ID: 955148544

View in Genome Browser
Species Human (GRCh38)
Location 3:56344317-56344339
Sequence GAGAATGAGGAGGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8665
Summary {0: 1, 1: 45, 2: 546, 3: 2029, 4: 6044}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955148544 Original CRISPR GAGAATGAGGAGGAGGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr