110835017 13:80073516-80073538 TCTCAACTCTAGAAAAGGAAGGG + Intergenic
1111465223 13:88599496-88599518 TCACATATGTAGGAAGGTGAGGG - Intergenic
1112042079 13:95556593-95556615 TCTCATCTGTAAAACAGGGATGG - Intronic
1112262757 13:97892419-97892441 TCTCATCTGTAAAATGGATATGG - Intergenic
1112329605 13:98467060-98467082 TCTCATCTGTAGAATGGAGGTGG + Intronic
1112356709 13:98679529-98679551 TCTCCTCTGTGGAATGGGAATGG + Intergenic
1112556369 13:100472307-100472329 TCTCCCCGGTAGACAGGGGAGGG - Intronic
1112818540 13:103302654-103302676 TTTCATCTGTAAAATGGGGATGG + Intergenic
1113333200 13:109352173-109352195 ACTCATCTGTAAAATGGAGATGG - Intergenic
1113337283 13:109389176-109389198 ATTCATCTGTTGAAAGGGTAGGG + Intergenic
1114267215 14:21079942-21079964 CCTCATCTATAGAATGCGGATGG + Intronic
1114408581 14:22479255-22479277 CCTCCTCTGTAGAATGGGGGAGG + Intergenic
1114411354 14:22503532-22503554 TCTCATCTGTAAAATGGGGATGG + Intergenic
1114539897 14:23447195-23447217 TCTTATCTGTAAAATGTGGATGG + Intergenic
1115160765 14:30390911-30390933 TATCATCTGTAAAAAGGAGCTGG + Intergenic
1115190806 14:30745399-30745421 TCTGAGCAGTGGAAAGGGGATGG - Intergenic
1115215896 14:31013764-31013786 TCTTTTCTGTAGAAACGGGGGGG + Intronic
1115415008 14:33122334-33122356 CCTCTTCTGGAGAAAGGTGATGG - Intronic
1115513502 14:34161492-34161514 ACTCATCTATAAAATGGGGATGG + Intronic
1116419009 14:44711749-44711771 TCTCATCTGTAGCATAAGGAAGG - Intergenic
1116495339 14:45553193-45553215 TTTCACTTGTAGAAAGGAGAGGG - Intergenic
1116815367 14:49578988-49579010 CCTCATTTGTAAAATGGGGACGG + Intronic
1116825604 14:49670527-49670549 TCCTATCTATAGAAGGGGGAAGG - Intronic
1117196007 14:53340777-53340799 CCTCATCTGTAAAACGGGGGTGG + Intergenic
1117572241 14:57058908-57058930 TTTCATCTGTAAAATGGGCATGG - Intergenic
1118599371 14:67460968-67460990 TCTCATCTGTAAAATGGAGATGG - Intronic
1118769377 14:68931649-68931671 CCACATCTGTAAAATGGGGATGG + Intronic
1118837927 14:69489702-69489724 TCTCATCTATAGAGTGGGAATGG + Intronic
1118948864 14:70415957-70415979 TATCATCTCTAAAATGGGGATGG - Intronic
1119158147 14:72430457-72430479 TCTCTTCTGCAGACAGAGGAGGG + Intronic
1119174590 14:72559849-72559871 CCCATTCTGTAGAAAGGGGAAGG + Intronic
1120115985 14:80617973-80617995 TTTCATCTATAAAATGGGGATGG + Intronic
1120319349 14:82939712-82939734 TCTCATCACTAAAATGGGGATGG + Intergenic
1120599402 14:86482666-86482688 TCTCATCTGTAAAATGGAAATGG - Intergenic
1120858249 14:89231672-89231694 TCGCATCTGGAGAAAAAGGAGGG + Intronic
1120885012 14:89445243-89445265 CCCCATCTGTAAAATGGGGATGG + Intronic
1121096920 14:91223853-91223875 GCTTATCTGTAAAATGGGGAGGG - Intronic
1121126823 14:91413329-91413351 CCTGATCTGTAATAAGGGGATGG - Intronic
1121314036 14:92950563-92950585 CCTCATCTGTAAAACGGGAAGGG - Intronic
1121319856 14:92985894-92985916 TCCTATCTGTAAAATGGGGAGGG - Intronic
1121642833 14:95497289-95497311 TCTCATCTGTAATATGGGGATGG + Intergenic
1121851881 14:97228720-97228742 TCACATCTGTAAGAAGGAGATGG - Intergenic
1122138518 14:99648328-99648350 CCTCATCTGTGGAAGGGGAAAGG - Intronic
1122242094 14:100375881-100375903 CCTCATCTGTGGAATGGGCATGG + Intronic
1123682744 15:22774329-22774351 TCACACCTGTAAAATGGGGATGG - Intronic
1123762713 15:23445099-23445121 TCACATCTGTAAAATGGGGATGG - Intronic
1124334494 15:28846852-28846874 TCACATCTGTAAAATGGGGATGG - Intergenic
1124486070 15:30117759-30117781 CCTCATCTGTAAAATTGGGATGG + Intergenic
1124757514 15:32420842-32420864 CCTCATCTGTAAAATTGGGATGG - Intergenic
1124913600 15:33947020-33947042 TCTCATCTGTAGACAGGTTAGGG + Intronic
1125195750 15:37044103-37044125 TCTTATCTGTAGAATGGAGATGG - Intronic
1125439085 15:39682135-39682157 TATCATTTGTATAAAGGAGAAGG - Intronic
1125732385 15:41900509-41900531 CCCCATCTGTAGAATGGGGAGGG - Exonic
1126112277 15:45182346-45182368 TTTTATCTGTAGAAAAAGGATGG + Intronic
1128148664 15:65347371-65347393 TCTCATCTGTAAAATGGGAGTGG + Intronic
1128186227 15:65645418-65645440 TCTCATCTGCAGATAGGTCAGGG + Intronic
1128735696 15:70052672-70052694 TCTCACCTATAAAATGGGGATGG - Intronic
1128862306 15:71084095-71084117 TCTCAACTGTAGAAGGAGGTGGG + Intergenic
1128904695 15:71456522-71456544 TCCCATCTGTGAAATGGGGATGG - Intronic
1129052765 15:72796742-72796764 CCCCATCTGCAGAATGGGGATGG + Intergenic
1130126693 15:81099724-81099746 CCTCATCTATAAAAAAGGGATGG - Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130193896 15:81761268-81761290 TATTATCTGTAGAACGGGGATGG - Intergenic
1130393475 15:83480405-83480427 TCTCATCTGTGAAATTGGGATGG - Intronic
1130867145 15:87942736-87942758 TCTCACCTGTAAAATGGGTATGG + Intronic
1130926177 15:88387592-88387614 CCTTATCTGTAAAATGGGGATGG + Intergenic
1131677273 15:94683318-94683340 CCTCCTCTGTAAAAAGGGGGTGG - Intergenic
1132175662 15:99711931-99711953 CCTCATCTGGAAAATGGGGATGG + Intronic
1132307842 15:100830565-100830587 TCTCAGCTGGAGATCGGGGAGGG - Intergenic
1133411093 16:5569571-5569593 CCTCATCTGTGAAATGGGGATGG - Intergenic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133598743 16:7318526-7318548 TCTCATCTGTGAGATGGGGATGG + Intronic
1133683234 16:8140644-8140666 TCTCATCTGTCAAATGGGTAGGG + Intergenic
1133850707 16:9500676-9500698 TCTCACCTGTAAAATGGAGAGGG + Intergenic
1133872795 16:9705227-9705249 CCTCATCTGTAAAAGGCGGATGG - Intergenic
1134095600 16:11416446-11416468 CCTCATCTGCAGAATGGGAATGG + Intronic
1134213596 16:12298500-12298522 TCTCATCTGTAAAATGGGAATGG + Intronic
1134260200 16:12644990-12645012 CTTCATCTGTAAAATGGGGAAGG - Intergenic
1134781032 16:16895718-16895740 TCTCATCTGTGGAATGGCGGCGG - Intergenic
1136098649 16:27977131-27977153 TCTCATCTGTAAAATGGGAATGG - Intronic
1136372317 16:29844140-29844162 CCTCATCTGTAAAATGGGGGTGG + Intronic
1136688161 16:32008289-32008311 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136788765 16:32951844-32951866 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136881048 16:33902090-33902112 CCCCATCTGTAAAATGGGGATGG + Intergenic
1137571666 16:49570332-49570354 TCTTATCTGTAAAATGGGGATGG - Intronic
1137584579 16:49656855-49656877 TCTCATCTATAAAATGGGGCTGG - Intronic
1138121679 16:54405364-54405386 CCTCATCTGTAGAATGGGAAGGG + Intergenic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1138382252 16:56610788-56610810 CCTCATCTGTAGAAAAAAGATGG + Intergenic
1138555264 16:57767152-57767174 CATCATCTGTAAAATGGGGATGG - Intronic
1138741821 16:59319756-59319778 CCTCATCTGTACAATGGGAATGG + Intergenic
1139372260 16:66476423-66476445 CCTTGTCTGTAGAATGGGGATGG + Intronic
1139658250 16:68402258-68402280 TCTCCTCTATAAAATGGGGAAGG + Intronic
1140231023 16:73117231-73117253 TCTATTCTGTTGAAAGAGGAAGG - Intergenic
1140232456 16:73128870-73128892 TCTCATCTATATAACGGGGATGG + Intronic
1140440497 16:74984350-74984372 TCTCACCTGTAGAAGGGAGATGG - Intronic
1140489070 16:75318939-75318961 TCTCATTTCTAGAAAGGGGCAGG - Intronic
1141309290 16:82897543-82897565 CCTCATCTATAAAATGGGGATGG - Intronic
1141544664 16:84757032-84757054 TCTCATCTGTAAAATGGGGTTGG + Intronic
1141586127 16:85034775-85034797 TCTCATCTGTGAAATGGGGACGG - Intronic
1141646985 16:85372849-85372871 TCTCATCTGCAACAAGGGGGAGG - Intergenic
1141760838 16:86027441-86027463 GCTCATCTGTAGTACGGGGAGGG - Intergenic
1141901980 16:86996877-86996899 CCTCATCTTTAGAGTGGGGATGG + Intergenic
1141989163 16:87600701-87600723 TCTCATCTGTAAAATGGAGATGG - Intergenic
1142233712 16:88911597-88911619 TCTCATCTGTAAAATGGGAATGG + Intronic
1142401819 16:89862899-89862921 TCTCTTCTGTAAAATGGGGCTGG - Intronic
1203090962 16_KI270728v1_random:1213333-1213355 CCCCATCTGTAAAATGGGGATGG - Intergenic
1142943922 17:3408858-3408880 GCTCATTTCTAGCAAGGGGAAGG + Intergenic
1143215424 17:5221248-5221270 TCTCAACAGTAAAAAGCGGAAGG + Intronic
1143385852 17:6530073-6530095 CCTCATCTGTAGAATGGCAAGGG - Intronic
1144409677 17:14988508-14988530 CCTCATCTGTAAAATGGAGATGG - Intergenic
1144602864 17:16633906-16633928 TCTCATTTGGAGAATGGGAAAGG - Exonic
1144754534 17:17671173-17671195 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1144765869 17:17732134-17732156 CTTCATCTGTAAAATGGGGATGG - Intronic
1144889811 17:18488160-18488182 TGTCATCTGTAGAATGAGCATGG + Intronic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145823345 17:27857542-27857564 CCTCATCAGTAGAATGGGGGTGG - Intronic
1145853822 17:28132937-28132959 TTTCATCTGCAAAATGGGGATGG - Intronic
1145868745 17:28256802-28256824 CCTAATCTGTAAAATGGGGATGG - Intergenic
1145973421 17:28970285-28970307 TCTCATCTGTAAAGTAGGGATGG + Intronic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1146472275 17:33134191-33134213 TCTTATATGTAAAATGGGGATGG - Intronic
1146579708 17:34025982-34026004 TCTCATCTGTGAAATGGGTATGG + Intronic
1146594930 17:34160149-34160171 TCTCATCTGTAAAATGGGCTTGG - Intronic
1146950415 17:36901518-36901540 TCTTGTCTGTAAAATGGGGATGG - Intergenic
1146973777 17:37093855-37093877 CCTCATCTGTAAAATGGGGGTGG - Intronic
1147149151 17:38503993-38504015 CCACATCTGTAAAATGGGGATGG - Intronic
1148340783 17:46872365-46872387 CCTAATCTGTAAAATGGGGACGG + Intronic
1148737908 17:49875142-49875164 TCTCATCTGTAAAAATGGAATGG + Intergenic
1148849233 17:50546856-50546878 TCTCATTTGTAAAATGGGCAGGG + Intronic
1148867083 17:50634439-50634461 CCTCATCTGTAAAATGGGAAGGG - Intergenic
1148988610 17:51646217-51646239 TCCCATCTGTAAACTGGGGATGG + Intronic
1149315457 17:55434276-55434298 TCTCACCTGTAAAATGGGGGAGG + Intergenic
1150322541 17:64227782-64227804 TTTCATCTGTAAAATGGGAATGG + Intronic
1152625464 17:81386258-81386280 GCTCATCTGTAAAATGGGCATGG + Intergenic
1153487810 18:5618153-5618175 ACTCAGCTGTAAAATGGGGAAGG + Intronic
1153680126 18:7492541-7492563 CCTCATTTGTAAAATGGGGATGG + Intergenic
1154486301 18:14874054-14874076 CCTCACCTGTAGAATGGGAATGG + Intergenic
1154486689 18:14877618-14877640 TCTCATCTGTTCAGTGGGGATGG - Intergenic
1155276865 18:24196956-24196978 TCTGATCTGTGGAAATGGGGTGG - Intronic
1155348010 18:24877717-24877739 TGTCTTTTGTAGAAAGGGCAGGG - Intergenic
1156384703 18:36594584-36594606 CCTCATCTGCACAATGGGGATGG + Intronic
1157156180 18:45268712-45268734 TTTCATCTGTTGAATGGAGAAGG + Intronic
1157289508 18:46399752-46399774 TCTGCTCTGAAGAAAGGGCAGGG - Intronic
1158219819 18:55139109-55139131 TCTCAACTGTAAAATGGGCATGG + Intergenic
1158237500 18:55334585-55334607 TCTCATTTCTAGAAAGGTGAAGG - Intronic
1158607297 18:58907078-58907100 TCTCCTCTGTAGATAGGTGGAGG - Intronic
1158667876 18:59449210-59449232 CCTCATCTATAAAATGGGGATGG + Intronic
1158911401 18:62066357-62066379 CCTCATCTGTAAAATGGAGATGG + Intronic
1159353335 18:67302060-67302082 TTTCATCTGATGAAAGGGAAAGG + Intergenic
1159464248 18:68760060-68760082 TCACACCTGTAGAATGGAGAAGG - Intronic
1160344648 18:78123331-78123353 TCCCCTCTGTTGTAAGGGGAGGG - Intergenic
1160464341 18:79063570-79063592 CCTCATCTGGGGAAAGGTGAAGG + Intergenic
1161556652 19:4946440-4946462 TCACAGCAGTCGAAAGGGGAAGG - Intronic
1162198823 19:9006731-9006753 TCTCATCTATAAAACGGGGATGG + Intergenic
1162356683 19:10189945-10189967 TTTCATCTATAAAAAGGGGGTGG - Intronic
1162842265 19:13365134-13365156 TCTTAGCTGTTGAAAGGGGTGGG - Intronic
1163273386 19:16267547-16267569 TCTCATCTGTGAAATGGGGATGG + Intergenic
1163811825 19:19437597-19437619 GGTCATCAGTAGAAAGGGGAGGG - Intronic
1165313933 19:35043507-35043529 TCTCATCTGTGAAATGGAGAGGG + Intronic
1165407736 19:35641413-35641435 TCTCATTTGATGAAGGGGGAAGG - Intergenic
1166097921 19:40553055-40553077 TCTCATCTGTAAAATGGAGATGG + Intronic
1166108454 19:40609128-40609150 TCTCATTGGTAAAATGGGGATGG + Intronic
1166164659 19:40978867-40978889 TCTCATCTGTAAAATGAGAATGG - Intergenic
1166258502 19:41621763-41621785 TGTTTTCTGCAGAAAGGGGAAGG + Exonic
1166411135 19:42555918-42555940 TTTTTTCTGCAGAAAGGGGAAGG + Intronic
1166505878 19:43371269-43371291 TTTCATCTGGACAAAGGGAAAGG + Intergenic
1166774400 19:45303473-45303495 TCTCATCTGCAGAATGGGAGCGG + Exonic
1167061038 19:47146632-47146654 TCCCATCTGTAAAACAGGGATGG - Intronic
1167457609 19:49605673-49605695 CCCCATCTGTAAAATGGGGATGG - Intronic
1168318020 19:55492563-55492585 CCTCATCTGCAGACAGGGGAGGG - Intronic
1168490498 19:56804840-56804862 CCTCATCTGTAAAATGGGGCTGG - Intronic
925532001 2:4874166-4874188 GAACATCTGTAGAAAGGGGGAGG - Intergenic
925641853 2:5993038-5993060 CTTCTCCTGTAGAAAGGGGAAGG - Intergenic
925659427 2:6186663-6186685 TCTCATCTGGAACAAGAGGAAGG - Intergenic
925850137 2:8073122-8073144 CCTAATGTGTAGAAAGGAGAAGG - Intergenic
926049943 2:9738238-9738260 CCTCATCTGTGAAATGGGGATGG - Intergenic
926088500 2:10035142-10035164 TCTCATCTGTAAAATGGGGATGG - Intergenic
926247589 2:11132533-11132555 CCTCATCTGTAGAATGGCGTTGG + Intergenic
926404120 2:12532536-12532558 TCTCATTTGCAAAAAGGGAATGG + Intergenic
927095276 2:19743625-19743647 TCTGCTCTGTAGAATGGAGATGG - Intergenic
927154723 2:20214946-20214968 TCTCATCTGTAAAATGTGCATGG - Intronic
928130497 2:28645684-28645706 CCTTCTCTGTAGAAAGGGAATGG - Intergenic
928280607 2:29943073-29943095 TCTCATCTGATGAAAGCGTAGGG + Intergenic
928498824 2:31865361-31865383 TCTCATTTGTAAAATGTGGAGGG - Exonic
928938024 2:36700869-36700891 TTTCATCTGTATAATGGTGATGG - Intronic
930875804 2:56214236-56214258 TCTCATTTGTAAGAAGAGGATGG + Intronic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
931486150 2:62694708-62694730 CCTCATCTGTAAAATGGGAATGG - Intronic
932084356 2:68745168-68745190 TCTCATCTGAAAAATGGGGCCGG + Intronic
932266385 2:70370753-70370775 CCTCATCTGTAGAGTGAGGATGG + Intergenic
932298372 2:70645356-70645378 CCTCATCTGTAGAATGGAGGAGG + Intronic
932834747 2:75025876-75025898 TCTCATCTGTAATATGGGGATGG + Intergenic
932909992 2:75796191-75796213 TCTCATCTGTAAAATAGGAATGG - Intergenic
934653412 2:96104846-96104868 TCTCAGCTGCAGAAACAGGATGG - Intergenic
934934439 2:98454449-98454471 TCTCATCTGTAAAATGGGGAAGG + Intronic
935359272 2:102233674-102233696 TCTCATCTGTAAAATGGGGATGG + Intronic
935940127 2:108229278-108229300 TATCATTTGATGAAAGGGGAAGG + Intergenic
936410484 2:112254016-112254038 TCCCATCTGTAAAACGAGGACGG + Intronic
936434011 2:112487641-112487663 TCTCATCTGTAAAATGGGGATGG + Intronic
937343285 2:121105518-121105540 TCTCATCTGGGAAATGGGGATGG - Intergenic
937605195 2:123792080-123792102 TCTTATCTGTAGAATGCAGATGG - Intergenic
938064428 2:128273401-128273423 TCACATCTGCAGAAAGGGGCAGG - Intronic
938906834 2:135845088-135845110 TTTCCTCTGTAGAAAGGGGAAGG + Intronic
940144842 2:150534800-150534822 TCTCATCTATAAAATGGGTAGGG - Intronic
940888361 2:159011101-159011123 TCTCATCTGTAAAATGGGGATGG - Intronic
941747873 2:169106331-169106353 TCTCATCTGTATAATGGGGGTGG + Intergenic
943201776 2:184836071-184836093 TCTCATTTATAGATAGGGAAAGG - Intronic
943600521 2:189914794-189914816 TCTCATCTATAAAATGGGGCAGG - Intronic
944611132 2:201409150-201409172 CCTCATCTGTAAAATGGAGAAGG + Intronic
944633062 2:201647194-201647216 TCTCATCTGTAAAATGATGATGG - Intronic
944991588 2:205243481-205243503 TCTCATCTGTAGAATGAGAATGG + Intronic
945416730 2:209582562-209582584 TTACATTTATAGAAAGGGGATGG - Intronic
945967251 2:216201707-216201729 TCTCTTCTGCAGAAAGGGGTAGG - Intronic
946400851 2:219467757-219467779 GTTCATCTGTAGAACAGGGATGG + Intronic
946413039 2:219525000-219525022 GCTCATCTGTAAAAGGGGAATGG - Intronic
946679571 2:222199119-222199141 TCTCATCTGTACAAAAGGAATGG + Intergenic
947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG + Intronic
948663448 2:239520512-239520534 TCAAATCTGCAGGAAGGGGAAGG - Intergenic
948794928 2:240397628-240397650 CCTCGTCTGTAGAAAGGGGTTGG - Intergenic
1168830635 20:843610-843632 TCTCATCTGTAAAATGGAGGGGG - Intronic
1168964082 20:1888500-1888522 TCTCATCTGAAAATAGGTGAGGG - Intergenic
1169488302 20:6051901-6051923 CCTCATATGTAAAAAGGAGATGG + Intronic
1170740625 20:19052937-19052959 TCTCATCCATAAAATGGGGATGG + Intergenic
1170993335 20:21326087-21326109 TTTTATCTGTAGAAAGTGGATGG - Intronic
1172126132 20:32626435-32626457 TCTCCTCTGTAAGATGGGGATGG - Intergenic
1172311468 20:33921571-33921593 TCTCGTCTGTAAAATGAGGACGG - Intergenic
1173348770 20:42225395-42225417 TCTCATCTGTAAAATGGGAATGG - Intronic
1173556858 20:43972607-43972629 CCTCATCTGTTAAATGGGGATGG - Intronic
1173605135 20:44326566-44326588 TCCCATCTGTTAAATGGGGATGG - Intergenic
1173702585 20:45086018-45086040 TCTGATCTGTAAAATGGGGCTGG + Intergenic
1173871141 20:46342910-46342932 GCTTATCTGTAGAATGGGGACGG + Intergenic
1173929564 20:46807484-46807506 TCTCAACTGTAAAATGGGGGTGG - Intergenic
1174067261 20:47874629-47874651 TTTCATCTGCAAAATGGGGACGG + Intergenic
1174157036 20:48522242-48522264 TTTCATCTGCAAAATGGGGACGG - Intergenic
1174187728 20:48719078-48719100 TCCCATCTGTAAAATGGGCATGG - Intronic
1174292842 20:49521204-49521226 ACTCATCTGTAAAATGGAGATGG - Intronic
1174365464 20:50053726-50053748 TCTCATCTGTAAAATGGGGATGG + Intergenic
1174520986 20:51130474-51130496 CCTCATCTGAAGAAGGGGGTCGG + Intergenic
1175359796 20:58400036-58400058 TCTCATCTCTAAAATGGAGATGG - Intronic
1175470007 20:59220933-59220955 CCTCATCTGTAGAATGGGGCTGG + Intronic
1175693779 20:61085830-61085852 TCTCATCTATAAAATGGGGAGGG - Intergenic
1176201792 20:63864265-63864287 CCTCATCTGTGGAGTGGGGAGGG + Intergenic
1176794613 21:13361781-13361803 TCTCATCTGTTCAGTGGGGATGG + Intergenic
1177650106 21:23949362-23949384 TCTCATCTGCAGAATGGGCATGG + Intergenic
1178412819 21:32379664-32379686 TCTCATCTGTAAAATGGGTGTGG - Intronic
1178883205 21:36464776-36464798 CCCCATGTGTAAAAAGGGGATGG - Intronic
1178947368 21:36959473-36959495 GCTCATAGGTAGAAAGGGGCGGG + Intronic
1179164111 21:38922025-38922047 TCTCAACTGTAGAAATGTGATGG + Intergenic
1179246178 21:39636139-39636161 TCTCATCTTTAGAGCAGGGATGG + Intronic
1179548806 21:42130046-42130068 TTTCATCTGTAGCATGGGTATGG - Intronic
1180278514 22:10669153-10669175 TCTCATTGGAAGAAGGGGGAAGG + Intergenic
1181690757 22:24558525-24558547 TCTCATCTGTAAAATGGGGGTGG + Intronic
1181728303 22:24826894-24826916 CCTCATCTGTGTAACGGGGATGG - Intronic
1181997758 22:26896240-26896262 TCTCATGTGTAAAATGGGAATGG - Intergenic
1182068488 22:27446693-27446715 TCTCATCTGTAAGATGGGGATGG + Intergenic
1182096282 22:27628110-27628132 TTTCATCTGTAAAATGGGGATGG - Intergenic
1182131039 22:27850864-27850886 TCTCATCTATACAATGAGGATGG + Intergenic
1182823786 22:33244373-33244395 CCTCATCTGCACAATGGGGATGG - Intronic
1183255156 22:36757211-36757233 CCTCATTTGTAAAAGGGGGATGG + Intergenic
1183410177 22:37650363-37650385 TCTCATTTTTACAACGGGGATGG + Intronic
1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG + Intronic
1184092048 22:42297975-42297997 TCACATCTGTACAAAGTGGTGGG + Intronic
1184143763 22:42596062-42596084 GCTCATCTGTAGAATGGGGGTGG + Intronic
1184306677 22:43607670-43607692 TTTCATCTGTTCAAAGTGGAAGG - Intronic
1184424744 22:44402886-44402908 TCTCATCTGCACAGTGGGGATGG + Intergenic
1184568775 22:45309600-45309622 CCTCATTTGCAGAAAGGGGGCGG - Exonic
1184642249 22:45878922-45878944 TCTCATCTGTGGAATGGGCCGGG + Intergenic
1184813653 22:46854266-46854288 CCTCATTTGTAAAATGGGGATGG + Intronic
1184888795 22:47367114-47367136 TCACATTTGTAGAAAGCAGAGGG + Intergenic
1185069880 22:48650330-48650352 ACTCATCTGTTGAAAGAAGATGG + Intronic
1185226063 22:49653538-49653560 TCTCATCTTTAGCAAGGGTCTGG + Intronic
1185235263 22:49708818-49708840 TCCAATCTGTGGGAAGGGGAGGG - Intergenic
949426779 3:3926138-3926160 ACACATCTATAGAATGGGGAAGG - Intronic
949485025 3:4529873-4529895 CCTCATCTGTAGAAAGGTACCGG - Intronic
950106629 3:10392810-10392832 TGTCATCTGTAGAGTGGGGAGGG + Intronic
950152549 3:10698825-10698847 GCTCCTCTGTAAAATGGGGATGG + Intronic
950265511 3:11570115-11570137 TCTCTTCTGTAAAACTGGGATGG - Intronic
950433183 3:12963172-12963194 TCTCATCTTTAGAAACAGGGAGG + Intronic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
950669030 3:14514153-14514175 CCTCATCTGTAAAATGGGGCTGG + Intronic
950711034 3:14812968-14812990 TCCCATCTATAAAATGGGGATGG - Intergenic
951278770 3:20721417-20721439 TCTCATCTCTAGAATGGGGATGG + Intergenic
951308745 3:21098557-21098579 GCTCATCTGTGGAATGGGAATGG - Intergenic
951977246 3:28526073-28526095 CCTCATATGTAAAATGGGGATGG + Intronic
952282336 3:31935834-31935856 TTTCATATGTAGAAAGGGAAAGG + Intronic
952930041 3:38352850-38352872 AGTCATCTGTAGAGAAGGGACGG + Intronic
952966055 3:38621975-38621997 TCTCATCTGTGCAATGGGGAAGG + Intronic
953227260 3:41032205-41032227 CCTCATCTGTAAAACGGGGTTGG - Intergenic
953312655 3:41894677-41894699 CCTCATCTGTAAAATTGGGATGG - Intronic
954255873 3:49405529-49405551 TTTCTTCTGTAGAAAGGGAATGG - Intronic
954388269 3:50255663-50255685 TCCCACCTGTAGAATGGGAATGG - Intronic
954447620 3:50555182-50555204 TCAAATCTGCAGACAGGGGAGGG - Intergenic
954537390 3:51371423-51371445 GCTCATCTGGAGAAAGGTGCAGG + Intronic
955146555 3:56325788-56325810 TCTCATCTGTAGAAAGGGGATGG - Intronic
955432923 3:58868548-58868570 TCTCCTCTGTAAAATGGGAATGG - Intronic
955867801 3:63403545-63403567 TCTCATCTGTTAAATGAGGATGG - Intronic
956170893 3:66432568-66432590 CCCCATCTGTAAAATGGGGACGG - Intronic
956733761 3:72219957-72219979 CCTCATCTGTAAAATGGGGCAGG + Intergenic
956740984 3:72275878-72275900 CCTCTTCTGTAAAATGGGGATGG - Intergenic
956741720 3:72280732-72280754 CTTCATCTGTAAAATGGGGATGG - Intergenic
956986406 3:74706424-74706446 TCTCATCTGCAAAATGGGAAGGG + Intergenic
958902132 3:99899819-99899841 TCTCATCTGTAAAATGGGAATGG + Intronic
959361596 3:105400873-105400895 TCCCATCTGTAAAATGGGGAAGG + Intronic
959913115 3:111787521-111787543 TCTCATCTGTAGCAAGTGTCAGG - Intronic
961816059 3:129550982-129551004 TCTTATCTGTAAGATGGGGATGG - Intronic
961818226 3:129562047-129562069 TCCCATCTGTAAAATGGGGAGGG + Intronic
962869666 3:139477014-139477036 TCTCATCTGTAAAATAAGGATGG - Intronic
964159253 3:153626805-153626827 GCACATTTGTAGAAGGGGGATGG + Intergenic
964779153 3:160315829-160315851 TCTTTTTTTTAGAAAGGGGATGG + Intronic
965357036 3:167688444-167688466 TTTTTTCTTTAGAAAGGGGAGGG - Intronic
965603108 3:170473858-170473880 TCTCATCTGCAAAACGGGGTTGG + Intronic
965615479 3:170587614-170587636 TCTCATCTTCAGAATGGGAAAGG + Intronic
965772600 3:172196577-172196599 TCTCATCTGTAAAATGGAGGTGG + Intronic
966083946 3:176043645-176043667 CGTCATGTGTAGAAAGGGCAAGG + Intergenic
966808031 3:183821357-183821379 CCTTGTCTGTAGAATGGGGACGG + Intronic
966876665 3:184326003-184326025 TCTCAACTTTAGAAAAGTGAAGG - Intronic
968283925 3:197497128-197497150 TCTCATCTGTAAAAGAGGGGAGG + Intergenic
968613790 4:1568486-1568508 TCTCAGCTGGAGAATGGGGCAGG + Intergenic
968859393 4:3154331-3154353 TCCCATCCGACGAAAGGGGAAGG + Exonic
968890593 4:3366605-3366627 TCTCAACAGCAGAAAGGAGACGG - Intronic
969148926 4:5151781-5151803 TCTCATCTGTAAAATGGAAAGGG + Intronic
969639248 4:8387253-8387275 CCTCATCTGCAGCACGGGGACGG - Intronic
970383482 4:15532030-15532052 TCACATCTGTAAAATGGGTATGG - Intronic
970511292 4:16784347-16784369 CCTCATCTGTAGACTGGGGCTGG + Intronic
971181688 4:24334272-24334294 TCTCATCTATAAAATGGGAAAGG - Intergenic
971198123 4:24488637-24488659 CAGCATCTGTAAAAAGGGGATGG + Intergenic
971297595 4:25411662-25411684 TCTCATCTGTAAAATGAAGATGG + Intronic
972267416 4:37475254-37475276 TATGAACTGTATAAAGGGGAGGG - Intronic
972654332 4:41050372-41050394 TCTCATCTGTAAAATGGGGATGG - Intronic
972724144 4:41731522-41731544 TCTCATCTGTGAAATGAGGATGG + Intergenic
973177962 4:47231366-47231388 TTTCATCTGTAAAATGAGGAGGG + Intronic
973801560 4:54483457-54483479 TCCCATCTGTATAACGGGAAAGG - Intergenic
974647552 4:64714764-64714786 TCTTATCTGTAGTAAGGCCAAGG + Intergenic
975804630 4:78099127-78099149 TCTCAGCTTTAGAGAGGAGAGGG + Intronic
976177132 4:82366045-82366067 TGTCATCTGTAGAAAGCTGGGGG - Intronic
976218693 4:82738871-82738893 CCTCATCTGTAAAATGGGGTTGG - Intronic
976824559 4:89246467-89246489 TCTCTTCTGGAGACACGGGAGGG + Exonic
977337582 4:95718091-95718113 TCAAATCTGTAGATAGTGGAGGG - Intergenic
978142634 4:105335029-105335051 TCTCATCTGTACAATGATGAAGG + Intergenic
978475976 4:109130537-109130559 TTTTATCAGTAAAAAGGGGAAGG + Intronic
980643902 4:135616838-135616860 TCTCATCAGTTGATAGGAGAAGG - Intergenic
980732372 4:136839496-136839518 GCTCATGTGTAGATAGGAGAGGG + Intergenic
981411104 4:144433723-144433745 TCTTATCTGTAAAATGGGAATGG - Intergenic
981563306 4:146070761-146070783 TCACATCTCTAGAAAGGGGGAGG - Intergenic
983163105 4:164441609-164441631 TCTCATCTCTAAAACTGGGAGGG + Intergenic
983346921 4:166538646-166538668 CCTTATCTTCAGAAAGGGGATGG + Intergenic
983380752 4:166989950-166989972 TCTTATAAGTAGAAAGGGAAGGG + Intronic
985821381 5:2163195-2163217 TCTCATCTCTAACATGGGGATGG + Intergenic
985999755 5:3621089-3621111 TCTCTGCTGCAGAAAGGGGAGGG - Intergenic
987072776 5:14353593-14353615 TCTCATCTATAAAATGGGCATGG - Intronic
987769660 5:22284398-22284420 TCTCATCTGAAGACTGAGGATGG + Intronic
988392105 5:30647665-30647687 AATCATATGTAAAAAGGGGAGGG + Intergenic
989062275 5:37421080-37421102 CCTCACCTGTCGAAAGGGGATGG - Intronic
989127643 5:38072612-38072634 CTTCATCTGTAAAAGGGGGAGGG + Intergenic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
990592947 5:57283944-57283966 CCTTATCTTTGGAAAGGGGAGGG + Intergenic
991128617 5:63095515-63095537 TCTCCTCTGAAAAAAGGAGAGGG - Intergenic
991490188 5:67175163-67175185 TCTCATCTATAAAATGGGAATGG - Intergenic
992009371 5:72511532-72511554 CTTCATCTGTAAAAAGGGCAGGG - Intergenic
992152505 5:73919063-73919085 CCCCATCTGTACAAATGGGAAGG + Intronic
993423814 5:87737052-87737074 TGCCATCTGAAGAAAGGGGATGG - Intergenic
993693017 5:91026040-91026062 TCTCATTTTTAAAATGGGGATGG - Intronic
993777268 5:92014874-92014896 TGGCATCTGTAGTAAGTGGATGG - Intergenic
993820423 5:92608161-92608183 TTTAATCTGTAAAATGGGGATGG + Intergenic
995123184 5:108556767-108556789 TCTCATCTGAGGGAAGGGGAGGG + Intergenic
995441929 5:112201916-112201938 TCTCATCTGTAAAACTGAGATGG + Intronic
995461612 5:112409818-112409840 TCTCATCAGTAATAAGGGTAAGG - Intronic
996168696 5:120260718-120260740 TCTCTTCAGTACAAAGGTGAAGG + Intergenic
996824442 5:127665403-127665425 CCTCATCTGTAAAATGGGCATGG + Intergenic
997357850 5:133275724-133275746 GCTCATCTGTAAAATGGAGAGGG - Intronic
997384040 5:133458634-133458656 TCCCATCTGTGGACTGGGGATGG + Intronic
997778995 5:136638348-136638370 TTTCATCTGTAGACTGGAGATGG - Intergenic
997880213 5:137582615-137582637 TCTCATCTATAAAATGGGAATGG - Intronic
998417885 5:141958755-141958777 CCTCATCTGTAGAGTGGGGATGG + Exonic
999095850 5:148977590-148977612 CCTCATCTGTAAAATGGGGTTGG - Intronic
999168942 5:149576413-149576435 TCTCATTTGTAGAAAGAAGATGG + Intronic
999271671 5:150300270-150300292 TATCATCTGTAGAATGGGGGTGG - Intronic
999608969 5:153349087-153349109 TCTCATCTGTGGAATGGGATGGG - Intergenic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
999932167 5:156445452-156445474 TATCAGCTTTAGAAAGGGAAGGG + Intronic
1000023711 5:157340869-157340891 TCCCATCTATAGAAAGGAGACGG + Intronic
1000171966 5:158711505-158711527 TCTCATCTGTAAAATTGGGAAGG - Intronic
1001037387 5:168307164-168307186 CCTCATCTGCAGAATGGAGATGG - Intronic
1001301674 5:170538081-170538103 TCTCATCTTTAAAATGGGAAAGG - Intronic
1001401761 5:171450460-171450482 CCTCATCTGTGGAATGGGGATGG - Intronic
1001439369 5:171727727-171727749 TCTAATCTGTAGAAAAGAGAGGG + Intergenic
1001489376 5:172144852-172144874 CCTCATCTGTAAAAGGGGGTGGG - Intronic
1001529457 5:172452159-172452181 TTTCATCTGTGTAATGGGGATGG - Intronic
1001544837 5:172564632-172564654 CCTCATCTGTACAGCGGGGATGG - Intergenic
1001591426 5:172867920-172867942 ACTCATCAGTAAAATGGGGAGGG - Intronic
1001752091 5:174139250-174139272 TCTCATCTGTAAAATGGGAATGG + Intronic
1001761536 5:174211937-174211959 TCCCATCTGTAAAGAGGAGATGG - Intronic
1001775750 5:174327960-174327982 CCTTATCTGTAAAAATGGGACGG + Intergenic
1002001837 5:176200435-176200457 TCCCCTGTGTAGAAGGGGGAAGG - Intergenic
1002093616 5:176818284-176818306 CCTCATCTGTAAAACGGGAATGG - Intronic
1002252501 5:177938543-177938565 TCCCCTGTGTAGAAGGGGGAAGG + Intergenic
1002603899 5:180370726-180370748 CCTCATCTGTAAAACGGGGCTGG + Intergenic
1003428780 6:6019922-6019944 TCTCATCTCTACAAATGAGAGGG - Intergenic
1003534410 6:6963767-6963789 TCTTATTTTTAAAAAGGGGAGGG - Intergenic
1003849734 6:10209441-10209463 TCTCACCTGTAAAATGGGGCTGG - Intronic
1004007152 6:11647517-11647539 CCTCATCTGTAAAACGAGGAGGG - Intergenic
1004872780 6:19923890-19923912 TCCCATCTATAGAAAGGGTGTGG - Intergenic
1005100071 6:22162396-22162418 TCTCTCAAGTAGAAAGGGGAAGG + Intergenic
1006135464 6:31893130-31893152 TCTCATCTGTAAAATGGAAAAGG - Intronic
1006181478 6:32155751-32155773 TCCCATCTGTGGAGAGGAGAGGG - Exonic
1006387313 6:33738575-33738597 TCTCATCTGTAAAACGGGGCTGG - Intronic
1006510908 6:34520559-34520581 ACTCATCTCTAGAACAGGGAAGG + Intronic
1007162730 6:39805300-39805322 CCTCATCTGTAAAATGGTGATGG + Intronic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1008062492 6:47013355-47013377 CCTCATCTGTAAACTGGGGAAGG - Intronic
1008445394 6:51583755-51583777 TCTCATCTGTAGAAATGAGTAGG - Intergenic
1008679204 6:53854561-53854583 TGTCACCTGTAAAAAGGAGATGG - Intronic
1010515713 6:76770681-76770703 TCTTATCTGTAGAAGAGGAAAGG - Intergenic
1010831098 6:80530519-80530541 TCTCATCTGTAAAATCTGGAAGG - Intergenic
1010908093 6:81518134-81518156 TCTCAGGTGTTAAAAGGGGAAGG + Intronic
1010952659 6:82055565-82055587 TCTAATCTGTAAAATGGGGTTGG - Intergenic
1012862141 6:104572521-104572543 CCTCATCTGTAAAATGGGTATGG + Intergenic
1012952317 6:105531480-105531502 TCTCATCTATAAAATGGGAATGG - Intergenic
1013290089 6:108712370-108712392 CCTCATCTGTAAAATGGGGGAGG + Intergenic
1013501935 6:110760784-110760806 CCTCATCTGTATAATGGGGATGG - Intronic
1014057685 6:117035403-117035425 CCTCATCTATAAAAAGGAGATGG - Intergenic
1015103437 6:129507957-129507979 TCTCATCTCCAGAAACTGGAAGG - Intronic
1015156280 6:130100228-130100250 TTTCATCTGTAAAATGAGGATGG - Intronic
1015531758 6:134227687-134227709 CCTCAACTGTAAAATGGGGATGG - Intronic
1015576822 6:134680591-134680613 TCTCATCTGTAGAATGGGCAAGG - Intergenic
1015578761 6:134701431-134701453 ACTCCTGTGTAGAAAGGGGAGGG - Intergenic
1016190769 6:141261496-141261518 GCTCCTCTGCAGAAAGGGGAGGG + Intergenic
1017364863 6:153623579-153623601 TCTACTTTGTAGAAAGGAGAGGG - Intergenic
1019561405 7:1660510-1660532 TGTCACCTGTAAAAGGGGGAAGG + Intergenic
1019567459 7:1691515-1691537 CCTCATCTGTAAAATGGGCAGGG + Intronic
1019609961 7:1931325-1931347 CCTCATCTGGAGAATGGGGAGGG + Intronic
1020030450 7:4929233-4929255 TCTCATCTGTCGAATGGGCTCGG - Intronic
1020129623 7:5552346-5552368 TCTCATCTGTAAAATGGGGTGGG + Intronic
1020373361 7:7458729-7458751 ACTCATCTGAAAAATGGGGATGG - Intronic
1020761224 7:12269833-12269855 GCTCCTGTGTAGAAAGGGGTGGG + Intergenic
1021459907 7:20874807-20874829 TCTCATCTATAAAATGGGGATGG - Intergenic
1021468747 7:20977326-20977348 TTTAATCTGTAGAAGGGGGTGGG + Intergenic
1021610016 7:22447894-22447916 GCTCATCTGTAAAAAGGAGATGG - Intronic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1022270805 7:28805790-28805812 TCCCATCTGTAAAATGGGGCTGG + Intronic
1023183134 7:37506175-37506197 TCTCACCTGTAAAATGAGGATGG - Intergenic
1023633252 7:42184011-42184033 CCTCTTCTGTAAAATGGGGAGGG + Intronic
1026020105 7:66699388-66699410 TCTCATCTGTAAAATGGGAGTGG + Intronic
1026840336 7:73667453-73667475 TCTCTTCTGTAAAATGGGGTTGG - Intergenic
1028367710 7:90053803-90053825 TCCCCTCTGTAAAAATGGGAAGG - Intergenic
1028579595 7:92394142-92394164 TCTCATCTTTACAATGTGGATGG + Intronic
1029176793 7:98670252-98670274 CCTCATCTGTAGAATGGAGAAGG + Intergenic
1029349714 7:100004518-100004540 CCTCATCTGTAAAATAGGGATGG - Intergenic
1029585633 7:101468977-101468999 TCTCATCTGTGAAATGGGGTTGG + Intronic
1029976124 7:104835914-104835936 TCCCATTTGGGGAAAGGGGAGGG - Intronic
1030207319 7:106963604-106963626 TCTCATCTATAGAAAAGACAAGG - Intergenic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1030880449 7:114871755-114871777 TCACATTTGTAAAAAGGGGTCGG - Intergenic
1031085211 7:117295801-117295823 TCTTATCTGTACAATGGAGAAGG + Intronic
1032322539 7:130898016-130898038 CCTCATCTGTGAAATGGGGATGG - Intergenic
1032506101 7:132435774-132435796 TCCAATGTGTAGGAAGGGGAAGG - Intronic
1032675374 7:134125375-134125397 TCTCATCTGTCTAATGAGGATGG + Intergenic
1032698481 7:134358289-134358311 TCTCATCTGTAAAATGGGGATGG + Intergenic
1033444618 7:141409452-141409474 CCTCATCTGTATAATGAGGATGG + Intronic
1034080411 7:148272102-148272124 TGTGATCTTTATAAAGGGGATGG + Intronic
1034490317 7:151389762-151389784 TCTCATTTCGAGGAAGGGGAAGG + Intronic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1035309371 7:157955422-157955444 TCTCATCAGCAGCCAGGGGAGGG + Intronic
1036729509 8:11249971-11249993 CCTCATCTGAAAAATGGGGATGG - Intergenic
1037272612 8:17146209-17146231 TCTCATCTGTAGCATGAGAAAGG + Intergenic
1037748322 8:21663593-21663615 TCTCATCTGTCAAATGGAGATGG - Intergenic
1037994621 8:23343341-23343363 TCTCATCTGTAAGGTGGGGATGG - Intronic
1038003843 8:23413223-23413245 TCTCACCTGTAAAATAGGGAGGG + Intronic
1038214187 8:25546568-25546590 TGTCACCAGTAGAAAGTGGATGG - Intergenic
1038610390 8:29055380-29055402 TCACGTTTGTAGGAAGGGGAAGG - Intronic
1042082488 8:65070809-65070831 TCTCACCTTTGGAAAGGAGAAGG - Intergenic
1042122206 8:65500473-65500495 TCTCATTTGTAAATAGGGGATGG - Intergenic
1042314517 8:67411486-67411508 TGTCATCTGTGGAAAGGGACAGG - Intergenic
1043714295 8:83461916-83461938 TTTCATCTGTAAAAAAGGTATGG - Intergenic
1043804003 8:84647927-84647949 TCTCATCTGTAATTTGGGGAAGG + Intronic
1044251308 8:90006549-90006571 TCTCATCTGTTGAGAGGTGATGG + Intronic
1044585709 8:93867566-93867588 TCTCATCTGTATAAAGGTTAAGG + Intronic
1044843722 8:96360135-96360157 CCTGATCTGTAAAATGGGGAGGG - Intergenic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1045383025 8:101645608-101645630 CCTCATCTGTAAAAAGGAGATGG + Intronic
1046999756 8:120562267-120562289 CCTCATCTGAACAAAGGGGGCGG - Intronic
1047055748 8:121163249-121163271 TCACATGGGTGGAAAGGGGATGG - Intergenic
1047301927 8:123620935-123620957 TCCCATCTGTAGAATGGGAATGG + Intergenic
1047521961 8:125601770-125601792 TCTCATCTGCAAAATGGTGATGG + Intergenic
1047599592 8:126412936-126412958 TCTCATCTGGAGAGAGCAGAGGG - Intergenic
1048468248 8:134685177-134685199 TCTCCTCTGTAAAAAGGGGATGG - Intronic
1049223764 8:141440048-141440070 CCTCATCTGTAGAATGGGGCAGG - Intergenic
1049450036 8:142655652-142655674 GCTCATCTGTACAATGGGGATGG + Intergenic
1050273917 9:3976516-3976538 ACTCATACTTAGAAAGGGGAAGG - Intronic
1051584016 9:18707569-18707591 TCTCATCTGTAAGATGGGGGTGG - Intronic
1051694420 9:19752785-19752807 CCTCATCTGTAGTATGGGCATGG - Intronic
1052495081 9:29214245-29214267 GCTCAGCTGGAGAAAGGGGAGGG + Intergenic
1053419479 9:37968276-37968298 ACTTATCTGTAAAATGGGGATGG - Intronic
1053481131 9:38417368-38417390 TCTCATCTGTGAAATGGGGATGG - Intronic
1053887222 9:42652866-42652888 CCTCACCTGTAGAATGGGAATGG + Intergenic
1053887620 9:42656395-42656417 TCTCATCTGTTCAGTGGGGATGG - Intergenic
1054226242 9:62460317-62460339 CCTCACCTGTAGAATGGGAATGG + Intergenic
1054226642 9:62463845-62463867 TCTCATCTGTTCAGTGGGGATGG - Intergenic
1055349226 9:75368496-75368518 TCTCATCTTTAAAAAGGGAGAGG + Intergenic
1056012917 9:82351408-82351430 TATCATCTGTAAAATGGGGATGG + Intergenic
1056820555 9:89838796-89838818 CCTCGTCTGTAGATTGGGGATGG + Intergenic
1057184990 9:93052520-93052542 TCCCATCTGTAAAATGGGGATGG + Intergenic
1057824918 9:98365018-98365040 TCTCATTTGTAAAATGGGCAGGG + Intronic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1058420050 9:104824795-104824817 CCTCATCTCTAAAATGGGGATGG - Intronic
1059346597 9:113633115-113633137 TCACATGGGTAGAAAGGGCAGGG - Intergenic
1059543977 9:115157994-115158016 CCTCATCTGTAAAAAGGAGATGG + Intronic
1059694344 9:116716497-116716519 TCCCATCTGTAGAATGGGAATGG + Intronic
1059820191 9:117963947-117963969 TCTCATCATTAGAAAGGAAATGG + Intergenic
1059923316 9:119181469-119181491 TCTTATCTGTCAAATGGGGAAGG + Intronic
1059930604 9:119256693-119256715 CCTCATCTGTAAAATGGGGTGGG + Intronic
1059993291 9:119885419-119885441 TCTCATTTGTAGAATGAGGGGGG - Intergenic
1060054276 9:120400496-120400518 CCTCATGTGTAGAATGCGGACGG + Intronic
1060238445 9:121883251-121883273 TCTCTTCTGTAAAATGGAGATGG + Intronic
1060392756 9:123291901-123291923 TCTCATCTGTAAAATGTGCAGGG - Intergenic
1060825718 9:126686793-126686815 GCTCATCTGTAAAATGGGAATGG + Intronic
1060962910 9:127693790-127693812 CCTCATCTGTAGAATGGGAGAGG - Intronic
1060975673 9:127763648-127763670 TCCCATCTGCAAAATGGGGAGGG + Intronic
1061659454 9:132119126-132119148 TCTCATCTGTAGCATTGAGATGG + Intergenic
1061673057 9:132200033-132200055 GGCCATCTGTAGAATGGGGATGG + Intronic
1061847824 9:133397805-133397827 CCTCATCTGTAAAGTGGGGATGG + Intronic
1062465419 9:136678634-136678656 ACTCATCTGTAGAAAGTGTGGGG - Intronic
1185833878 X:3327542-3327564 TCTTATGTGTAGAAAGAGGCAGG - Intronic
1185857799 X:3552040-3552062 GTTCATCTGTAGAATGTGGATGG - Intergenic
1185935323 X:4250018-4250040 TTTCATCTGTAAAATGGGGAGGG + Intergenic
1186487630 X:9945955-9945977 CCTCACCTGGAGAAAGGGGAAGG - Intronic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1187248764 X:17577855-17577877 TCTCATCTTTAAAAAGGGATAGG + Intronic
1187397359 X:18930372-18930394 TGTCATTTGTAGAAAGTGCAAGG - Intronic
1187556826 X:20359643-20359665 TATCATTTGTGTAAAGGGGATGG - Intergenic
1189346729 X:40247578-40247600 CCCCATCTGTAAAATGGGGATGG + Intergenic
1190397306 X:49998162-49998184 CATCATCTGTAAAATGGGGAGGG - Intronic
1190702801 X:53000734-53000756 TCAGATCTGTAGAACGGAGACGG + Intergenic
1190843665 X:54170472-54170494 TTTCATCTGCAGAAATGGGCTGG - Intronic
1190916345 X:54814057-54814079 CCTCAACTGTAAAACGGGGATGG - Intronic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1193843060 X:86433058-86433080 CCTAATCTGTAAAATGGGGATGG + Intronic
1193931491 X:87558285-87558307 TCTCATTTGTAAAATGAGGACGG + Intronic
1194818711 X:98478807-98478829 TCTGATCTGTAGATATGGGGTGG - Intergenic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1196919218 X:120568743-120568765 TCTTATCTGTACAGTGGGGATGG - Intronic
1197270041 X:124415320-124415342 TAGCATCTGTTGAAAGGAGAAGG - Intronic
1198030253 X:132747642-132747664 TCCCATTTGTACAAGGGGGAGGG + Intronic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic
1198420651 X:136468315-136468337 TCTCACCTGTAAAATGGGGATGG - Intergenic
1199760451 X:150900183-150900205 TCTCATGTGTCAAAGGGGGAGGG + Intergenic
1200059652 X:153478603-153478625 TCTCCTCTGTAAAATGGGGTAGG - Intronic
1201928804 Y:19318928-19318950 TCTCAGCTTTTGAAAGTGGAGGG - Intergenic