ID: 955148815

View in Genome Browser
Species Human (GRCh38)
Location 3:56346834-56346856
Sequence CTGCATCCTCCAATGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 1, 2: 1, 3: 44, 4: 381}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955148810_955148815 16 Left 955148810 3:56346795-56346817 CCAATATGTAGAGGCCAGTATCT 0: 1
1: 0
2: 0
3: 12
4: 125
Right 955148815 3:56346834-56346856 CTGCATCCTCCAATGGAGAAAGG 0: 1
1: 1
2: 1
3: 44
4: 381
955148813_955148815 2 Left 955148813 3:56346809-56346831 CCAGTATCTAGAAAGGGCATTCT 0: 1
1: 0
2: 0
3: 28
4: 242
Right 955148815 3:56346834-56346856 CTGCATCCTCCAATGGAGAAAGG 0: 1
1: 1
2: 1
3: 44
4: 381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955148815 Original CRISPR CTGCATCCTCCAATGGAGAA AGG Intronic
900388354 1:2420746-2420768 CTCCACCCTCCAATCGAGAGAGG - Intergenic
900723919 1:4202295-4202317 CTGCATCATCCCATGGTGGAAGG + Intergenic
900817030 1:4855892-4855914 CTGCATCATCCCATGGTGGAAGG - Intergenic
900909211 1:5582868-5582890 CTGCATCATCCTATGGTGGAAGG - Intergenic
901733491 1:11297308-11297330 CTGTGTCCTCCCATGGAGGAAGG - Intergenic
902144913 1:14390745-14390767 CTGCATCCTCCCAGGAAGGAAGG + Intergenic
904968778 1:34402478-34402500 CTGCATCCTCCATGGCAGAAGGG + Intergenic
905485734 1:38294892-38294914 CTGTATCCTCATATGGAGGAAGG + Intergenic
907979674 1:59469354-59469376 CTGCATCATCCCATGGCAAAGGG + Intronic
909052419 1:70782637-70782659 CTGCATCCTCACATGGTGGAAGG - Intergenic
909273809 1:73658824-73658846 GTGCATCCTCCCATGGTGGAAGG + Intergenic
911545015 1:99206135-99206157 CTGCATCCACATATGGAGGAAGG + Intergenic
911558292 1:99373000-99373022 CTGTATCATCCTATGGAGGAAGG - Intergenic
912680544 1:111726380-111726402 CTGAAACCTCCAAGGCAGAAAGG + Exonic
912695642 1:111840081-111840103 CTGCATCCTCACATGGTGGAAGG + Intronic
913436058 1:118849034-118849056 CTGCAGCTTCCAATTCAGAATGG + Intergenic
916199146 1:162253217-162253239 CTGCATCGTCCCATGGCGGAAGG - Intronic
916506508 1:165433067-165433089 GTGCATCCTCTGATGCAGAAGGG - Intronic
916506514 1:165433118-165433140 GTGCATCCTCTGATGCAGAAGGG - Intronic
916539223 1:165736097-165736119 CTGCATCCTCACATGGTGGAAGG - Intronic
916690656 1:167186950-167186972 CTGCATAATCCCATGGTGAAGGG - Intergenic
917347811 1:174046826-174046848 CTGCATCCTCACATGGCGGAAGG + Intergenic
917783761 1:178429365-178429387 CTGCTACCTACAAGGGAGAAGGG - Intronic
919365976 1:196661527-196661549 CTGTGTCCTCCAATGATGAAAGG + Intronic
919410600 1:197237394-197237416 CAGCATCCTCACATGGTGAAAGG + Intergenic
920724994 1:208426739-208426761 CTGTGTCCTCCAATGGCGAAAGG + Intergenic
921249749 1:213285850-213285872 CTGCATCCTCACATGGTGGAAGG - Intergenic
921588630 1:216977952-216977974 CTGCATCATCCCATGGTGGAAGG - Intronic
921808342 1:219481042-219481064 CTGTAGCCTGGAATGGAGAATGG - Intergenic
921893289 1:220373753-220373775 CTACATCATCCCATGGTGAAAGG + Intergenic
923175698 1:231462464-231462486 CTTCATCCTGCAGTGGTGAATGG - Intergenic
1063538977 10:6912925-6912947 CAGCTTCCTCCACTGGAAAATGG + Intergenic
1063544261 10:6964562-6964584 CTGCATCCTCACATGATGAAAGG - Intergenic
1063588270 10:7372554-7372576 CTGCAGCCTCCAGTGAAGAATGG + Intronic
1063897508 10:10697641-10697663 CTGCATCCTCACATGGCAAAAGG + Intergenic
1064350658 10:14573347-14573369 CTGCATCATCCCATGGTGGAAGG - Intronic
1065433563 10:25684135-25684157 CTGCATCCTCACATGGTGGAAGG + Intergenic
1066339052 10:34511491-34511513 CTGCATCCTCACATGTAGGAAGG + Intronic
1066537895 10:36411234-36411256 CTGCATCCTCCCATGGCAGAAGG - Intergenic
1067358101 10:45549832-45549854 CTGCATCATCCCATGGTGGAAGG - Intronic
1067527337 10:47046617-47046639 CGGCCTCCTCCAATGGATAAGGG + Intergenic
1068111298 10:52683889-52683911 CTTCATCTCCCAGTGGAGAATGG + Intergenic
1068863687 10:61872178-61872200 CTGTATCCTCACATGGGGAAAGG + Intergenic
1068910146 10:62371676-62371698 CTGTTTCCTCCTATGTAGAAAGG + Intergenic
1071036265 10:81249677-81249699 CTGCATCATCCTATGATGAAAGG - Intergenic
1071359713 10:84833870-84833892 CTGCATCATCCCATAGTGAAAGG - Intergenic
1072171093 10:92862491-92862513 CTGCATCCTCACATGGTGGAAGG - Intronic
1073429288 10:103475979-103476001 CTGCTTCCTCACCTGGAGAATGG + Intronic
1073812589 10:107166525-107166547 CTGAATCCTCCAAAACAGAAAGG + Intergenic
1074431953 10:113401813-113401835 CTGCATCCTCAGGTGGTGAAAGG + Intergenic
1075510395 10:123067625-123067647 CTGCTTCCTCCCATGGCAAAGGG + Intergenic
1075601310 10:123771470-123771492 CTGCATCCTCCCATGGCAGATGG - Intronic
1076604604 10:131681306-131681328 CTGCCTGCTCCAAGGGAGGAAGG - Intergenic
1078732137 11:13984452-13984474 CTGCATTATCCCATGGGGAAAGG + Intronic
1079659776 11:23022819-23022841 ATGCATCTTCCAAAGTAGAAAGG - Intergenic
1079752204 11:24213211-24213233 CTGCAACCTCCACTGGTGATAGG + Intergenic
1080174363 11:29343949-29343971 CTGCCTGCTCCATTGGAGAGTGG + Intergenic
1080257344 11:30305843-30305865 CTTCATCCTCACATGGTGAAAGG + Intergenic
1080335333 11:31188976-31188998 CTGCATCCTCACATGGTGGAGGG - Intronic
1080414150 11:32053905-32053927 CTGCATCATCCCATGGTGAAGGG - Intronic
1080926666 11:36764397-36764419 CTGCATCATCCCATGGAGGAAGG + Intergenic
1081439137 11:43061251-43061273 CTGCATCCTCACATGGTGGAAGG + Intergenic
1082120807 11:48378129-48378151 CTGCTACCTCCACTGGAGCAAGG - Intergenic
1082253023 11:50002513-50002535 CTGCTACCTCCACTGGAGCAAGG + Intergenic
1082761460 11:57130955-57130977 ATGCATCATCCCATGGAGAAGGG + Intergenic
1082782572 11:57299271-57299293 CTGCCCCATCTAATGGAGAAAGG - Intergenic
1086086334 11:82958554-82958576 CTGCATCCTCACATGATGAAAGG - Intronic
1087097158 11:94330209-94330231 CTGCATTCTCACATGGTGAAAGG + Intergenic
1087429643 11:98036412-98036434 CTGCATTCTCACATGGAGGAAGG - Intergenic
1090269852 11:125378465-125378487 CTGCTTCTTCCAATGGGGACAGG - Intronic
1090402187 11:126456123-126456145 CTGCTTCCTCCAGTGGAAGAGGG + Intronic
1090467690 11:126949760-126949782 CTTCATTCTCCAAGAGAGAAGGG + Intronic
1091056619 11:132425057-132425079 GTCCATCCTGCAATGGAGACGGG + Intronic
1091678118 12:2506096-2506118 CTTCCACCTCCCATGGAGAATGG + Intronic
1091991482 12:4959595-4959617 CTGTGTCCTCCCATGGAGGAAGG + Intergenic
1093770670 12:23014004-23014026 CTGCATCCTGACATGGTGAAGGG + Intergenic
1094068476 12:26386292-26386314 CTGCATTCTTCATTGGACAATGG - Intronic
1094084742 12:26577028-26577050 CTGCATCATCCCATGGGGGAAGG - Intronic
1094103991 12:26789345-26789367 CTGCTTACTGCAATGGAAAAGGG - Intronic
1095864599 12:46957666-46957688 CTGCATCCTCCCATGGTGGAAGG - Intergenic
1097753659 12:63385473-63385495 CTGCATCCTCTTCTGGGGAAAGG - Intergenic
1097754623 12:63395982-63396004 CTGCATCCTCACATGGCGGAAGG + Intergenic
1101422206 12:104558972-104558994 CTGCATTCTCCATTGGAGGTGGG + Intronic
1101681051 12:106965734-106965756 ATGGATACTCCAATGGGGAAAGG - Intronic
1102804384 12:115766703-115766725 ATGCATTCTCCAAAGGAGCAGGG - Intergenic
1103394472 12:120597351-120597373 GTCCAGCCTCCACTGGAGAATGG + Intergenic
1103780591 12:123396201-123396223 CTGCAGGCTCCAGTGGACAAAGG + Intronic
1104266012 12:127233098-127233120 TTCCATCCTCCAATGTAGTACGG + Intergenic
1104797315 12:131528671-131528693 CTGCATCTTCCCAGGGAGAAGGG + Intergenic
1105500156 13:20964783-20964805 CTGCATCCTCCCATGGTGGAAGG - Intergenic
1105697928 13:22908912-22908934 CTGCATCCTCACATGGAAGAAGG + Intergenic
1106690068 13:32105277-32105299 CTGTGTCCTCACATGGAGAAAGG - Intronic
1107266895 13:38566641-38566663 CATCATCCTCCAATTCAGAATGG + Intergenic
1107980093 13:45727078-45727100 CTGCTTCCACACATGGAGAAAGG + Intergenic
1108781969 13:53847447-53847469 CTGCATCATCCCATGTTGAAAGG - Intergenic
1109014002 13:56984645-56984667 CTGCATCCACCAATGCAGGTGGG + Intergenic
1109231475 13:59762936-59762958 CTGCATCTTCCCATGGTGATGGG - Intronic
1109383123 13:61591188-61591210 CTGCATCATCCCATGGCAAAAGG - Intergenic
1109523847 13:63548288-63548310 CTGCATCCTCACAAGGTGAAAGG - Intergenic
1109602383 13:64649226-64649248 CTGCATCATCTAATGGTGGAAGG - Intergenic
1109658737 13:65430138-65430160 CTGCATCCTCACATGGTGGAAGG - Intergenic
1112028916 13:95439287-95439309 CTGCATCCTCACATGGTGGAAGG + Intronic
1113395662 13:109945256-109945278 CTGCATCCTCACATGGTGGAAGG + Intergenic
1113479491 13:110610116-110610138 CTGCATCCTCCCTAGTAGAATGG + Intergenic
1113491937 13:110699095-110699117 CTGCATCATCCCATGGTGGAGGG - Intronic
1113970302 13:114183598-114183620 CTGCATCCTCATATGGTGAAAGG + Intergenic
1114202208 14:20532453-20532475 CTGTATCCTCACATGGGGAAGGG + Intergenic
1115813062 14:37132073-37132095 CTGCATCATCCCATGGTGGAAGG + Intronic
1115979248 14:39030804-39030826 ATGCGTCCTCACATGGAGAAAGG - Intergenic
1116160208 14:41258261-41258283 TTGCATCCCCCAATGGGGCATGG + Intergenic
1117090988 14:52250068-52250090 CTGCATCTTCCCATAGAAAAGGG - Intergenic
1118700505 14:68428054-68428076 CTGCATCATCCCATGGTGGAAGG - Intronic
1118868669 14:69723589-69723611 CTGCATCCTCTCATGGTGGAAGG + Intergenic
1119167001 14:72502804-72502826 CTGAATACTCCAATGAAGAGTGG - Intronic
1119320001 14:73724933-73724955 CTGCATCTTCCTCTGGGGAATGG + Intronic
1120062384 14:79999466-79999488 CTGAGTCTTCAAATGGAGAAGGG + Intergenic
1121428521 14:93870940-93870962 CTGCATCCTCCAGAGGGGAGGGG - Intergenic
1121644908 14:95511166-95511188 CTGCTTCCCCCACTGGAAAATGG + Intergenic
1122110210 14:99494869-99494891 CCGCATCCTCAAATGGTGGAAGG + Intronic
1123670748 15:22654410-22654432 CTGCATCCTCACTTGGTGAAAGG - Intergenic
1123800170 15:23810949-23810971 CTGCAGCCTGAAATGAAGAATGG - Intergenic
1124477703 15:30049327-30049349 CTGCATCATCCCATGGTGGAAGG + Intergenic
1124526722 15:30460837-30460859 CTGCATCCTCACTTGGTGAAAGG - Intergenic
1124598402 15:31110710-31110732 CTGTGCCCTCCAATGGAGGATGG - Intronic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1124771931 15:32546846-32546868 CTGCATCCTCACTTGGTGAAAGG + Intergenic
1125076210 15:35621611-35621633 CTGCTTGCTCCAATGCTGAATGG + Intergenic
1125128743 15:36256488-36256510 CTCCTTCCTGCTATGGAGAAAGG - Intergenic
1125215201 15:37264040-37264062 CTGCATCCTCACATGGTGAAAGG - Intergenic
1126656400 15:50982157-50982179 CTGCATCATCCCATGGTGAAAGG - Intronic
1128129309 15:65215055-65215077 CTGCACCCTGCAGTGGGGAAAGG + Intergenic
1128227164 15:66010053-66010075 CAGCATAATCCAATAGAGAATGG + Intronic
1129063220 15:72878262-72878284 CTGTATCCTCACATGGAGGAAGG + Intergenic
1129487466 15:75888854-75888876 CTGCATCCTCAAAGGAAGAGTGG + Intronic
1129907785 15:79201647-79201669 CTGCATCCTCCCATGGTAGAAGG + Intergenic
1129958245 15:79659004-79659026 CTGCTTCCTCTCATGGAGGAAGG + Intergenic
1130114849 15:80997866-80997888 CTGCATCCTCCCATGATGAAAGG + Intergenic
1130377200 15:83339942-83339964 CTGCATCCTCTTCTGGGGAAAGG + Intergenic
1131237912 15:90712969-90712991 CTGCATTTTCCCATAGAGAAGGG - Intergenic
1132828174 16:1915131-1915153 CTGCATCCCCCACAGGAGACCGG + Intronic
1133441142 16:5821817-5821839 CTGCATCCTCACATGGTGAAAGG + Intergenic
1135754341 16:25083850-25083872 CTGCATCATCCCATGGTGGAAGG - Intergenic
1137300139 16:47141911-47141933 GCGCCTCCTCCAATGGTGAAGGG - Intronic
1137805490 16:51301089-51301111 CTGCGTCCTCACATGGTGAAAGG + Intergenic
1138101638 16:54256612-54256634 CTGCAGCCCCCCAGGGAGAAAGG - Intronic
1138208585 16:55143812-55143834 CTGCATCATCCTATGGTGGAAGG - Intergenic
1138802738 16:60054340-60054362 CTGCATTCTCACATGGTGAAAGG - Intergenic
1138919962 16:61515483-61515505 CAGCTTCTACCAATGGAGAATGG + Intergenic
1139266345 16:65642737-65642759 CTCCATCCTCCCAAGGAGCAGGG + Intergenic
1140348021 16:74233802-74233824 CTGCATCCTCCTATGGCAGAAGG - Intergenic
1140941517 16:79725774-79725796 CTGTTTCCTCCTATGGAAAATGG + Intergenic
1141351007 16:83296835-83296857 GTACATCTTCCAAGGGAGAAAGG + Intronic
1141651898 16:85397228-85397250 CTGCTTCCCCCAATGCAAAAGGG - Intergenic
1141676433 16:85520195-85520217 CTGTATCCTCACATGGTGAAAGG + Intergenic
1142290545 16:89192037-89192059 CTGCATCCTCCCGTGGGGCAGGG + Intronic
1142367123 16:89656635-89656657 CTGCTTCCCCACATGGAGAATGG + Intronic
1144802359 17:17938517-17938539 CTCAATCCTCCACTAGAGAATGG + Intronic
1145785930 17:27593894-27593916 CCGCATCCTCCCATGGTGGAGGG + Intronic
1145834451 17:27943718-27943740 CTGTATCATCCCATGGAGGAAGG - Intergenic
1146524804 17:33557554-33557576 CTCCTTCCACCAATGCAGAATGG - Intronic
1147538223 17:41334726-41334748 CTGCTTCCTCAAAAGGAGAGTGG + Intergenic
1147985490 17:44305044-44305066 CTGCATCATCCAATGGTGGTAGG + Intergenic
1148634479 17:49137446-49137468 CTGCATCATCCCATGGTGGAAGG - Intronic
1150338104 17:64344585-64344607 CTTCCTCCTCCTATGGAGGAGGG - Intronic
1150668554 17:67169379-67169401 CTGCATCATCCCATGGTGGAAGG + Intronic
1155438002 18:25833222-25833244 CTGTATCCTCACATGGGGAAAGG - Intergenic
1156069857 18:33193937-33193959 CTGCATCATCACATGGAGGAAGG + Intronic
1156209535 18:34924464-34924486 CTGCATCATCCCATGGTGGAAGG + Intergenic
1156793725 18:41013576-41013598 CTGGATCCTTCAATAGAAAAAGG - Intergenic
1157145136 18:45154788-45154810 CTGTATCCTCCAGTGTAAAATGG + Intergenic
1157382204 18:47228940-47228962 CTGCATACTCCAAAGGAGGCTGG - Intronic
1157663204 18:49463693-49463715 CTGCATCCTGGAATTGAAAAAGG + Intergenic
1158645840 18:59246311-59246333 CTGCATCCTCACATGGTGGAAGG + Intergenic
1160279361 18:77473023-77473045 CTTCATTATCCAAGGGAGAAGGG + Intergenic
1160712140 19:557074-557096 CTGCGTCTTCCCAGGGAGAACGG - Intergenic
1162702290 19:12525844-12525866 CTGCACCCTCTCATGGTGAAGGG + Exonic
1163820499 19:19493866-19493888 CTGCATGTTCCAGTAGAGAAGGG - Intronic
1164409858 19:27992872-27992894 CTGCACTCTCCAGTAGAGAATGG - Intergenic
1165203105 19:34161050-34161072 CTAAAACCTCCCATGGAGAAAGG - Intergenic
1166131751 19:40749850-40749872 AAGGATCCTCCAACGGAGAACGG + Exonic
1166664122 19:44666947-44666969 CAGCCTCCTCCCCTGGAGAATGG - Intronic
925249271 2:2417393-2417415 CTGCATCCTCACAGGGTGAAAGG - Intergenic
925477098 2:4229565-4229587 CAGCTCCCTCCAATGGAGTAGGG - Intergenic
926288503 2:11509734-11509756 CTGCATCCTCACATGGTGGAAGG - Intergenic
926961867 2:18365819-18365841 CTGCATCCTCACATGGTGGAGGG - Intergenic
927458041 2:23274478-23274500 CTGCATCCTCACATGGTGGAAGG - Intergenic
929795820 2:45057727-45057749 CTGCATCCTCGCATGGTGGAAGG - Intergenic
930689155 2:54341343-54341365 CTGCATCCTCACATGGTGGAAGG - Intronic
931247186 2:60500986-60501008 CTGCATCCTCCTCTGTAAAATGG + Intronic
932359290 2:71091324-71091346 CTGCATCCTCATATGGTGGAAGG - Intergenic
935825826 2:106948265-106948287 CTGAGTCCTCAAATGGTGAAAGG + Intergenic
936109953 2:109656928-109656950 CAACAGCCCCCAATGGAGAAGGG + Intergenic
937359204 2:121217466-121217488 CTGCATCTGCCATTGGAGGATGG - Exonic
938178882 2:129162081-129162103 CAGCATCCTCATCTGGAGAATGG - Intergenic
938612961 2:132968251-132968273 CTGACTGCTGCAATGGAGAATGG + Intronic
940403676 2:153275465-153275487 GTGCATCCTCTCATGGTGAAAGG - Intergenic
942079917 2:172390252-172390274 TTAGATCCTCCAAAGGAGAAGGG - Intergenic
942455165 2:176133061-176133083 GAGCAGCCTCCAATGGAAAATGG - Intergenic
943678492 2:190742273-190742295 CTGCATCCTCCCATGGCAGAAGG - Intergenic
943990238 2:194680486-194680508 TTGCATCCTCCCATGGTGGAAGG + Intergenic
947154807 2:227151790-227151812 CTGCATCCTCACATGGTGGAAGG - Intronic
947627079 2:231626440-231626462 CTGCACCTGCCAATGGGGAAAGG - Intergenic
947979109 2:234393754-234393776 CTGCAACATCCCATGGTGAAAGG + Intergenic
1168760167 20:345144-345166 CTGCTTCAACCAATGGAGTACGG - Intergenic
1169100494 20:2943760-2943782 CTGCATCCTCTTTTAGAGAAAGG - Intronic
1171421113 20:25018254-25018276 CTGCATCGTCCCATGGTGGAAGG - Intronic
1171437793 20:25136526-25136548 CTGCATCATCCCATGGTGGAAGG - Intergenic
1172926920 20:38546230-38546252 CTGCATAATGCTATGGAGAATGG - Exonic
1173113234 20:40215867-40215889 CTGTATCAACCAATGGAGACTGG + Intergenic
1175218799 20:57405372-57405394 CTGCATCCTCCATGGGAACAAGG - Intronic
1175842624 20:62039327-62039349 CAGCATCGTTCAATAGAGAAAGG + Intronic
1177032991 21:16005613-16005635 CTGAATCCTCCACAGGAAAATGG - Intergenic
1177345027 21:19856330-19856352 TTGCATCCTCCAAAGGGGACTGG - Intergenic
1183017800 22:35004245-35004267 CTGCATCCTTACATGGTGAAAGG + Intergenic
1184908806 22:47511711-47511733 CTGCATCCTCACATGGTGAAAGG - Intergenic
949847411 3:8385877-8385899 CTGCATCATCCCATGGCGGAAGG - Intergenic
950146234 3:10651846-10651868 CTGCATCTCACAATGGACAAAGG - Intronic
950152669 3:10699848-10699870 CTGCATCATCCCATGGTGGAAGG - Intronic
950948769 3:16977903-16977925 CTGCATCCTCACATGGTGGAAGG + Intronic
951186970 3:19724393-19724415 CTGTGTCCTATAATGGAGAAGGG + Intergenic
952391855 3:32887334-32887356 CTGCTTACTACAATGAAGAAGGG - Intronic
952686241 3:36151816-36151838 CTGCATCCTCATATGGTGGAAGG + Intergenic
952723095 3:36553951-36553973 CTGCATCATCCCATGATGAAAGG - Intergenic
953051855 3:39351553-39351575 CTGTATCGCCCAATGGGGAAAGG + Intergenic
955016376 3:55074101-55074123 TTGCATTCTCCTATGGGGAAAGG - Exonic
955148815 3:56346834-56346856 CTGCATCCTCCAATGGAGAAAGG + Intronic
955944801 3:64182588-64182610 CTGCATCCTCAGGTGGTGAAAGG - Intronic
956054285 3:65281969-65281991 CTGCATCCTCCTATGTTGGAAGG - Intergenic
956571862 3:70705569-70705591 CTGCATCCTCACATGGGGGAAGG + Intergenic
957013153 3:75031034-75031056 CTGCATCATCCAATGGTAGAAGG - Intergenic
958138037 3:89521565-89521587 CTGCATCATCCCATGGTGGAAGG - Intergenic
959003227 3:100989147-100989169 CTGCATCCTCACATGGTGGAAGG - Intronic
959765038 3:110016255-110016277 CTGCAGCCACCAATAGAAAATGG - Intergenic
959886674 3:111510451-111510473 CTGCATCTTCACATGGAGGAAGG + Intronic
960006390 3:112785553-112785575 CTGCATCATCCCATGGAGGAAGG - Intronic
960231513 3:115233220-115233242 CTGCATTCACCAATTGAAAAAGG + Intergenic
960663679 3:120088797-120088819 CTCCACCCTATAATGGAGAATGG - Intronic
961116520 3:124334520-124334542 CTGCCTCCTAGAATGGATAATGG - Intronic
961166085 3:124764840-124764862 CAGCATCCTGCAATGGAGACTGG - Intronic
961843373 3:129737519-129737541 CTGCATCATCACATGGTGAAAGG - Intronic
962077227 3:132095330-132095352 CTGCATCATCCCATGGTGGAAGG + Intronic
962607618 3:137045570-137045592 CTGTATCCTCACATGGGGAAGGG + Intergenic
963173726 3:142277386-142277408 CTGCATCCTCACGTGGTGAAAGG - Intergenic
964851693 3:161102847-161102869 CTGCATCATCCAATGGTGGATGG + Intronic
964905619 3:161716718-161716740 TTGCATCATCCCATGGTGAAAGG + Intergenic
964990228 3:162801699-162801721 CTGCATCCTCACATGATGAAAGG - Intergenic
965055701 3:163712006-163712028 TTGCTTCCCCCAATGAAGAAAGG + Intergenic
966323048 3:178722427-178722449 CTGCATCATCCCATGGTGGAAGG + Intronic
966510003 3:180751778-180751800 CTGCATCATCCCATGGTGGAAGG - Intronic
966938260 3:184728866-184728888 CGGCTTCCTCCAATGCAGAATGG - Intergenic
967806175 3:193716355-193716377 CTGCATCCTCAAAAGGGGAAGGG + Intergenic
968660048 4:1795076-1795098 CTGCAGCCGCCGACGGAGAAAGG - Intronic
968806020 4:2773108-2773130 CTGCATGATCCCATGGAGGAAGG + Intergenic
970800091 4:19963067-19963089 CTGCATCCTCACATGGTGGAGGG + Intergenic
971082617 4:23231913-23231935 CTGGAGCCTCCAAATGAGAAGGG - Intergenic
972054419 4:34781361-34781383 CTGCACCCTCTCATGGTGAAGGG + Intergenic
972624029 4:40778527-40778549 CTGTATCCTCAGATGGTGAAAGG - Intronic
972841383 4:42933696-42933718 CTGCATCTTCACATGGTGAAAGG - Intronic
972842374 4:42946654-42946676 CTGTATCCTCACATGGTGAAAGG + Intronic
973199928 4:47488877-47488899 CTGCATCCTCCCATGGTGGAAGG - Intronic
973555763 4:52081127-52081149 CTCCATCCTCTAAAGGAGAAAGG - Intronic
974030778 4:56774339-56774361 TTGCTTCCTTTAATGGAGAAAGG - Intergenic
974874431 4:67685806-67685828 CTGCATCGTCCCATGGTGGAAGG - Intronic
976282949 4:83343105-83343127 CTGCATCGTCCTATGGAGGGAGG - Intergenic
977148435 4:93477100-93477122 CTGCATCATCCCATGGTGGAGGG + Intronic
977206950 4:94173822-94173844 CTCCATTCTCACATGGAGAAGGG - Intergenic
977309823 4:95372172-95372194 CAGGATGCTCCACTGGAGAAGGG - Intronic
977688615 4:99877507-99877529 TTGCATCCTCCTTTGGGGAATGG + Intergenic
978052799 4:104223200-104223222 ATACATCCTCCAAAAGAGAAGGG - Intergenic
978361610 4:107936494-107936516 CTGCATCATCCCATGGTGGAAGG - Intronic
978526806 4:109675844-109675866 CTGCATCATCCCATGGCAAAAGG - Intronic
978561693 4:110040848-110040870 CTGCATCATCCCATGGTGGAAGG - Intergenic
978947216 4:114514747-114514769 CTGCACCCTCCAATGGTAAAAGG - Intergenic
979772688 4:124548401-124548423 CTGCTTCCACAAATGGTGAAAGG - Intergenic
980483045 4:133414315-133414337 CTGTATCCTCGCATGGTGAAAGG - Intergenic
980976571 4:139616785-139616807 CTGCATCCTCACATGGTGGAAGG + Intergenic
981350341 4:143722099-143722121 CTGCATCATCCCATGGTGGAAGG + Intergenic
981796995 4:148606554-148606576 CTGCATCATCCCATGGTGGAAGG - Intergenic
981959850 4:150523379-150523401 CTGTGTCCTCCCATGGAGAAAGG - Intronic
982676019 4:158376696-158376718 CTGCATCATCACATGGAGGAAGG + Intronic
983671221 4:170240124-170240146 CTGCATCATCCCATGGTGGAAGG + Intergenic
984218417 4:176943336-176943358 CTGCAGGCTCCAGTGGAGCATGG - Intergenic
986258900 5:6125490-6125512 CAGCATACTCCAGTGGAGATGGG + Intergenic
991274500 5:64828539-64828561 CTGCATCCTCAAATGGCAGAGGG + Intronic
991411276 5:66347875-66347897 CTGAAGCCTGCAATAGAGAAAGG + Intergenic
992041454 5:72837323-72837345 CAGCATCCTCACATGGAGGAAGG + Intronic
993909985 5:93669639-93669661 CTGCATACTGCAATGGGGAAAGG - Intronic
994083975 5:95738616-95738638 CTGCATCGTCCCATGGTGGAAGG - Intronic
994095218 5:95841817-95841839 CTGAATCTTCCAGTAGAGAATGG + Intergenic
994304098 5:98180971-98180993 CTGCATTCTCCACTGGATCAGGG + Intergenic
994427678 5:99614321-99614343 CTGCATCCTCACATGATGAAAGG + Intergenic
995052309 5:107720055-107720077 CTGCAGCCTCCACTGGTGACAGG + Intergenic
995058384 5:107787584-107787606 TTGCATCCTCACATGGCGAAAGG - Intergenic
995058585 5:107789321-107789343 CTGCATCCTCACATGGTGGAAGG - Intergenic
995394182 5:111670118-111670140 CTGCATCCTCACATGGCAAAAGG + Intronic
996043844 5:118848134-118848156 CTGCACACTCCAGTGTAGAAAGG + Exonic
996483617 5:124003964-124003986 CTGCATCATTCCATGGAGGAAGG + Intergenic
997089309 5:130838493-130838515 CTGAATCCTCAAATGGTGGAAGG + Intergenic
997399381 5:133590863-133590885 CTGCATACTCCCATGGTGAAAGG + Intronic
997737695 5:136226246-136226268 CTGCATCCTCCTGTGGAACAAGG + Exonic
997923572 5:138006273-138006295 CTGGATCCTCCTAAGTAGAAAGG + Intronic
999297229 5:150467305-150467327 CTGCATCCTCACATGGTGGAAGG - Intergenic
999597920 5:153225985-153226007 TAGCATCCTCCAATGGTGATAGG + Intergenic
1000440480 5:161257160-161257182 CTGCTTCCTCCTATGTTGAATGG - Intergenic
1000827284 5:166060617-166060639 CTGCATCATCACATGGAGGAAGG - Intergenic
1001125918 5:169019104-169019126 CTGCATCCTGGGAAGGAGAAAGG + Intronic
1001599790 5:172921369-172921391 CTGCAGGCTACAGTGGAGAAGGG - Intronic
1003095338 6:3138668-3138690 CAGCATCCACCCATGGAGACAGG + Intronic
1003310989 6:4969861-4969883 CTGTGTCCTCGAATGGCGAAGGG + Intergenic
1003333768 6:5151622-5151644 CAGCATGTTCTAATGGAGAAGGG + Intronic
1003491625 6:6627350-6627372 CTGCATCCCTCACTGTAGAAAGG - Intronic
1003806233 6:9728466-9728488 CTGCATCTTCCAAGGAGGAAGGG + Intronic
1004039881 6:11965100-11965122 CTGCATCATCCTATGGTGGAAGG + Intergenic
1004994963 6:21181481-21181503 CTGCATCATCCAATGGCAGAAGG - Intronic
1005353525 6:24960341-24960363 CTGTGTCCTCACATGGAGAAGGG + Intronic
1005878903 6:30039105-30039127 CTGCATCCTCCCATGGCAGAAGG - Intergenic
1007828114 6:44616975-44616997 CTGCATCCTCACATGGTGGAGGG - Intergenic
1007878434 6:45134160-45134182 CTGCATCATCCTATGGCAAAAGG + Intronic
1008840441 6:55896609-55896631 CTGCGTCCTCACATGGTGAAAGG + Intergenic
1010743433 6:79534794-79534816 CTGCATCCTCTTATTGAGACAGG - Intronic
1012803140 6:103860355-103860377 CTGCATCCCACAAAAGAGAATGG + Intergenic
1012998996 6:106002911-106002933 CTGAATGCTCCAAAAGAGAATGG - Intergenic
1014220539 6:118794713-118794735 CTGCCTCTTCATATGGAGAAAGG - Intergenic
1014503618 6:122225793-122225815 CTGCATCCTCACATGGTGGAAGG + Intergenic
1015595215 6:134859920-134859942 CTGCATCTAACACTGGAGAAGGG + Intergenic
1016465925 6:144325402-144325424 CTACATCATCCCATGGAAAAAGG - Intronic
1016508640 6:144814240-144814262 CTGCGTCCTCCCATGGTGGAAGG - Intronic
1017807644 6:157959938-157959960 CTGCATCCTCACATGGAGGAAGG - Intergenic
1018068007 6:160137184-160137206 CAGCATCCTCCTAGGGAGCAGGG - Intronic
1018117953 6:160606382-160606404 CAGCAGCCTCCAATGGTAAACGG - Intronic
1018782194 6:167078298-167078320 CTGCATCCTCACAGGGAGAAGGG + Intergenic
1022386811 7:29907646-29907668 CTGCATCTTCACATGGTGAAAGG - Intronic
1022650628 7:32270806-32270828 CTGTTTCCTCCAATGCAAAATGG + Intronic
1023700606 7:42888645-42888667 ACGCATCCTCCAATGGAGGCCGG - Intergenic
1023800294 7:43827944-43827966 CTGTATTCTGCAATGGAGAAAGG + Intergenic
1024743756 7:52383800-52383822 CTACATCCTCCAAAGGGGCAGGG + Intergenic
1024840076 7:53575225-53575247 CTGCCACCTCCACTGGAGCAGGG + Intergenic
1024846375 7:53648196-53648218 CTGCTTCCACCAATGGTGAAAGG + Intergenic
1025735441 7:64142863-64142885 CTGCATCTTCCCATGGCAAAGGG + Intronic
1025807110 7:64844532-64844554 CTGCATCCGCAAAATGAGAAAGG + Intergenic
1027579118 7:79971026-79971048 CGGCATTATCCAGTGGAGAAAGG - Intergenic
1029935163 7:104416867-104416889 CTGCATCATCCCATGGTGGAAGG + Intronic
1030172036 7:106612608-106612630 CTGCATCATCCCACTGAGAAAGG - Intergenic
1030985239 7:116233839-116233861 CTGCATCTTCACATGGAGGAAGG + Intronic
1033285675 7:140038847-140038869 CTGAGTCCAGCAATGGAGAAGGG + Intronic
1033422952 7:141218883-141218905 CAGCCTGCTCCAATGTAGAATGG + Intronic
1034563689 7:151897138-151897160 CTGCTTCCTCTTATGGAGAAAGG + Intergenic
1034949832 7:155289832-155289854 CTGCATCCTCACATGGTGAAGGG + Intergenic
1035554739 8:558320-558342 CTGCATCATCCCATGGTGGAAGG + Intergenic
1035785706 8:2259025-2259047 CTGCATCCTCCCATGGCGGAAGG + Intergenic
1035807101 8:2462691-2462713 CTGCATCCTCCCATGGCGGAAGG - Intergenic
1037609597 8:20464993-20465015 CACCATCCTCCAGTGGAGACAGG + Intergenic
1037953934 8:23038649-23038671 TTGCATCCTCTTCTGGAGAAAGG + Intronic
1038277907 8:26137111-26137133 TTGCATCCTCACATGGTGAAAGG - Intergenic
1038340540 8:26681685-26681707 ATGCATCCTCACATGGTGAAGGG - Intergenic
1039214803 8:35258146-35258168 CTGCATCGTCACATGGAGGAAGG + Intronic
1039954332 8:42195519-42195541 CTGCTTCCTCCCGGGGAGAAAGG - Intronic
1039956856 8:42214432-42214454 TTGCAGCCTCCTATGGAGGATGG + Intergenic
1040543213 8:48377855-48377877 CTCCCTCCACCGATGGAGAAAGG - Intergenic
1041159801 8:55027997-55028019 CTGTGTCTTCCAATGGAGGAAGG - Intergenic
1041957162 8:63568913-63568935 ATGCATCATCCCATGGTGAAAGG - Intergenic
1042103020 8:65294896-65294918 CTGCATCCTCCAATGGGCACAGG - Intergenic
1042197561 8:66245349-66245371 CTGCATCATCCCATGGTGGAAGG + Intergenic
1042796910 8:72674072-72674094 CTGGCTCTTCCAATAGAGAAGGG - Intronic
1043056914 8:75450925-75450947 CTGCATCATCCCATGGCGGAGGG - Intronic
1043624750 8:82242965-82242987 CTGCTTCATCCAATGGCAAAAGG - Intergenic
1044538534 8:93384550-93384572 CTGCATCCTCATATGGTGAGAGG + Intergenic
1044868759 8:96598117-96598139 CTGCATCCTCACATGGCAAAGGG + Intronic
1045404475 8:101852008-101852030 CTGCATCCTCACATGGTGGAAGG - Intronic
1045407620 8:101882389-101882411 CTGTATCCTCCTATGGTGGAAGG - Intronic
1046079430 8:109353341-109353363 CTGCATCCTCACATGGTGGAAGG + Intergenic
1046392759 8:113598117-113598139 TTTCATTCTCCAATTGAGAATGG + Intergenic
1046805538 8:118475339-118475361 CTGCTTCCACTCATGGAGAATGG - Intronic
1046818893 8:118615379-118615401 CTGCAGCCTCCACTGGGGGAAGG - Intronic
1047064318 8:121263420-121263442 CTTCATCATCCCATGGTGAAAGG - Intergenic
1047913969 8:129561693-129561715 CTGTGTCATCCCATGGAGAAAGG - Intergenic
1048264793 8:132976297-132976319 CTGCATCATTCCATGGGGAAAGG + Intronic
1048841795 8:138573041-138573063 CTGCATCCTAATATGGAGGAAGG + Intergenic
1049240762 8:141536388-141536410 CTGCATCCTCAAGCGGAGAGTGG + Intergenic
1049713436 8:144078094-144078116 CTGCATCCTCAAAGGGAAAAGGG + Intergenic
1050125705 9:2354397-2354419 CTGCAGCCAACAATGTAGAAAGG + Intergenic
1050503507 9:6323371-6323393 CTGCATCATCCCATGGAAGAAGG + Intergenic
1051667841 9:19482025-19482047 ATGCAGCCTCCAGGGGAGAAAGG - Intergenic
1051957112 9:22709691-22709713 ATGCATCATCCCATGGTGAAAGG + Intergenic
1052671079 9:31558019-31558041 CTGCATCATCCCATGGTGGAGGG - Intergenic
1053034876 9:34816584-34816606 CTGTGTCCTCCCATGGTGAAAGG + Intergenic
1055160744 9:73124772-73124794 CTGCATCATCCCATGGTGGAAGG - Intergenic
1055325091 9:75120475-75120497 CTGCCTCCTCGAATCTAGAATGG + Intronic
1055535452 9:77238068-77238090 TTGCATCATCCAATGAAGACAGG - Exonic
1056463234 9:86828322-86828344 CTGCATGCCCCACTGGAGGAGGG - Intergenic
1057705811 9:97394170-97394192 CTGCATCATCCCATGGCGGAAGG - Intergenic
1057974391 9:99588881-99588903 CTGCATCCTCACATGGTGGAAGG - Intergenic
1059856928 9:118409655-118409677 CTGCATCCTCCCACGGTGAAAGG + Intergenic
1060374377 9:123105479-123105501 CTTCTTCCTGCTATGGAGAAGGG - Intergenic
1060731727 9:126041503-126041525 CTGCATCCTCATATGGTGGAAGG - Intergenic
1060950874 9:127601856-127601878 CTGCATCATCCCATGCAGAAGGG - Intergenic
1061186751 9:129059450-129059472 CTCCAGCCTGCCATGGAGAAGGG - Intronic
1062258932 9:135648030-135648052 CTGCATCAGCCAATGGGGAAAGG + Intergenic
1186034714 X:5409390-5409412 CTGTGTCCTCCCATGGTGAAAGG - Intergenic
1186963463 X:14762130-14762152 CTGCATCCTCACATGGTGGAAGG + Intergenic
1187563350 X:20423379-20423401 CTGCATCCTCACATGGTGAAAGG - Intergenic
1188134071 X:26472434-26472456 CTGCATCCTCCAATGGTGAAAGG - Intergenic
1188620646 X:32218734-32218756 CTGTTTTCTCCAATGGAAAATGG - Intronic
1188877494 X:35448451-35448473 CTCAAGACTCCAATGGAGAAAGG - Intergenic
1188936736 X:36185211-36185233 CTGCATCCTCCCATGGCAGAAGG + Intergenic
1189368588 X:40409682-40409704 CTGCATCCTCCAAAGGAGAGGGG - Intergenic
1189740147 X:44109446-44109468 CTGCATCCTCACATGGTGGAAGG + Intergenic
1190311865 X:49122581-49122603 CTTCTTCCTTCAATGGGGAAGGG + Intronic
1190710469 X:53064669-53064691 CTGCATCATCCCATGGTGGAAGG + Intronic
1191885635 X:65885031-65885053 CTGCATCCTCAGATGGTGGAAGG - Intergenic
1192000082 X:67140509-67140531 CTGGACCCAACAATGGAGAATGG - Intergenic
1192018153 X:67354461-67354483 CTGCATCCTCATATGGTGGAAGG + Intergenic
1192581654 X:72287945-72287967 CTTCAGCCTCCAATGTAGCAGGG - Intronic
1193577567 X:83220777-83220799 CTGCATCCTCACATGGCCAAAGG + Intergenic
1194076366 X:89399691-89399713 CTGCCACCTCCATTGGAGCAGGG - Intergenic
1194553854 X:95333325-95333347 CTGCTACCTCCACTGGAGAGGGG + Intergenic
1196541328 X:116911855-116911877 CTGCATCTTCCCATGTAGAAGGG - Intergenic
1197342807 X:125293597-125293619 CTGCATCATCCCATGGTGGAAGG + Intergenic
1197715188 X:129701418-129701440 CTCCATCCTTCCATGCAGAAAGG + Intergenic
1198164478 X:134041048-134041070 CTGCATCCTCACATGCAGAAGGG - Intergenic
1198319030 X:135499986-135500008 CTGCATCATCCCATGGTGGAAGG - Intergenic
1198741717 X:139849939-139849961 CTGCATCATCCCATGGTGGAAGG - Intronic
1198880638 X:141277290-141277312 ATGCCTCCTCCTGTGGAGAAAGG - Intergenic
1199703533 X:150404182-150404204 CTGCACCCTGTAATGGAAAAAGG + Intronic
1199721326 X:150544604-150544626 CTGCATTCTGGAGTGGAGAAGGG - Intergenic
1200429006 Y:3055211-3055233 CTGCCACCTCCATTGGAGCAGGG - Intergenic
1201597146 Y:15682957-15682979 CTGCATCCTCACATGGTGGAAGG - Intergenic
1201726086 Y:17153612-17153634 CTGTACCCTCCAATGGCAAAGGG + Intergenic