ID: 955160287

View in Genome Browser
Species Human (GRCh38)
Location 3:56458756-56458778
Sequence GGGAATGTTACAGCCTTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955160287 Original CRISPR GGGAATGTTACAGCCTTAGA AGG Intronic
901702510 1:11053233-11053255 GGGAATGCTGCCCCCTTAGAGGG - Intergenic
905486089 1:38297958-38297980 GAGAATGTAACATCCTGAGATGG + Intergenic
907344730 1:53765802-53765824 GCCAATGTTACAGCATTAGTGGG + Exonic
910403972 1:86866106-86866128 GGGATTGCTTGAGCCTTAGAGGG + Intronic
911922829 1:103788755-103788777 GGGAATTTCACAGACTTTGATGG - Intergenic
913383371 1:118233337-118233359 GTGAGTGTTACAGCCTTTAAAGG - Intergenic
914195611 1:145446610-145446632 GGGGATGTAACAGCCTGAGGAGG - Intergenic
916842031 1:168610322-168610344 GGGAATGTTACTGCCCTCTAGGG + Intergenic
916943468 1:169700471-169700493 ATGAATGTTACAGCCTTGAATGG + Intronic
917046317 1:170864561-170864583 GGGAATGATACAGCTTTGCATGG - Intergenic
918347919 1:183622774-183622796 GGGAATTTATCAGCCTTAGGTGG - Intergenic
1063199947 10:3778601-3778623 GGGAGTGTTACAAACTTGGAGGG + Exonic
1063392656 10:5660383-5660405 GGGCAGGGCACAGCCTTAGATGG - Intronic
1066114163 10:32225145-32225167 GCTAATGTAACAGCTTTAGAGGG + Intergenic
1068814221 10:61291619-61291641 GGGGATGTGAAAACCTTAGAGGG - Intergenic
1074595877 10:114866448-114866470 GTGAATGAAACAGGCTTAGATGG - Intronic
1079490798 11:20987109-20987131 GGCAATGTTTCAGCCTTATGGGG - Intronic
1081713066 11:45230391-45230413 GGGAATCTCAAAGCCTCAGAAGG - Intronic
1087632767 11:100670199-100670221 GGGAATTTGACAGCAATAGATGG - Intergenic
1088273225 11:108057028-108057050 GGGAATGTTACAGTTTTATAAGG + Intronic
1097293623 12:57941371-57941393 CGGGTTGTTACAGCCTTTGAGGG + Intergenic
1100442231 12:94627651-94627673 TGGAATGTTCCTCCCTTAGATGG + Intronic
1107198781 13:37687890-37687912 GGTAATTTGACAGCCTGAGAAGG + Intronic
1108157074 13:47596250-47596272 GTGAATGTTACAGCTCTTGAAGG - Intergenic
1108710382 13:53027458-53027480 GGAATTGTTACAACCCTAGAGGG + Intergenic
1109707908 13:66122931-66122953 TGGAATGCCACAGACTTAGAGGG - Intergenic
1109758495 13:66794590-66794612 GAGATTGTTAAAGCCTTAGGTGG - Intronic
1113268677 13:108648237-108648259 GGGAATATTAAAGCCAGAGAAGG - Intronic
1115999599 14:39228788-39228810 GGGGATGTTACATCCTTTGTTGG + Intergenic
1120335402 14:83148485-83148507 GTGAGTGTTACAGCCTTTAAAGG + Intergenic
1121485208 14:94309576-94309598 GGGAAACTTACAGCCTTTGGGGG + Intronic
1129034885 15:72642917-72642939 GGGAATGGTGCAGCCTGAGTTGG + Intergenic
1129214997 15:74094299-74094321 GGGAATGGTGCAGCCTGAGTTGG - Intergenic
1129390371 15:75217300-75217322 GGGAATGGTGCAGCCTGAGTTGG + Intergenic
1129732141 15:77938661-77938683 GGGAATGGTGCAGCCTGAGTTGG - Intergenic
1130445615 15:83998610-83998632 GGGATTTGAACAGCCTTAGATGG + Intronic
1131888524 15:96947161-96947183 GGGAATATTATACCCTTATAAGG - Intergenic
1132739587 16:1404887-1404909 GGGTATTTTTCAGACTTAGAAGG + Intronic
1146747408 17:35344632-35344654 TGGAATGTTCCAGCCTTTGTTGG - Intergenic
1146748840 17:35358088-35358110 GGGAATGTTACATACTTTGAAGG - Intronic
1149597585 17:57873366-57873388 GGGAAGGTGACAGCCTAAGGAGG - Intronic
1151879609 17:76887227-76887249 GGCACTGATACAGCCTGAGATGG - Intronic
1152274115 17:79344341-79344363 GGGAATGGTAGAGCCTTCCAAGG - Intronic
1152502373 17:80721015-80721037 GGGACTGTTTCTGCCCTAGACGG - Intronic
1158536968 18:58316857-58316879 GCGAATGTTTCTGCCTTACAAGG + Intronic
1163447917 19:17358376-17358398 GGGTCTGTTGCAGCCTCAGAGGG - Intronic
1164720924 19:30431106-30431128 GGGAGTGTTCCTGCCATAGATGG - Intronic
1166493986 19:43284821-43284843 GTGTATGTTACAGCCTTTGTAGG + Intergenic
1168629423 19:57945531-57945553 GAAAACGATACAGCCTTAGATGG - Intronic
926239729 2:11075754-11075776 GGCAATCTCACAGCCTAAGATGG - Intergenic
929608367 2:43251057-43251079 GGAAAGGTTGCAGCCTGAGAGGG + Intronic
930164970 2:48195759-48195781 AGGAAAGTTCCATCCTTAGAAGG + Intergenic
932569203 2:72929058-72929080 TGGAATGTTCTGGCCTTAGAGGG + Intronic
932868807 2:75375482-75375504 GGAAATGTTACAGTCAGAGAGGG + Intergenic
936922626 2:117704816-117704838 GTGAATGTTACAGCTTTTAAAGG + Intergenic
940347828 2:152645853-152645875 GGTAACATTACAGCCTTTGAAGG + Intronic
940701473 2:157049387-157049409 GAGAATGTTACATGCTTGGAAGG + Intergenic
941612999 2:167684342-167684364 GGTAATGTTTCAGGCTTGGAGGG - Intergenic
943489837 2:188537274-188537296 GGGAATGTTCCAGCTTTTGCCGG + Intronic
944641945 2:201736471-201736493 GGGAAATTTATAGCCTTAAATGG + Intronic
946236144 2:218325553-218325575 GGGAATTTTACAGCCTTATCTGG + Intronic
1172487865 20:35309721-35309743 GGGATTGTTTCAGCTTTGGAGGG + Intronic
1172935020 20:38613943-38613965 GGGAAAGTTGTAGCCATAGAGGG + Intronic
1177946620 21:27478820-27478842 GGGAATGTTATATCCTCACATGG + Intergenic
1179157607 21:38863592-38863614 TGCCATGTTACAACCTTAGAAGG - Intergenic
1181964219 22:26645375-26645397 GTGAGTGCTACAGCCTTAGGTGG - Intergenic
949500180 3:4672799-4672821 GGGAATGCTAAGGCCTAAGATGG - Intronic
951530389 3:23693346-23693368 GGGAATGTTACATTCTTAACAGG - Intergenic
951810696 3:26695890-26695912 GGGAAGGTAACAGCCTGAGGAGG - Intronic
953711621 3:45276157-45276179 AGAAATGTGACAGCCATAGAAGG + Intergenic
955160287 3:56458756-56458778 GGGAATGTTACAGCCTTAGAAGG + Intronic
956290620 3:67655832-67655854 GTGAGTGTTACAGCCCTCGAAGG - Intergenic
957278228 3:78116316-78116338 AGGAATACTACAGTCTTAGAAGG + Intergenic
960266815 3:115629498-115629520 GGGAATATTTCAGGCTGAGAGGG - Intronic
961709043 3:128812832-128812854 AGGAATGTTACAGGCTGAGAGGG + Intronic
965120519 3:164548796-164548818 AATAATGTTACATCCTTAGAGGG - Intergenic
973211480 4:47619910-47619932 TGGAATGTTATTGCTTTAGAAGG - Intronic
974241003 4:59246817-59246839 GTGAATGTAAGAGTCTTAGAAGG + Intergenic
977757927 4:100695633-100695655 GGGAAATCTACAGACTTAGATGG - Intronic
977790985 4:101102629-101102651 CAGAATGTTAGAGCTTTAGATGG - Intronic
981173621 4:141654245-141654267 GGGGATGTTACAGCTCTGGAAGG + Intronic
981583248 4:146271911-146271933 GAGAAGGTTTCAGCCTTAAAGGG - Intronic
987567369 5:19609159-19609181 GGGAATTTTATATCTTTAGATGG + Intronic
992468854 5:77033908-77033930 GGGAAGGTGACGGCCTGAGAGGG - Intronic
995611939 5:113920118-113920140 GGGAATGTAGCATCCTGAGATGG - Intergenic
997907403 5:137832258-137832280 GGGAATGTTTCAGAACTAGATGG + Intergenic
998921143 5:147069719-147069741 GGGAATGCTACATTATTAGATGG - Intronic
999145820 5:149392872-149392894 GTGGTTGTTTCAGCCTTAGAGGG - Intronic
1000101140 5:158017778-158017800 AGGAATGTTAACGTCTTAGAAGG + Intergenic
1002135983 5:177107885-177107907 GGGACTGTTACTGCCCTTGAGGG + Intergenic
1006699314 6:35958919-35958941 GGGAATTTTACAGCATTTGGAGG - Intronic
1008581182 6:52908777-52908799 GGGAATATAACAGCTTAAGAGGG + Intronic
1010443564 6:75926613-75926635 GAGAATGTTAAGGCCTGAGAAGG + Intronic
1011833095 6:91397321-91397343 GAGATTCTTAAAGCCTTAGAAGG + Intergenic
1015199412 6:130562298-130562320 GGGAATGTAACAGCTTGAAAAGG + Intergenic
1023350619 7:39316991-39317013 GGGATTGTCTCAGCCTGAGAGGG + Intronic
1023930290 7:44701187-44701209 GGCCATGTCACAGCCTTACATGG + Intronic
1034714253 7:153225124-153225146 GGAAAAGTTACAGTCTTACAAGG + Intergenic
1035712551 8:1729718-1729740 GGGAATGGCACAGCCCTGGACGG - Intergenic
1039049241 8:33478144-33478166 GGGCAAGATACAGACTTAGAAGG + Intronic
1040301665 8:46191200-46191222 AGGAATGTTACAGCCTTCCTGGG - Intergenic
1040303907 8:46202299-46202321 GGGAATGTTGGAGCCTCACAAGG + Intergenic
1040596555 8:48843069-48843091 GGGAATGTTTCAGCCATATGTGG - Intergenic
1041911270 8:63091038-63091060 GGGAATCTTATTGCCCTAGAAGG + Intergenic
1043653090 8:82624062-82624084 GGGAAAGTTAAAGACTTATAAGG + Intergenic
1052143165 9:25013839-25013861 GGGAAACTTATAGCATTAGATGG + Intergenic
1052580608 9:30349720-30349742 GGGGATTTTATGGCCTTAGAAGG + Intergenic
1061716222 9:132520056-132520078 GGGAATGGTACAGGATTTGAGGG - Intronic
1062699054 9:137889740-137889762 GGGGATGTAACAGCCTGAGAAGG + Intronic
1186011317 X:5137269-5137291 GGGATATTTACAGCCTTACAGGG + Intergenic
1186653704 X:11589926-11589948 GGTAATTATACAGCCTTTGATGG + Intronic
1187941319 X:24385297-24385319 GGAAATCATACAGCCTCAGAGGG - Intergenic
1192154126 X:68730984-68731006 GGGAATGATACTACCTTATAAGG + Intergenic
1192827328 X:74711323-74711345 GGGAATGAGACAACTTTAGAAGG + Intergenic
1194862118 X:99012643-99012665 TGGAATGTTAAAGTTTTAGAGGG - Intergenic
1197493411 X:127147661-127147683 GAGAATGGTACACCCTTAGAAGG - Intergenic
1200436151 Y:3154203-3154225 GGGAATGACACAGGCTTGGATGG - Intergenic
1200855272 Y:7931198-7931220 GGTAATGTTACATCCTTACTTGG - Intergenic