ID: 955172115

View in Genome Browser
Species Human (GRCh38)
Location 3:56576788-56576810
Sequence GGATTAATACACATACACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 164}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955172115_955172116 -7 Left 955172115 3:56576788-56576810 CCATGGTGTATGTGTATTAATCC 0: 1
1: 0
2: 0
3: 16
4: 164
Right 955172116 3:56576804-56576826 TTAATCCAGTCTATCATTGATGG 0: 3914
1: 19487
2: 11603
3: 6325
4: 4628
955172115_955172120 6 Left 955172115 3:56576788-56576810 CCATGGTGTATGTGTATTAATCC 0: 1
1: 0
2: 0
3: 16
4: 164
Right 955172120 3:56576817-56576839 TCATTGATGGACATTTGGGTTGG 0: 3748
1: 17146
2: 9895
3: 4849
4: 2509
955172115_955172118 1 Left 955172115 3:56576788-56576810 CCATGGTGTATGTGTATTAATCC 0: 1
1: 0
2: 0
3: 16
4: 164
Right 955172118 3:56576812-56576834 GTCTATCATTGATGGACATTTGG 0: 3920
1: 18528
2: 9502
3: 3654
4: 2041
955172115_955172119 2 Left 955172115 3:56576788-56576810 CCATGGTGTATGTGTATTAATCC 0: 1
1: 0
2: 0
3: 16
4: 164
Right 955172119 3:56576813-56576835 TCTATCATTGATGGACATTTGGG 0: 4050
1: 18655
2: 10817
3: 6018
4: 6260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955172115 Original CRISPR GGATTAATACACATACACCA TGG (reversed) Intronic
900839859 1:5039738-5039760 GGATTAAATGACATACCCCATGG + Intergenic
901883821 1:12209130-12209152 GGATCAACACACACACACAAGGG - Exonic
909816823 1:80004704-80004726 AAATTAACACATATACACCAAGG - Intergenic
910557495 1:88551971-88551993 GAACTAATATACATACATCAGGG + Intergenic
910616990 1:89209264-89209286 GGATTGTTACAGAAACACCAGGG + Intergenic
912660542 1:111525511-111525533 AGATTAAAAATCATACACCATGG - Intronic
917279362 1:173366263-173366285 GTATTAATACATATCCACAATGG + Intergenic
923279212 1:232425961-232425983 GGATCAAGGCAAATACACCAGGG + Intronic
1063172355 10:3520296-3520318 GAATTAATACAAATACATGAAGG - Intergenic
1068371520 10:56122790-56122812 GGATTAATTGATAAACACCAAGG + Intergenic
1071316051 10:84399390-84399412 TGGGAAATACACATACACCATGG - Intronic
1071474777 10:86016772-86016794 GGAATAATACACATAAAAGAGGG - Intronic
1073276210 10:102313816-102313838 GCATTAATACAGATACACAGAGG - Intronic
1075225289 10:120623754-120623776 GGAAAAATACAGATACACCTTGG - Intergenic
1075867868 10:125742561-125742583 GGAGTAGTAAAAATACACCAAGG - Intronic
1081259292 11:40938759-40938781 GGATGAAGACACAGACATCAAGG - Intronic
1083248425 11:61448576-61448598 GAATTAATAAACATATAGCAAGG + Intronic
1085223210 11:74894043-74894065 GGTGTGATACATATACACCATGG + Intronic
1087376409 11:97347650-97347672 AAATTGGTACACATACACCAGGG + Intergenic
1088523222 11:110722300-110722322 GTATTAACACATATACACCATGG - Intergenic
1090755528 11:129786657-129786679 TGTTTAACACACACACACCAAGG + Intergenic
1092361406 12:7839761-7839783 GGAGTAATACCCATACAGAAGGG + Intronic
1094274388 12:28654646-28654668 GGAACAACACACACACACCAGGG - Intergenic
1094441367 12:30480737-30480759 GAATTACTTAACATACACCAGGG + Intergenic
1096740335 12:53688950-53688972 GAATGAATACACAGAAACCATGG - Intergenic
1097649983 12:62285630-62285652 GGATACACACACACACACCATGG - Intronic
1098245809 12:68516610-68516632 TGATAAAAACACGTACACCATGG + Intergenic
1098970689 12:76852730-76852752 ATATTAAAACACATACACTAAGG - Exonic
1101077203 12:101143029-101143051 ATATACATACACATACACCATGG + Intergenic
1101262114 12:103044000-103044022 GGATTTTTACACATACACGGAGG + Intergenic
1102023907 12:109702378-109702400 GGATTAAGTGACATAGACCAGGG + Intergenic
1102791525 12:115650329-115650351 GATTTAATACACATGCACCCAGG + Intergenic
1104096595 12:125563765-125563787 GGCTTAAGACACACACACAAAGG + Intronic
1105731193 13:23218745-23218767 GTATTAATACAAATAGACCAAGG + Intronic
1106701191 13:32230526-32230548 GGATAAAGAAATATACACCACGG - Intronic
1110156099 13:72318676-72318698 GCATTAATTCATATACGCCACGG + Intergenic
1111200564 13:84929892-84929914 AGAACAATACACACACACCAGGG + Intergenic
1111218166 13:85171713-85171735 GTATTAATACATATACACAATGG - Intergenic
1111439819 13:88266453-88266475 GCATACATACAAATACACCATGG - Intergenic
1112071739 13:95859940-95859962 GGATGAATACATATACATCATGG + Intronic
1112598099 13:100828355-100828377 GGATCATGACACACACACCAGGG + Intergenic
1120931200 14:89850277-89850299 GGATTAATATTAATACTCCATGG - Intronic
1122501150 14:102200611-102200633 GGATTTTTACACAGACAACAAGG - Intronic
1123154212 14:106208866-106208888 GGATTTATAGGCATACAGCAGGG + Intergenic
1202920024 14_KI270723v1_random:22702-22724 AAAATAATACACATACACCTAGG - Intergenic
1202924896 14_KI270724v1_random:14936-14958 AAAATAATACACATACACCTAGG + Intergenic
1125283159 15:38064922-38064944 AGATTTAAACACATACACCTAGG + Intergenic
1126254292 15:46607151-46607173 TGATTAAAATACATATACCAAGG + Intergenic
1127577994 15:60311414-60311436 GGTGCAATACATATACACCATGG + Intergenic
1130378761 15:83354269-83354291 GTCATAATACATATACACCATGG - Intergenic
1131692678 15:94844541-94844563 TGCTTAATATACATACACGAGGG - Intergenic
1133518347 16:6531772-6531794 GGGTTGATACTCATACACGAAGG - Intronic
1133983617 16:10651629-10651651 GGATGGATAAATATACACCATGG + Intronic
1137739595 16:50754840-50754862 GTATATATATACATACACCATGG - Intronic
1140654627 16:77126905-77126927 GGACAAATACACATACACGGAGG - Intergenic
1142106001 16:88303096-88303118 GGATTAACAGACAGACACCAGGG - Intergenic
1150113767 17:62526221-62526243 GGAGGAAAACACATACACCAAGG + Intronic
1150867441 17:68868250-68868272 TGTTTTATACACATATACCATGG + Intronic
1153077893 18:1186592-1186614 AGATAAATACACATACAGCAAGG + Intergenic
1153411947 18:4803196-4803218 GGATTTATACAGATACAGGATGG + Intergenic
1153981209 18:10312282-10312304 AGATTAACACACATTCCCCAGGG + Intergenic
1154092883 18:11381362-11381384 GGACTAATACACATACCTCCTGG - Intergenic
1156576838 18:38327054-38327076 TGATTAATACACATACTCATTGG - Intergenic
1157117486 18:44875645-44875667 GGCTCAATACACATATACCAAGG + Intronic
1157142562 18:45124636-45124658 AGATAAATAGACATAAACCAGGG + Intergenic
1160068919 18:75607437-75607459 AGATTAAAACACATTTACCAAGG - Intergenic
1163068221 19:14815362-14815384 TGTTTCATACACATGCACCAGGG + Intronic
1166929366 19:46292505-46292527 GTATTGATACACATATATCATGG - Intergenic
926527294 2:13996552-13996574 ATATATATACACATACACCATGG + Intergenic
927296473 2:21460313-21460335 TGATTAATACTGATACTCCAAGG - Intergenic
927333488 2:21893122-21893144 GGAAATGTACACATACACCATGG - Intergenic
929373105 2:41250630-41250652 GGATTACGACATATATACCATGG + Intergenic
929800550 2:45096881-45096903 GGATAAATACAGACACATCATGG + Intergenic
931989728 2:67777896-67777918 GGATTCTTACTCCTACACCAGGG - Intergenic
932197888 2:69799962-69799984 GGATTAAAACAGATAACCCATGG - Intronic
932979527 2:76647698-76647720 GGATTAACAGACGTACTCCATGG + Intergenic
936063319 2:109312068-109312090 CCATAAAAACACATACACCAAGG - Intronic
936260133 2:110952295-110952317 GCATAAATACCCATACAACAGGG - Intronic
936458236 2:112691990-112692012 CGAGTAATACACATGCACCAGGG - Intergenic
939648308 2:144729626-144729648 GTAGTAGTACACATACACCATGG - Intergenic
940583512 2:155612696-155612718 GAATGAATACTCATACATCAGGG + Intergenic
941394986 2:164963139-164963161 GGATTAATACACCTCCAGCTGGG + Intergenic
942165031 2:173233312-173233334 GGATTAAAACACATACATGGTGG - Intronic
942781746 2:179651751-179651773 GGTTTAGTACTCAGACACCAAGG - Intronic
944034718 2:195280572-195280594 GGTGTAGTACATATACACCATGG + Intergenic
1170603273 20:17858053-17858075 GGAGTAAGACAGATACACAATGG + Intergenic
1171783959 20:29446597-29446619 AAAATAATACACATACACCTAGG - Intergenic
1174089901 20:48038535-48038557 TGATTAAAACCCACACACCAAGG + Intergenic
1177764846 21:25445814-25445836 GATGTAGTACACATACACCATGG + Intergenic
1178004600 21:28203939-28203961 TGATTTATACATATACACCATGG + Intergenic
1185090479 22:48766449-48766471 GTATGTATACACACACACCAGGG - Intronic
949151379 3:772088-772110 AGATTAAGACACAAACACGAAGG + Intergenic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
952166737 3:30757966-30757988 GGATTAATGAATAAACACCATGG - Intronic
952182492 3:30932914-30932936 GGATTGGCACATATACACCATGG - Intergenic
953746962 3:45582461-45582483 GGATTTCTTCACAGACACCAAGG - Intronic
953834761 3:46332882-46332904 AGGTTATTACACATAAACCATGG + Intergenic
954205037 3:49052448-49052470 GGATTAAGACACAGGCTCCAGGG + Intronic
955172115 3:56576788-56576810 GGATTAATACACATACACCATGG - Intronic
957081562 3:75640361-75640383 AAAATAATACACATACACCTAGG + Intergenic
960100203 3:113734085-113734107 AGATTTCCACACATACACCATGG + Intronic
962815756 3:138997074-138997096 AGATTAATACACAAAAAGCAAGG - Intergenic
963660416 3:148119814-148119836 GGATGAATACCCATTCTCCATGG - Intergenic
964088710 3:152848186-152848208 AGTGTGATACACATACACCATGG - Intergenic
967521360 3:190436468-190436490 GGATTCATACGCCCACACCAAGG - Intronic
971554530 4:27996806-27996828 GGATAAAGATATATACACCATGG - Intergenic
972328630 4:38042553-38042575 AAATTAAAACACATATACCAAGG - Intronic
973302140 4:48598339-48598361 GGATGAATACCCATTCTCCATGG + Intronic
973349181 4:49090933-49090955 AGCTTAATACACACACAGCAAGG - Intergenic
973807929 4:54543514-54543536 GGATTAAAACACATAAATAAAGG - Intergenic
974015434 4:56644658-56644680 GCATAAATACACATGCAACAGGG - Intergenic
979968975 4:127111465-127111487 GTATTAATATATATACACCATGG + Intergenic
984781410 4:183529592-183529614 GGACTAATGCAGATACACAAAGG - Intergenic
987629643 5:20452390-20452412 GGATAAAAACATACACACCATGG + Intronic
987912832 5:24170692-24170714 GGAGTAATATTCATACAGCATGG + Intronic
987966597 5:24885350-24885372 GCATTAATAAACATACAACTAGG - Intergenic
988236272 5:28550007-28550029 GGACTAATCCACATACAATATGG - Intergenic
989267435 5:39493244-39493266 GGTTTAATAAACATAAAACAAGG + Intergenic
989470618 5:41813410-41813432 GGGTCAATTCACATACACAAAGG + Intronic
991229398 5:64313514-64313536 GGAAATGTACACATACACCATGG - Intronic
992142134 5:73809063-73809085 GGATTACAAAACATGCACCATGG - Intronic
995553747 5:113306061-113306083 CCATTAATACATATACAACATGG - Intronic
995747903 5:115423215-115423237 GGATTAATAGAGATTCCCCAGGG + Intergenic
996025776 5:118644271-118644293 GGATATATATACACACACCATGG + Intergenic
997206151 5:132051388-132051410 GGATGCATACACATGCCCCATGG - Intergenic
999370918 5:151054824-151054846 GGATCAATACACCTCCACCCAGG + Intronic
999663290 5:153887964-153887986 GGATGAATCCATATAAACCAAGG + Intergenic
1001324409 5:170711287-170711309 GGAGGCATACACATAGACCATGG - Intronic
1003384566 6:5655278-5655300 GGATTACTGCTCAAACACCAAGG - Intronic
1008618967 6:53253200-53253222 AGATATATATACATACACCATGG - Intergenic
1013553774 6:111236019-111236041 GTATATATATACATACACCATGG + Intergenic
1014680752 6:124427032-124427054 GGACTAATACACATACACTCTGG + Intronic
1015060298 6:128956321-128956343 GAATAAATAGACATACCCCAGGG - Intronic
1017998471 6:159556156-159556178 GGATGAATACAGCTACATCATGG + Intergenic
1021280340 7:18709213-18709235 GGAACAATACACACACACCAGGG - Intronic
1021834278 7:24652632-24652654 GGAATAATAGGCATAAACCAGGG + Intronic
1022223209 7:28335049-28335071 GCATAAAGACACATAGACCAAGG - Intronic
1022629091 7:32068779-32068801 GGATTCATATCCATACACCCAGG - Intronic
1022966143 7:35474166-35474188 GGACTAATACACATATACACAGG + Intergenic
1027462710 7:78475287-78475309 GAATGCAAACACATACACCATGG + Intronic
1027935699 7:84599580-84599602 GGATAGATACATATACACAAAGG + Intergenic
1029684699 7:102138864-102138886 GGATTTACACACATAGACAAAGG + Intronic
1030326543 7:108225432-108225454 TCATTATTACACATACATCATGG + Intronic
1030574681 7:111271338-111271360 GGATTAATATACACACCCAATGG + Intronic
1030792059 7:113742118-113742140 GGACTAATACACATACATTTGGG + Intergenic
1031390662 7:121210437-121210459 AGTATAATACACATACACAATGG + Intronic
1031594601 7:123634409-123634431 AGTTTGATACATATACACCATGG - Intronic
1032043471 7:128581980-128582002 GGAGGAAAACACATACACCAAGG + Intergenic
1032061367 7:128727974-128727996 CAATTAATACCCATATACCATGG + Intronic
1033014150 7:137654653-137654675 GGATTCATAGATATTCACCAGGG - Intronic
1033178991 7:139156029-139156051 CTATTAATAGACATACAACATGG - Intronic
1035256366 7:157630996-157631018 GCATTAATTCACATCCATCAGGG - Intronic
1037256159 8:16957223-16957245 GGACTAACCCACATACACTATGG - Intergenic
1040101158 8:43507149-43507171 GGAAAATTTCACATACACCATGG + Intergenic
1042885090 8:73540252-73540274 AGAAGAATACACATACACAAAGG + Intronic
1043360069 8:79461714-79461736 GTAATAATCCCCATACACCAAGG + Intergenic
1044349581 8:91148067-91148089 AAATTGGTACACATACACCATGG - Intronic
1044787778 8:95813662-95813684 ATATATATACACATACACCATGG - Intergenic
1044856188 8:96478296-96478318 GGTACAATACATATACACCATGG + Intergenic
1047541434 8:125770311-125770333 TTATTAATACCCATAAACCAAGG - Intergenic
1049127354 8:140804057-140804079 GGATTAATCCCCATGCACCCTGG + Intronic
1049251673 8:141592539-141592561 GGAACAACACACATACACCCAGG - Intergenic
1051811541 9:21055024-21055046 GGATCAATAGTCATACAACAGGG + Intergenic
1056658851 9:88530169-88530191 GGATTAAGTCACACACCCCATGG + Intergenic
1056964249 9:91152838-91152860 GAAATAATACACATACAGCCTGG - Intergenic
1057356747 9:94338264-94338286 GGTCTAAAACAAATACACCAAGG - Intergenic
1057651006 9:96919380-96919402 GGTCTAAAACAAATACACCAAGG + Intronic
1058195911 9:101975538-101975560 AGATGAATACACATAAAGCAAGG - Intergenic
1058348600 9:103994571-103994593 GTATATATATACATACACCATGG + Intergenic
1059607563 9:115851042-115851064 GGGTAAATACACACCCACCAAGG + Intergenic
1062154858 9:135041574-135041596 GAAGTAATACACACACACTATGG + Intergenic
1185749938 X:2602851-2602873 GAAATAGTACATATACACCATGG + Intergenic
1185886308 X:3786444-3786466 GGACTAATACACACACCCAAAGG - Intergenic
1186171461 X:6881699-6881721 GGATTAATATACTTAAACCCAGG - Intergenic
1187683751 X:21795625-21795647 TGGTAAATACATATACACCATGG - Intergenic
1192074594 X:67980071-67980093 GCATGAAAAAACATACACCATGG - Intergenic
1193267438 X:79488780-79488802 AGTGTAATACATATACACCATGG - Intergenic
1196576145 X:117321402-117321424 GTATTAATACATATACACAATGG - Intergenic
1198930881 X:141858675-141858697 AGATACATACACACACACCATGG + Intronic
1199107584 X:143889004-143889026 GTATATATACACATACATCATGG - Intergenic
1199780833 X:151057796-151057818 GAATTAAGATATATACACCATGG - Intergenic