ID: 955152054

View in Genome Browser
Species Human (GRCh38)
Location 3:56377086-56377108
Sequence ATTAACATTGGGCCTCTAAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 84}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955152054 Original CRISPR ATTAACATTGGGCCTCTAAT CGG (reversed) Intronic
909784688 1:79596359-79596381 ATGAATATTATGCCTCTAATAGG + Intergenic
910531441 1:88240817-88240839 ATTAATTTTGGACCTCAAATGGG + Intergenic
911538484 1:99129461-99129483 ACTAACATTGGACCTCTCAGTGG - Intergenic
915552770 1:156644773-156644795 ATAAACAGTGGGCCTGGAATGGG + Intronic
917451671 1:175152349-175152371 CTTAACATTGGGCCTGCACTTGG + Intergenic
919544922 1:198903579-198903601 ATTAACATTGGGCAGTTATTCGG - Intergenic
1068305511 10:55202407-55202429 ATTATCTTTAGGCCTATAATGGG - Intronic
1068957709 10:62834515-62834537 ATCAACATTGGTTCACTAATGGG + Intronic
1069250378 10:66259181-66259203 ATTTACATGGGGCCTCTTAATGG + Intronic
1073232502 10:101983926-101983948 AATAACCTTGGGCTTCTGATTGG + Intronic
1074512275 10:114125948-114125970 ATTAACATTGGAGCTCTCTTTGG - Exonic
1087554114 11:99692587-99692609 ATTAACAGTGGACCTCTCAGTGG - Intronic
1087718700 11:101637733-101637755 ATTAACAGTGGACCTCTCAATGG + Intronic
1095303314 12:40612877-40612899 ACTAACAGTGGACCTCTAATTGG - Intergenic
1097211191 12:57371623-57371645 TTTAACATTGTGCTTCTCATAGG + Intronic
1097601317 12:61696063-61696085 ATTACCTTAGGGCCTCTCATGGG - Intergenic
1100099853 12:91090569-91090591 ACTAACAGTGGACCTCTAAGTGG - Intergenic
1106865832 13:33962557-33962579 ATAAATATTTGGCCTCTGATTGG - Intronic
1115383806 14:32771944-32771966 TTTAATATTGGGCCCCAAATTGG + Intronic
1116095946 14:40367671-40367693 ATTAACATTGGACTTCTATTTGG - Intergenic
1116332704 14:43615501-43615523 ATTGATATTGGGCCCCAAATGGG - Intergenic
1122095180 14:99365366-99365388 ATTAACATTGGTTATCTTATGGG - Intergenic
1125040596 15:35181664-35181686 CTTAACATTTGGCCTGTACTTGG - Intergenic
1126469564 15:48993594-48993616 ATTATCTTTTGGCCTGTAATGGG + Intronic
1126927061 15:53601145-53601167 ACTAACAGTGGGCCTCTTAGTGG + Intronic
1127092249 15:55478805-55478827 ATCGATATTGGGCCCCTAATGGG - Intronic
1129971583 15:79782126-79782148 ATTAACAGTGGACCTCTCAGTGG + Intergenic
1131519214 15:93100610-93100632 ATTTACATTGGGCCTAAAAGTGG + Intergenic
1137898523 16:52239371-52239393 ATGAAGAGTGGGCCTGTAATAGG + Intergenic
1155837753 18:30608205-30608227 ATTAACACTGGGGCTCACATGGG + Intergenic
1157059409 18:44270094-44270116 ATTTACATTAGGCCTCTATTAGG - Intergenic
1161340782 19:3740827-3740849 ACTAACATTCAGCCTCTAAAAGG + Intronic
1168672414 19:58250674-58250696 ATTGATATTGGGCCCCAAATGGG + Intronic
932822505 2:74913305-74913327 ATTAACATTGGTCTCATAATTGG + Intergenic
936855912 2:116957201-116957223 ATTGACCTTGGCCCTTTAATGGG + Intergenic
936916785 2:117648115-117648137 ATTTTCATTCTGCCTCTAATGGG - Intergenic
939540773 2:143491153-143491175 ATTAACATTGAGCATCTCATTGG + Intronic
940376464 2:152964228-152964250 ATTGATATTGGGCCTCAAATGGG + Intergenic
941264544 2:163344156-163344178 ATAAACATAGGGCCTTTCATTGG + Intergenic
941670837 2:168290762-168290784 TTTAACATGAGGCCTGTAATAGG - Intergenic
942537402 2:176979405-176979427 ATTAATATTGGGCTTGTGATTGG - Intergenic
945374547 2:209064609-209064631 AATAACTTTGGGACTCTTATGGG - Intergenic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
1170437259 20:16342996-16343018 ATTAAAATTGGGCATGAAATGGG + Intronic
1170672817 20:18450756-18450778 ATTAAACTTGGGACTCAAATAGG + Intronic
1174549663 20:51352796-51352818 ATTAACATTGGCTCTCGGATGGG - Intergenic
1183024092 22:35050721-35050743 CTTAACATTAGGCATCTTATGGG - Intergenic
949210791 3:1498267-1498289 ATTAATATTGGCCCTTTAATTGG + Intergenic
950769941 3:15303290-15303312 ATTCACATTAGCTCTCTAATCGG + Intronic
955152054 3:56377086-56377108 ATTAACATTGGGCCTCTAATCGG - Intronic
955903075 3:63777976-63777998 ATTAAAATTGTGCCTATATTTGG - Intergenic
960312952 3:116139361-116139383 AGAAACCTTGGTCCTCTAATTGG - Intronic
961068203 3:123894490-123894512 AATAACATTGGGATTTTAATAGG + Intergenic
966907263 3:184536095-184536117 ATTCACATGAGGCCCCTAATGGG + Intronic
968436974 4:598282-598304 ACTAACAGTGGGCCTCTCACTGG - Intergenic
971094424 4:23384161-23384183 ATTATCATTGACCCTGTAATAGG + Intergenic
975861367 4:78680551-78680573 ATTGATCTTGGGCCTCTCATTGG - Intergenic
976710527 4:88066184-88066206 ATTAAGATTGGGCTACAAATTGG + Intronic
980150656 4:129043256-129043278 ATTTACATAGGGCCACCAATTGG + Intronic
981059676 4:140409360-140409382 ATTATCATAGGGTGTCTAATAGG - Intronic
981208749 4:142075521-142075543 ATTAACATTTGGTTTCTAAAAGG - Intronic
983967901 4:173835888-173835910 ATTAACAATGTGCCACTGATGGG + Intergenic
984129276 4:175852968-175852990 ATTAACATTGTACCCCAAATGGG + Intronic
984345841 4:178524140-178524162 ATTAATATTGGGTGTCTATTTGG - Intergenic
985142356 4:186854552-186854574 ATTGTCATAGGGCTTCTAATGGG + Intergenic
987429100 5:17809877-17809899 ATTAAAATTAAGCCTCTAAGAGG + Intergenic
988085950 5:26476009-26476031 CTTAGCATTGAGTCTCTAATGGG - Intergenic
1001368550 5:171170859-171170881 AGTAACAGTGAGCCTCTATTTGG + Intronic
1002902478 6:1421001-1421023 AATAACATTGAGCATCTTATTGG + Intergenic
1003403379 6:5809228-5809250 AATAGCACTGGGCCTATAATTGG - Intergenic
1006209115 6:32377575-32377597 ATTAACAGAGGGCTTCTAAAGGG + Intergenic
1008062189 6:47010038-47010060 ATTAACACACGGCCTCTGATGGG + Exonic
1013467899 6:110433690-110433712 ATTAAGATTGGGTCTTTAATAGG + Intronic
1016947275 6:149546442-149546464 AACAACTTTGGGCCTCTACTAGG + Intergenic
1022457788 7:30574129-30574151 ATTGAGATTGGGCCCCAAATGGG + Intergenic
1023091188 7:36618958-36618980 AGTAACATTGGGCCTGTGAATGG + Intronic
1028381160 7:90200479-90200501 ATTAACAATGGGCATCAAAAAGG + Intronic
1031622894 7:123956929-123956951 ATTAAAATTGGCTCTCTAATAGG - Intronic
1033898552 7:146106667-146106689 GTTAACGTTGGTCCTCTGATAGG - Intergenic
1034981856 7:155484319-155484341 ATTAACATTTGGCATCAAACAGG - Intronic
1042965160 8:74343451-74343473 ATGAACCTGGGGCCTCTAACTGG + Intronic
1049951685 9:650757-650779 AGGAACATTGGGCCTCTGTTAGG - Intronic
1055043798 9:71904208-71904230 ATTATCAGTGGGCCTCTGGTAGG + Intronic
1055842088 9:80517736-80517758 ACTAACAGTGGACCTCTAAGCGG - Intergenic
1062122829 9:134842806-134842828 AATGACATTTGGCCTCTAAATGG - Exonic
1062704978 9:137933441-137933463 ATTTATATTGGGCCCCAAATTGG + Intronic
1185962689 X:4563069-4563091 AATTACATTAGTCCTCTAATGGG - Intergenic
1188139736 X:26534973-26534995 ATTAACATTGTGGCTCTTAGGGG + Intergenic
1189787062 X:44568685-44568707 ATTAACTTGGGGATTCTAATGGG - Intergenic
1191155537 X:57268639-57268661 GTTAACAGTGGACCTCTAACTGG + Intergenic
1192862396 X:75089836-75089858 TTTAAAATTGGGTCTGTAATTGG - Intronic
1195502599 X:105619570-105619592 ATTAAATGTGGGCCTCTGATAGG - Intronic
1195794325 X:108627322-108627344 ATTGACAGTGGGCCTCTATGAGG - Intronic