ID: 955181263

View in Genome Browser
Species Human (GRCh38)
Location 3:56672753-56672775
Sequence AATTAAATGCCTAAATTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 5, 3: 22, 4: 295}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955181263 Original CRISPR AATTAAATGCCTAAATTGGA AGG (reversed) Intronic
901984361 1:13062423-13062445 AATTAAAAGCAAAAATTGCAGGG - Intronic
901997449 1:13164347-13164369 AATTAAAAGCAAAAATTGCAGGG + Intergenic
902353405 1:15876908-15876930 AATTAAATGATCAAAGTGGAAGG + Intronic
902997873 1:20241289-20241311 AATTAAATAACTAAATAAGATGG - Intergenic
907873105 1:58460768-58460790 ATTTAAATATCTAAATTGAAAGG - Intronic
909700453 1:78515458-78515480 AATGAAATGCCAAAATTACATGG + Intronic
909899167 1:81110828-81110850 AAATAAATGCCAAAATGGAATGG + Intergenic
911076651 1:93882072-93882094 AATTAAATCCTTAAACTGAAAGG + Intergenic
911304746 1:96219680-96219702 AATGAAATGGCTATATTGTATGG - Intergenic
911842789 1:102705360-102705382 TATTAACTGACTTAATTGGAAGG + Intergenic
912083704 1:105973512-105973534 AATTAAATGCTAAATCTGGAAGG - Intergenic
912769487 1:112450469-112450491 AGTTAGTTGCCTAAATTGGGTGG + Intronic
913449147 1:118980735-118980757 AATTAAATGCCAAATTTAGTTGG + Intronic
913510828 1:119560103-119560125 AAATAAAGGCCTAAATTTAAGGG + Intergenic
913515051 1:119597508-119597530 AAATAAAGGCCTAAATTTAAGGG + Intergenic
916353644 1:163880104-163880126 AATTCAATGCCAGAATTGAAGGG - Intergenic
917191069 1:172419714-172419736 AATCAAATGCCTGGACTGGAGGG - Intronic
918033572 1:180842567-180842589 CATTACATGGCTAAATTTGAAGG + Intronic
918865605 1:189894923-189894945 AATCAAATGCCTATTTTGAAGGG + Intergenic
919230253 1:194764348-194764370 AATTGAATCCCTAAGTTGCAGGG - Intergenic
919430124 1:197482177-197482199 AATTAAATTCTTTAGTTGGATGG - Intergenic
919783725 1:201241736-201241758 AATTAAAGACCTAAATGTGAAGG - Intergenic
921344568 1:214168980-214169002 ATTTGAATGCCTAAATTCTAGGG + Intergenic
922922086 1:229314129-229314151 AGGGAAAGGCCTAAATTGGAAGG - Intergenic
923442127 1:234030598-234030620 GATTAAATACCTAACTTAGAGGG + Intronic
923734772 1:236595210-236595232 CATTAAATACCTAAATGAGAAGG + Intronic
924475170 1:244376676-244376698 AATTAAATGGATAAATCGTATGG - Intronic
924737934 1:246776001-246776023 CATCAAATGTCTAAATTGGATGG + Intergenic
1064485123 10:15779597-15779619 AATTCAATACTTAAATTAGAAGG - Intronic
1066221141 10:33336599-33336621 AGTTAAATGCCTAAGTTGAGCGG + Intergenic
1067231613 10:44415958-44415980 AAGTAAATCTCTAAATAGGAAGG - Intergenic
1067381824 10:45781211-45781233 AATTAAAGACCTAAAATTGATGG + Intronic
1067889523 10:50121851-50121873 AATTAAAGACCTAAAATTGATGG + Intronic
1068273203 10:54756903-54756925 AATGAAATTCCTAAGTAGGAGGG + Intronic
1068458829 10:57298948-57298970 AACAAAATGCATAAATTGGAAGG - Intergenic
1068783740 10:60946872-60946894 AGTTGAATGCCTAAATCTGAGGG + Intronic
1068860107 10:61839372-61839394 AAAAAAATGCCCAAACTGGAAGG + Intergenic
1069312770 10:67059406-67059428 AATTAATTGCAAAAATTGGAGGG + Intronic
1069482683 10:68797977-68797999 AATTAAATGACAAATTTGGCTGG - Intergenic
1070405714 10:76092868-76092890 AAAAAAATGCATAAATTGAAAGG - Intronic
1071795594 10:89001908-89001930 AATTCAGTGCCCAAACTGGAGGG + Intronic
1072302361 10:94073605-94073627 ACTTAAAACCCTAAAGTGGAAGG - Intronic
1073337514 10:102720921-102720943 AATTAAATTCCTCAATTGTTTGG + Intronic
1073457182 10:103644693-103644715 AACTTACTGCCTAAACTGGATGG + Intronic
1075826011 10:125357535-125357557 AAGTCAATGTCTTAATTGGATGG + Intergenic
1076937071 10:133572972-133572994 AATTCAATGCATGAATTTGAGGG - Intergenic
1079063198 11:17267492-17267514 AATTAAATGCAGAAATTAGCCGG - Intronic
1084444078 11:69193339-69193361 AATTAAATGCCCCATTTGGCTGG - Intergenic
1085550153 11:77362168-77362190 AAGCAAATGCCCAAATTGCAAGG - Intronic
1086178780 11:83924428-83924450 AATTAAAGGGTTAAAATGGAAGG + Intronic
1087992442 11:104761818-104761840 AATTAAAGTCCAAGATTGGATGG + Intergenic
1089677647 11:120100486-120100508 ATTTAAATGCGTGAATTGTATGG - Intergenic
1090937518 11:131357250-131357272 AATTAAATGAATAAGATGGATGG - Intergenic
1092705817 12:11283032-11283054 AATTATATGCTTAAATAAGATGG + Intergenic
1094243239 12:28253824-28253846 CATTAAATGCCTAAGGTAGAAGG - Intronic
1095441283 12:42240679-42240701 TTTTAAATGCCTCAACTGGATGG + Intronic
1095504180 12:42875370-42875392 AATCATATTCATAAATTGGAAGG - Intergenic
1095680555 12:44970468-44970490 AAGTAAATGCTTAAAGTGAAAGG + Intergenic
1095905817 12:47376981-47377003 AATTAACTACCAAAATGGGAAGG - Intergenic
1096301130 12:50428673-50428695 AATTAAATGAATAAAGTGCATGG + Intronic
1097515863 12:60605321-60605343 AAGAAAATGCCTGAATTTGATGG + Intergenic
1097563775 12:61240837-61240859 AATTTAAGGGCCAAATTGGAGGG - Intergenic
1098075782 12:66729213-66729235 CATTAAAGGCCTAAATTTGATGG + Intronic
1099175230 12:79413810-79413832 AATTGCATGCCTAAATAGTAAGG + Intronic
1099675192 12:85751561-85751583 AATTTAATAAGTAAATTGGAGGG + Intergenic
1099927032 12:89031079-89031101 AAGTATATGCCTAATTTGGGTGG - Intergenic
1099988683 12:89699436-89699458 AGTTAAAAGACAAAATTGGAAGG + Intronic
1100556898 12:95703600-95703622 AATTTATTTCCTAAATTTGAAGG + Intronic
1100983686 12:100185237-100185259 AATTGAATTCCTAAAATTGATGG - Intergenic
1101006256 12:100403914-100403936 AATTAGATGCTTAAATTTGGTGG + Intronic
1104223004 12:126803947-126803969 AATCAAATGCCTATATTTGGTGG + Intergenic
1106161254 13:27203220-27203242 AAATAAATGGATTAATTGGATGG + Intergenic
1106742287 13:32657531-32657553 CATTAAATGCCTCAATTAAAAGG - Intronic
1107024552 13:35786222-35786244 AATTAAATTACTAAATTTGTAGG - Intronic
1107575738 13:41719943-41719965 AAATAAATGCCAGAATTTGAGGG + Intronic
1107677532 13:42812342-42812364 CATTTAAGGACTAAATTGGAAGG + Intergenic
1107744063 13:43486438-43486460 GATTAAATGCCTAAACTAGTAGG + Intronic
1109059535 13:57596915-57596937 CATTAAATAACTAAATTGGTAGG - Intergenic
1110180266 13:72608834-72608856 TATTAAATGCCTAATTGAGAAGG - Intergenic
1111099582 13:83566208-83566230 AATTAAAAGCCAAAATTTGAGGG + Intergenic
1111682032 13:91455042-91455064 AATTAAATGGATAAAAGGGATGG - Intronic
1112449414 13:99495418-99495440 AATTTATTGCCTAAATTTAAAGG - Intergenic
1112936416 13:104805328-104805350 AATGAAAAGCCTAAAATGTAAGG + Intergenic
1113037466 13:106066451-106066473 AGTTAAATGGCTAGATTGTATGG - Intergenic
1114769368 14:25410959-25410981 AACTTAATGCCTACCTTGGAGGG + Intergenic
1115416794 14:33144701-33144723 AATTAAATGGGTAAATTAGCTGG - Intronic
1116202908 14:41822275-41822297 TAATAAATGCCTACATTGAAAGG - Intronic
1116905471 14:50399062-50399084 CATTAAATGCTTATATTAGAAGG - Intronic
1117078288 14:52126001-52126023 ATTTTAAAGCCTAAATTGCAGGG + Intergenic
1117938299 14:60933321-60933343 AACTAAATGCCAAAATTATACGG - Intronic
1118105575 14:62655517-62655539 AACTAAATGCCTTTTTTGGAGGG + Intergenic
1118827423 14:69397021-69397043 AATTAAAGGACTAATTTGAAAGG + Intronic
1119057494 14:71438030-71438052 AATTTAATGGCTAAAATGTAAGG - Intronic
1120683993 14:87516573-87516595 AATAATATGGCTAAATTGAAAGG - Intergenic
1125260385 15:37817721-37817743 AATTAAATTGCTATTTTGGAAGG + Intergenic
1126967126 15:54066876-54066898 AATTTAATGCCTAGATTCCAGGG + Intronic
1128774652 15:70310688-70310710 AATTATATGACTGTATTGGAAGG - Intergenic
1128957826 15:71967474-71967496 AATTAAATGCCTGAAATAGCAGG + Intronic
1129555058 15:76499388-76499410 AATCAAATGCCAAAATCAGATGG + Intronic
1129782243 15:78280180-78280202 TATTAAATGCCTTAATTGGAAGG + Intronic
1131976255 15:97948660-97948682 AATTCAATGACTAAATGAGAAGG + Intergenic
1132835724 16:1952267-1952289 AATTAAAAGGCTAATTTGGGCGG - Intronic
1133605042 16:7378661-7378683 AAATAAAAGCCTACATTGGGAGG - Intronic
1133730800 16:8576998-8577020 AATTTACTGCCTCAAATGGAAGG - Intronic
1136939332 16:34506946-34506968 AAGTAATGGGCTAAATTGGAAGG - Intergenic
1138814207 16:60185675-60185697 AAATAAATGAATAAAATGGAGGG + Intergenic
1139709588 16:68765596-68765618 AATGAAATCCCAAAATTGTAGGG + Intronic
1140504354 16:75461348-75461370 ATCTAAATGACTAAATTGGCCGG - Intronic
1141263168 16:82472039-82472061 CTTTAAATGCTTAAATTGTATGG - Intergenic
1143133393 17:4695335-4695357 AATAAAATGGCTAAATTGTATGG + Intronic
1143359894 17:6360814-6360836 AATGAAAGGTCTAAAATGGAAGG + Intergenic
1145925076 17:28640789-28640811 AAGCAAATGCCTAAGCTGGATGG + Intronic
1146581586 17:34043364-34043386 AAACAAATGCCTTAAATGGAGGG + Intronic
1147478514 17:40736880-40736902 ATTAAAATGCCAAAATTGGCCGG - Intergenic
1149158403 17:53661885-53661907 AAGAAAATGTCTAAATTGGCCGG + Intergenic
1149575521 17:57709020-57709042 AATTAAATGGGTGAATTGTATGG - Intergenic
1150316466 17:64173431-64173453 AATTTAATACCTAACTTGGCTGG + Intronic
1153736819 18:8079272-8079294 AATTAAATGACTGAGGTGGAGGG - Intronic
1154014697 18:10605675-10605697 AATTAAAAGCCAAACTTGGCTGG - Intergenic
1156055072 18:32992815-32992837 AATTAAAAACGTAAATTAGATGG + Intronic
1156766167 18:40658435-40658457 AATAAAATGCTTAAATTTAAAGG + Intergenic
1156993985 18:43444405-43444427 AATTGGATGCCTAATGTGGATGG + Intergenic
1160339229 18:78072588-78072610 AATTAAATGCTCAACGTGGATGG - Intergenic
1164544263 19:29146042-29146064 AAATAAATACCTAGCTTGGAGGG + Intergenic
1165974347 19:39661575-39661597 AATTAAAGGCATGAATGGGAAGG - Intergenic
1166628636 19:44385061-44385083 AATTAAATGACAAATTTGGGGGG + Exonic
925496365 2:4454029-4454051 AGTTGAATGCCTAAATCTGAGGG + Intergenic
929216706 2:39421838-39421860 ATTTAAATGGATAAAGTGGAAGG - Intronic
932153574 2:69394761-69394783 AAATAAGTGGCTGAATTGGATGG - Intergenic
932296739 2:70630591-70630613 ATTTTAATGTATAAATTGGAAGG + Intronic
932507622 2:72251346-72251368 ACTTAAATGCCTTATCTGGAAGG + Intronic
933246409 2:79979560-79979582 AATAAAATACCAGAATTGGATGG + Intronic
935077526 2:99760072-99760094 TATTGAATGCTTAAATGGGAGGG - Intronic
935562483 2:104573581-104573603 AATAAAATGCCTAAATTATCTGG + Intergenic
935621899 2:105137231-105137253 AATTCAATGCCAAATTTGGTGGG + Intergenic
936387568 2:112043849-112043871 AGCTATATGCCTAAATTGGGAGG + Intergenic
936579806 2:113688621-113688643 CTTTAAATGCTTAAATTAGAAGG + Intergenic
937007416 2:118529979-118530001 AATGAAATGCCAAAATAGGAAGG - Intergenic
938159638 2:128973690-128973712 AATGAGATGCCTCAAGTGGAGGG + Intergenic
939326743 2:140700848-140700870 AATTTAATGCTTAACTTGGATGG - Intronic
939493944 2:142906487-142906509 AGTTATATACCTAAATTGGGAGG + Intronic
939599888 2:144175515-144175537 AATTTAGTGCCTTATTTGGAGGG - Intronic
939856113 2:147360515-147360537 AACAAAATCTCTAAATTGGATGG + Intergenic
939962373 2:148576513-148576535 AATCAAATGCCTAGGTGGGATGG + Intergenic
941293448 2:163704948-163704970 ATTTTAATGCTAAAATTGGATGG - Intronic
942565146 2:177258577-177258599 GATTAAATGGGTAAATTGTAAGG + Intronic
942589517 2:177527044-177527066 AATTAAAAGCCTAAAATGTCTGG + Intronic
942918429 2:181341565-181341587 AATTAAAAGCCTAAATGAAAAGG - Intergenic
943173940 2:184444062-184444084 AATTATATCCCTATGTTGGAAGG - Intergenic
943286756 2:186010953-186010975 AGTTAAATGCCTGAATTGAAAGG + Intergenic
943537070 2:189166121-189166143 ATTGAAATGCCTAAAATGTAAGG - Intronic
944153923 2:196591827-196591849 AATAAAAGGCCTAATCTGGATGG - Intronic
944398799 2:199301534-199301556 ATCTGAATGCCTAATTTGGAAGG - Intronic
945693412 2:213070990-213071012 AATTAAATGGCTAATGTTGAAGG - Intronic
945848088 2:214972353-214972375 AATTAAATGACAAAATTGGTTGG + Intronic
946746440 2:222850731-222850753 AAATAAATGGATAAATTGCAGGG + Intergenic
947275254 2:228384365-228384387 AATTAAATATCTAAATAGCAAGG - Intergenic
948265386 2:236632102-236632124 AATGAAATGCCCTGATTGGAAGG - Intergenic
948604179 2:239124165-239124187 ATTTAAAAGCGTGAATTGGATGG - Intronic
948959445 2:241321018-241321040 AATTATCTGCTTAAATTGGGTGG - Intronic
1169323062 20:4651276-4651298 ACTTAAATGCCTACATTGCCAGG + Intergenic
1169605842 20:7318204-7318226 AATAAAAGGCATACATTGGAAGG - Intergenic
1170212745 20:13861525-13861547 CTTTAAATGGGTAAATTGGATGG - Intronic
1171014333 20:21526128-21526150 CATTAAATGGGTAAATTGTATGG + Intergenic
1171181603 20:23094888-23094910 ATTTGAATGCCTAACTAGGAAGG - Intergenic
1172172490 20:32947726-32947748 CACTAAATGCCTATATTAGAAGG + Intronic
1172474031 20:35223994-35224016 AATGAACTGCCAAAGTTGGAAGG - Intergenic
1173240536 20:41292624-41292646 AATTACATTCCTAAACTGAAAGG - Intronic
1177031823 21:15989881-15989903 AATCAAATGCTTAATCTGGATGG - Intergenic
1177043426 21:16141274-16141296 CAAGAAATGCCTATATTGGAGGG - Intergenic
1177064800 21:16417079-16417101 AATACAATGCCTAAGTTGAAAGG - Intergenic
1177481684 21:21697792-21697814 AATTAAAAACCTACATTGGTGGG - Intergenic
1177990765 21:28033384-28033406 AATATAGTGCCTAAATTGGAAGG + Intergenic
1178412932 21:32380672-32380694 AATTAACTGCTTGAATTAGATGG - Intronic
1182035006 22:27191232-27191254 CATAAAATGCCTGAACTGGAAGG - Intergenic
1182157918 22:28093124-28093146 AATTTAATGTCAATATTGGAAGG - Intronic
1183876601 22:40787903-40787925 AAGTAAATGCATTAAATGGAAGG - Intronic
1184306152 22:43603593-43603615 AATTAAGTGCCTAAACTGAGCGG - Intronic
1184966755 22:47980644-47980666 AATAAAATGCCTACATAGGCCGG - Intergenic
1185135276 22:49067372-49067394 AATTAAATGCCTTCATCGGCAGG - Intergenic
1185359548 22:50397387-50397409 AATTAACTTCCTACAATGGAAGG - Intronic
951236504 3:20241857-20241879 AATTCAAAGCATGAATTGGAAGG + Intergenic
952006114 3:28844541-28844563 AATTAAGTGCTTAAATTTGAAGG - Intergenic
952257972 3:31711828-31711850 ATTTAAATGGATAAATTGTATGG + Intronic
952620016 3:35327133-35327155 AATGAAATGCCTAAATTTTGAGG + Intergenic
955181263 3:56672753-56672775 AATTAAATGCCTAAATTGGAAGG - Intronic
955569271 3:60286843-60286865 ATTTATATTCCCAAATTGGAGGG - Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956443654 3:69304721-69304743 AATTTACAGCCTAAAATGGATGG - Intronic
957740697 3:84264666-84264688 AATTAAATGGGTGAATTGTATGG - Intergenic
957813056 3:85253800-85253822 AATTAAATTGCTTAATTTGAGGG + Intronic
958554308 3:95654823-95654845 TATTGAAAGCTTAAATTGGAGGG - Intergenic
960203413 3:114866022-114866044 AATTAAATGCATAATTTTGGAGG + Intronic
960455737 3:117869298-117869320 AATTAAATGCATAAATATGTAGG + Intergenic
961586288 3:127929112-127929134 GATTAAATACTTAAATTAGAAGG + Intronic
962473956 3:135739727-135739749 ATTCAAATGCATAAAGTGGAGGG - Intergenic
963524499 3:146400011-146400033 AATTAGATGGCAAAATTAGATGG + Intronic
963961169 3:151310809-151310831 AATTATATGAGTACATTGGAAGG + Intronic
964804600 3:160594513-160594535 AATTAGATGGACAAATTGGATGG + Intergenic
965006907 3:163039095-163039117 ATTTAAATGTCTCAATTTGATGG - Intergenic
965222370 3:165943003-165943025 AATTAAATGCATATATTTTATGG + Intergenic
965963238 3:174453932-174453954 AACTAAATGCCTCAATTAAAAGG + Intronic
967617842 3:191594348-191594370 TTTAAAATGACTAAATTGGAAGG - Intergenic
967672604 3:192256172-192256194 AAGTAAATGACTAATTTGCATGG - Intronic
968185366 3:196629975-196629997 CATTAAATGCGTAAATTATATGG - Intergenic
969923986 4:10568481-10568503 CATAAAATGCGTAAATTGAATGG + Intronic
970763969 4:19524625-19524647 AATTAAATGTCTAAATGAAATGG - Intergenic
973154555 4:46934533-46934555 AATTAAATGCCAACATTGGGAGG - Intronic
975618547 4:76272384-76272406 ATTTAAGTTCCTAAGTTGGAGGG + Intronic
975698231 4:77035777-77035799 TACTAAATGCCTAATTTGTATGG + Exonic
975840879 4:78472468-78472490 AATAAAATTCTTAAGTTGGATGG - Intronic
975869636 4:78765783-78765805 CTATAAATGCCTAAAGTGGATGG + Intergenic
975922135 4:79404387-79404409 AACTAAATGCCTGTATTAGAAGG - Intergenic
976533282 4:86181141-86181163 AATTAAATTTTTAAATGGGATGG + Intronic
978136969 4:105274551-105274573 AAGTAAATTCCTAAATGGGAAGG - Intronic
978295849 4:107204119-107204141 AATTAAATGCCCAATTTGGGGGG - Intronic
978333079 4:107636248-107636270 AATTAAATTCCTAAACAGCAGGG + Intronic
978461086 4:108953035-108953057 AAGTAGATGCCTATAATGGATGG + Intronic
978612051 4:110552742-110552764 AATTAAATGACTAAATGGATAGG - Intronic
978750777 4:112244550-112244572 GACTAAATACCTATATTGGAGGG + Intronic
979266513 4:118709486-118709508 AAATAAAGGCTTAAATTTGAGGG + Intronic
979504818 4:121484342-121484364 AATTCAAAGCATAAATTGCAAGG - Intergenic
979940006 4:126750644-126750666 AATTAAATGCTTAAAATTTAGGG + Intergenic
980875201 4:138655157-138655179 AATGAAATGCCTAAATTAGAGGG - Intergenic
981581806 4:146256850-146256872 ATTTTAATGCCCAAATTTGATGG + Intronic
981849123 4:149207399-149207421 ATTTAAATGGGTAAATTGCATGG + Intergenic
982604880 4:157502389-157502411 AATGAAATACCTGAATTGAAAGG - Intergenic
983621593 4:169767218-169767240 AATTAAACACATAACTTGGAAGG - Intergenic
984033394 4:174634006-174634028 AATTAATCACCTAAGTTGGAAGG + Intergenic
984381864 4:179003518-179003540 AATTTAATGTTTAAATTTGAAGG + Intergenic
987658134 5:20835096-20835118 AATTAAATGCCTAAAATGTATGG + Intergenic
987667520 5:20963875-20963897 AGTGTAATGCCTAAATTGAATGG + Intergenic
987804529 5:22746191-22746213 AATTAAATGCCTACTTTAGGTGG - Intronic
988765549 5:34370840-34370862 AATTAAATGCCTAAAATGTATGG - Intergenic
989726483 5:44593162-44593184 CATTAAATACATAAATTTGAAGG - Intergenic
990670260 5:58121053-58121075 AATTAAATGGATAAATTGTATGG + Intergenic
991261533 5:64673814-64673836 CATTAAATGGATAAATTGTATGG - Intergenic
991354285 5:65751560-65751582 ATTTAAATGTCTAAAATGAATGG + Intronic
993201481 5:84821426-84821448 AATTAAATGCTTAAATTTATTGG - Intergenic
993660701 5:90630407-90630429 AATGAAATGTATAAAATGGAAGG - Intronic
993921588 5:93811411-93811433 AATTGAAAGCCTTAGTTGGAAGG + Intronic
995139287 5:108716459-108716481 AATTAAAGACCTAAATGTGAGGG + Intergenic
995144904 5:108776373-108776395 AATAAATTGCCTAAATTGTAGGG - Intronic
995314713 5:110755712-110755734 AAATAAATTCCTAATTTGAAAGG + Intronic
996441545 5:123496863-123496885 AATTAAATCCTTAAATAGGCAGG - Intergenic
997626246 5:135332800-135332822 GTTTAAATGACTTAATTGGATGG - Intronic
998821063 5:146058415-146058437 AAATAAATGTCTAAATTGAAAGG + Intronic
999040229 5:148401411-148401433 AATTAATTGTCTAAAATGGCGGG + Intronic
999543367 5:152598884-152598906 AATTCAAAGCCTCAACTGGAGGG + Intergenic
1003936571 6:10980627-10980649 AATTAAATGTCTAAAATTCATGG + Intergenic
1011076553 6:83444873-83444895 AGTTGTATGCCTAAATTGGGAGG - Intergenic
1011569617 6:88721044-88721066 AATAAAATGCCTATATTGAATGG - Intronic
1012061617 6:94491250-94491272 AATGAAAGTCTTAAATTGGAAGG - Intergenic
1012406390 6:98904874-98904896 AACTAAATGCTTAAATAGAAAGG + Intronic
1012717167 6:102690049-102690071 AATTATTTGCCTAACTAGGAGGG + Intergenic
1014996217 6:128148557-128148579 CATTAACTGTCTGAATTGGAAGG - Intronic
1015952508 6:138567448-138567470 AATAAAATCCTTAAATTGGTGGG - Intronic
1016252816 6:142066732-142066754 AAAGAAATCCCCAAATTGGAAGG - Intronic
1016473123 6:144396620-144396642 ATTTAAATGGGTAAATTGTATGG + Intronic
1016628740 6:146202897-146202919 AAATAAATCCCTGAATTGGCCGG + Intronic
1018192360 6:161321261-161321283 AATTAAATGCATGGACTGGAAGG - Intergenic
1018585671 6:165355238-165355260 AATGAAATGCATAAATTTGAAGG + Intronic
1019935490 7:4253756-4253778 AATTAAATGAATAGATTTGAAGG - Intronic
1020594893 7:10194306-10194328 AATTAAATGCCTTAAAAGAATGG - Intergenic
1020623514 7:10547928-10547950 AATAATAAGCCTAATTTGGATGG - Intergenic
1021217428 7:17934100-17934122 AATTAAATGAATAAATAGGCTGG - Intronic
1021864713 7:24943765-24943787 TATGACATGACTAAATTGGATGG + Intronic
1021899236 7:25266724-25266746 TATTAAATGCCTACCATGGATGG - Intergenic
1021933087 7:25601494-25601516 CATAAAATGCCTGAATTGGTAGG - Intergenic
1022592175 7:31674771-31674793 ACTTAAATACTTAAATGGGAGGG + Intergenic
1024134724 7:46394652-46394674 AATTAAATGCCTACATCCAAGGG - Intergenic
1024577616 7:50777511-50777533 ATTTAAATGAGTAAATTGTATGG + Intronic
1024889396 7:54183379-54183401 CATTAAAATCCTAAATGGGAAGG - Intergenic
1025523711 7:61776785-61776807 AAAGAAATGTCTAAATTTGAGGG + Intergenic
1027186348 7:75973117-75973139 AATTAAATAGTTAAATTGGCTGG - Intronic
1027931036 7:84535578-84535600 GATTAAATCCCAAAATTAGAGGG - Intergenic
1028175405 7:87651185-87651207 AAATAAAAGCTTAAATTGAAAGG + Intronic
1028310173 7:89321734-89321756 AAATAAATACCTAAATTAAAAGG + Intronic
1029559832 7:101295249-101295271 AGTTAAAGGCCTAAAGTGGCCGG - Intergenic
1032528443 7:132598904-132598926 GATTAAAGGCCTAAGTAGGAAGG - Intronic
1035992534 8:4508889-4508911 AGGAAAATGCCTAAATAGGATGG + Intronic
1038935182 8:32242140-32242162 AAGATAATGCCTAAATTGCAGGG + Intronic
1039301418 8:36213198-36213220 AATGAGATGCCGAAAGTGGAAGG - Intergenic
1041360940 8:57053392-57053414 AATTAAACTCCTCAATTTGAAGG + Intergenic
1041643904 8:60231339-60231361 TATTAAGAGCCTAAACTGGATGG + Intronic
1041783458 8:61604338-61604360 AATTAAATGGTTAAATTTTAGGG + Intronic
1042848903 8:73195859-73195881 AATAACATACCAAAATTGGAGGG + Intergenic
1044116995 8:88348201-88348223 GGTTAAATGCCTCAATTAGAAGG - Intergenic
1046438041 8:114220215-114220237 ATTTAAGTGCTTAAACTGGAGGG - Intergenic
1047077047 8:121415796-121415818 AATGTAATCCCTAAAGTGGAAGG - Intergenic
1048400023 8:134056878-134056900 CAATAAATGTTTAAATTGGAAGG - Intergenic
1048482480 8:134812169-134812191 AATAAAATACCTATCTTGGAGGG + Intergenic
1048834645 8:138506803-138506825 CATTAAATGTCAAAATTAGAAGG - Intergenic
1050087943 9:1986170-1986192 AAATAAATGAGTATATTGGAGGG - Intergenic
1051234448 9:14984273-14984295 AATTAAACACATAACTTGGAGGG + Intergenic
1051367380 9:16330476-16330498 AAAAGAATGCCTAGATTGGAGGG - Intergenic
1051431831 9:16987420-16987442 AATTAGTTCCCTAAAGTGGAAGG + Intergenic
1055361229 9:75492651-75492673 AAATAAATGGCCAATTTGGAAGG - Intergenic
1055659183 9:78484871-78484893 AAAAAAATGCATAAATTGAAAGG - Intergenic
1055859800 9:80735002-80735024 ATTTAAAGGTATAAATTGGAAGG - Intergenic
1057496656 9:95566360-95566382 AAATGCATGCCTAAATTGGCAGG - Intergenic
1057824581 9:98362568-98362590 AATTACATGTCTCAAATGGAAGG + Intronic
1059399247 9:114058696-114058718 GATAAAATGTTTAAATTGGAGGG - Intergenic
1060160688 9:121360310-121360332 GATTAAAATCCTACATTGGAAGG - Intronic
1061390649 9:130315420-130315442 AATTATATGCCAAGCTTGGAGGG + Intronic
1185996046 X:4950436-4950458 AAATAAATTCCTAAATTGATTGG + Intergenic
1186548171 X:10473266-10473288 AGTTAAAAGCTTAAATAGGAGGG + Intronic
1188784286 X:34325304-34325326 AATGATATGGCAAAATTGGAGGG - Intergenic
1189120951 X:38394467-38394489 AGTTAAAAGGCTAAATTGAAGGG - Intronic
1191167323 X:57404556-57404578 AGTTGTATGCCTAAATTGGGAGG + Intronic
1192940214 X:75903920-75903942 AGCTATATGCCTAAATTGGGTGG + Intergenic
1193187472 X:78530029-78530051 AAGAAAATGGCTAAAGTGGAAGG + Intergenic
1193553048 X:82922906-82922928 AACTAAATGCCTCAATTAAAAGG - Intergenic
1193800986 X:85935789-85935811 AATCTACTGCCTAATTTGGAGGG + Intronic
1194087522 X:89547055-89547077 ATTTAAATGCATAAATTGTATGG + Intergenic
1194495431 X:94611729-94611751 AATTAAATTCCTAAATGTTAAGG - Intergenic
1195698871 X:107686912-107686934 TATTAAATGCCTAAATTGAAGGG + Intergenic
1197681048 X:129385742-129385764 AATTAAATACCTAAATGAAATGG + Intergenic
1198796228 X:140398694-140398716 AAATAAATGCCTCACTTAGAAGG + Intergenic
1199238478 X:145518172-145518194 AACAAAATGGCTAAATAGGAGGG - Intergenic
1199459317 X:148067080-148067102 AACTAAAAGTCTAAATGGGAAGG - Intergenic
1200440167 Y:3202926-3202948 ATTTAAATGCATAAATTGTATGG + Intergenic
1202014846 Y:20392324-20392346 AATTTAATTACTAATTTGGATGG + Intergenic