ID: 955181889

View in Genome Browser
Species Human (GRCh38)
Location 3:56680097-56680119
Sequence TACCCAGTTTGAATAATCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955181889 Original CRISPR TACCCAGTTTGAATAATCTA AGG (reversed) Intronic
910124306 1:83823573-83823595 TGCCCAGTTTGACTAATTCAAGG + Intergenic
910708870 1:90157937-90157959 TTCCCAGTTTGTTTTATCTAAGG - Intergenic
912028198 1:105205256-105205278 TACCCAGTCTGAGTAACGTAAGG + Intergenic
913659230 1:120991917-120991939 AACCCAGTGTTAATTATCTATGG - Intergenic
914010595 1:143775041-143775063 AACCCAGTGTTAATTATCTATGG - Intergenic
914167229 1:145186074-145186096 AACCCAGTGTTAATTATCTATGG + Intergenic
914413816 1:147458680-147458702 AACCCAGTTTGAAGGCTCTAGGG - Intergenic
914649215 1:149683698-149683720 AACCCAGTGTTAATTATCTATGG - Intergenic
917307111 1:173638294-173638316 TCCCCAGTCTGAAGAATCTGGGG + Intronic
917848092 1:179039539-179039561 TACCCAGTTTTGATTATCCATGG + Intronic
918893573 1:190309639-190309661 TACCCAGTGTGAATTTTCTTAGG - Intronic
922035407 1:221842903-221842925 TACCAAGTATGGGTAATCTACGG - Intergenic
922070113 1:222183806-222183828 GACCCAGTTTGCATAACATAAGG - Intergenic
1071708232 10:88022623-88022645 CTCCAAGTTTGAAAAATCTAAGG + Intergenic
1073089004 10:100917501-100917523 TTCCCAGTCTGAAAAAACTAAGG - Intronic
1078769750 11:14338119-14338141 TTGCCAGTTTGAATAAAGTATGG - Intronic
1083392151 11:62360432-62360454 TACTCATTTTCAATAATCTAAGG - Intronic
1085661865 11:78375382-78375404 TACACAGTTTGAAAAATCTAAGG + Intronic
1088750408 11:112837861-112837883 TAAACAGTATGAATAATATAAGG + Intergenic
1093431133 12:19086356-19086378 TACAAAGTTTGAATTATCTGTGG - Intergenic
1095886727 12:47196011-47196033 CACCTAGTTTGACTAATCTTTGG - Intronic
1101355991 12:103978128-103978150 GACACTGTTTGAATAATCTAGGG + Intronic
1105862941 13:24432920-24432942 TGCACAGGTTGAAGAATCTATGG + Intronic
1108365248 13:49704498-49704520 CTCCCAGTCTGAATATTCTACGG + Intronic
1108753152 13:53469384-53469406 TCCCCAGTTTGAAAAATCTCTGG + Intergenic
1109613579 13:64799528-64799550 TATCAAATTTAAATAATCTATGG + Intergenic
1109780971 13:67109189-67109211 AACCCAGTTTCAACAAGCTAAGG - Intronic
1110958944 13:81595380-81595402 TATCCACTTTGATTAATCTGGGG - Intergenic
1111664600 13:91251214-91251236 TAATCAGTTTGCATAAACTATGG - Intergenic
1111742763 13:92225214-92225236 TATTCAGTTTGATTAATTTATGG + Intronic
1116470171 14:45277494-45277516 TTCCCAGTGTGAAAAATCTCAGG + Intergenic
1118891098 14:69909817-69909839 CACCCAGTTAGAATTATCTTTGG - Intronic
1119449127 14:74693057-74693079 TACCCAGTTTGAATATAATGGGG + Intronic
1125104265 15:35952454-35952476 GAGCCAGTTTGAATAATCAGAGG + Intergenic
1125148762 15:36506325-36506347 GACCCAGTTTAAGTAACCTATGG + Intergenic
1126266447 15:46759883-46759905 GATTCAGTTTGAAAAATCTAGGG + Intergenic
1127903560 15:63359185-63359207 TACCCCCTTTGGATAATCCATGG + Intronic
1130917176 15:88314267-88314289 AACCAAGTTAGAATAATATAAGG - Intergenic
1136078823 16:27838381-27838403 TACACAGTTTGAAAACTCTGGGG + Intronic
1138648445 16:58442625-58442647 TTGCCAGTTTGAATAATTTCAGG + Intergenic
1146148329 17:30442576-30442598 TAACCAGTTTGTATATTCCAAGG + Intronic
1147348356 17:39820718-39820740 TACCTCGTTAGCATAATCTAAGG - Intronic
1153374887 18:4364566-4364588 TACACATTTTAAATAATATATGG - Intronic
1153657804 18:7300678-7300700 TACCTAGTTTGAAAAATAAAAGG - Intergenic
1155993000 18:32300230-32300252 TACCCATTTTGAAAAATCACAGG + Intronic
1159127499 18:64241268-64241290 TTCCCAGTTTAAATAAGGTAGGG - Intergenic
1159194266 18:65091383-65091405 TAACAAGTTTGAAGAATTTAGGG - Intergenic
1159807883 18:72977723-72977745 TACACAGTTTGCATAATATATGG + Intergenic
1161626669 19:5330936-5330958 TACCCACTTCCAATAATCAATGG + Intronic
925729709 2:6910429-6910451 TAAGGAGATTGAATAATCTAAGG + Intergenic
937484595 2:122301339-122301361 AACCCAGTTTAAGGAATCTAAGG + Intergenic
940149290 2:150581365-150581387 TGCTCTGTTTGAAGAATCTAGGG - Intergenic
943653933 2:190487407-190487429 TAGCCAATGTAAATAATCTAAGG + Intronic
944247856 2:197550234-197550256 TATCCAGTTCTAAGAATCTATGG + Intronic
946151782 2:217778730-217778752 TACCCAGTGTGAATAATAGAGGG + Intergenic
947410857 2:229837976-229837998 TATCAAGTTTGAATAATTTTGGG - Intronic
1169739146 20:8871111-8871133 TACTCTGTTTTCATAATCTATGG - Intronic
1177738875 21:25128641-25128663 TAGCCACTTTGAATACTCTCAGG + Intergenic
949168986 3:976174-976196 TACTCATTTTGCATTATCTATGG - Intergenic
949508908 3:4751609-4751631 TAGCCTGTTTGAATAATCAGAGG + Intronic
950250642 3:11462520-11462542 TGGCTAGTTTGAATAATCTCAGG + Intronic
950647985 3:14389112-14389134 AACCCAGTTTGAAAATCCTAGGG + Intergenic
951573056 3:24085455-24085477 GGCCCAGTTTGAAAAATCCAAGG + Intergenic
952910005 3:38175712-38175734 TACCCAGTTTGAAAGATTTAAGG + Intronic
955181889 3:56680097-56680119 TACCCAGTTTGAATAATCTAAGG - Intronic
956846053 3:73183847-73183869 TACTCAGGTTGAATAATTTAAGG - Intergenic
956848802 3:73209012-73209034 TACCCAGGTTGAAAATCCTAAGG - Intergenic
960943801 3:122952476-122952498 TCCCCAGTTTGGAGAAACTAAGG - Intronic
962918515 3:139930825-139930847 TACCCAGCTTAAATTATTTAGGG + Intergenic
963547357 3:146677008-146677030 TACCCAGTCTGAATTATATGGGG - Intergenic
965576959 3:170227258-170227280 AACTCAGTTTGAATGATCTCTGG - Intronic
966574906 3:181489758-181489780 AACTCAGATGGAATAATCTAGGG + Intergenic
968867428 4:3222400-3222422 TACTCAGTTTGAAGAAACTTGGG + Exonic
970285557 4:14509930-14509952 TAGCCATTTTGACTAATTTAAGG - Intergenic
973088560 4:46101319-46101341 TACCTTTATTGAATAATCTAGGG + Intronic
973303810 4:48620414-48620436 TACCCAGTATGAGTACTGTAGGG + Intronic
974583808 4:63843179-63843201 TAACCATTTTGAATATTGTAAGG - Intergenic
975340212 4:73231630-73231652 TAACCACTTTGAAGATTCTAAGG - Intronic
979557938 4:122072369-122072391 TACCAATATTGAATATTCTAAGG + Intergenic
983381990 4:167007346-167007368 TAGGCATTATGAATAATCTAGGG - Intronic
986041269 5:3996248-3996270 AACCTAGTTTGAATAATCACAGG - Intergenic
987234483 5:15928958-15928980 TACCCTGTTTGCACTATCTATGG - Intronic
987334391 5:16885963-16885985 TACTCTGTTTGAGTACTCTATGG - Intronic
988325518 5:29761632-29761654 TCCCCACTTTGAATAAACCATGG - Intergenic
990056753 5:51591156-51591178 TAACCAGTGTGAAGACTCTAGGG + Intergenic
993689971 5:90988384-90988406 TACCAAATTTATATAATCTAGGG + Intronic
995375762 5:111472545-111472567 TACCCATTTTCACAAATCTAAGG + Intronic
997760770 5:136445693-136445715 TACCCAATTTGAAGAATAAAGGG - Intergenic
1000491061 5:161914162-161914184 TACCCAATTTGCACAGTCTATGG + Intergenic
1002533155 5:179861083-179861105 TTCCCAGGTTGAATGATTTATGG + Exonic
1003909570 6:10731234-10731256 TACCTATTTTGAATAACTTAAGG + Intergenic
1003912691 6:10757080-10757102 TACCTATTTTGAGTAATTTAAGG + Intronic
1004913532 6:20309633-20309655 TAGCCAGATTGAAGAATGTATGG - Intergenic
1008599768 6:53080604-53080626 TATCCAGTTAGAATAAATTAAGG + Intronic
1010455990 6:76056132-76056154 GACCCAGTTTGATTTATCTCAGG + Intronic
1011470939 6:87707005-87707027 TACTGAGTTTGAATAATCATAGG + Intergenic
1012595550 6:101034133-101034155 GAACTAGTTTGAATAAGCTATGG - Intergenic
1014847284 6:126292971-126292993 TACAAATTTTGGATAATCTATGG + Intergenic
1017307021 6:152930347-152930369 TACTCAGTTTAAATAATCCCAGG - Intergenic
1018502607 6:164427308-164427330 AACCTATTTTGAAGAATCTATGG + Intergenic
1021594084 7:22296241-22296263 CAGCCAGTCTGAATAATCTGAGG + Intronic
1022065735 7:26855170-26855192 CACCAAGTTTTAATAAACTATGG + Intronic
1024122033 7:46252583-46252605 TTACCAGTTTGAATAAAGTATGG - Intergenic
1033338409 7:140472786-140472808 TAAACAGTTTTCATAATCTAAGG - Intronic
1033898059 7:146099783-146099805 TATCAAGTATGAATAATCAATGG - Intergenic
1034388945 7:150767263-150767285 TACACAGTTTTAAGAAACTAAGG - Intergenic
1035326029 7:158066711-158066733 TACCCAGATTGTATACTTTATGG + Intronic
1037247262 8:16849200-16849222 TACACACTTTGAATATTTTAAGG - Intergenic
1039592924 8:38765283-38765305 TACCAAGTTCCAATAATCTGAGG - Intronic
1040924557 8:52665038-52665060 TTCTCAGATTGAATAAACTAGGG - Intronic
1044572088 8:93731328-93731350 CACCCATTTTGAATAATATATGG - Exonic
1050617157 9:7413708-7413730 TTCCAAGTTTGAATTATCTGGGG + Intergenic
1051498436 9:17750939-17750961 TACCCAGCCTGAATATTCCATGG - Intronic
1052388988 9:27856114-27856136 TAGCTACTTTGAATAATCTCAGG + Intergenic
1052681765 9:31701798-31701820 TACACATCTTGAATAATCCAAGG - Intergenic
1055100987 9:72465377-72465399 TGCTCAGTTTGAATAATTTAGGG + Intergenic
1187204043 X:17165284-17165306 GAACCAGTTTGGATAAACTAAGG + Intergenic
1192078587 X:68025085-68025107 TGCCCAGCTTCCATAATCTATGG - Intergenic
1197306072 X:124843559-124843581 TAGCCAGTTTGAACAATGCATGG + Intronic
1197627060 X:128814004-128814026 TTTCCAGTTTGATTAATCTTTGG - Intergenic
1199062753 X:143377858-143377880 AAAACAGTTTTAATAATCTATGG + Intergenic
1201447214 Y:14070644-14070666 TACTCAACTTGAATAATCAAGGG + Intergenic