ID: 955187880

View in Genome Browser
Species Human (GRCh38)
Location 3:56732491-56732513
Sequence CTGTGGATAAAGAGGTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955187874_955187880 28 Left 955187874 3:56732440-56732462 CCACAAGCTTTCATTAAGCAATA 0: 1
1: 0
2: 1
3: 13
4: 177
Right 955187880 3:56732491-56732513 CTGTGGATAAAGAGGTCCCCAGG 0: 1
1: 0
2: 0
3: 14
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955187880 Original CRISPR CTGTGGATAAAGAGGTCCCC AGG Intronic
900911370 1:5599179-5599201 CTCTAGATTAACAGGTCCCCTGG + Intergenic
901123336 1:6912450-6912472 CAGAGGATAGAGTGGTCCCCAGG - Intronic
901190157 1:7405097-7405119 CTGTGGGCTAAGAGGTCCCCGGG + Intronic
902134702 1:14294921-14294943 CTATGGACACAGAGGTCCCCAGG + Intergenic
902220075 1:14959027-14959049 CTGTGGATAAACAGATCCATAGG + Intronic
905508916 1:38503030-38503052 CTGTGGGTAAAGAGCTTGCCTGG - Intergenic
906046803 1:42837373-42837395 CAGTGGGTAAGGAGGTGCCCAGG + Intronic
907235068 1:53038978-53039000 CTGGGGGTAAAGAGGCCACCTGG + Exonic
908755650 1:67466868-67466890 CTGTGGATACAGAGGTGGACAGG + Intergenic
912584525 1:110750278-110750300 CGGTGGACAGAGAGGGCCCCTGG + Intergenic
914676442 1:149910340-149910362 CCATGGGTAAAGAGGTCCCCTGG + Intronic
916416052 1:164592820-164592842 CTGAGGATAAAGACTGCCCCTGG + Intronic
917665288 1:177220175-177220197 CTGTAGATAGATAGGCCCCCAGG - Intronic
917739886 1:177952030-177952052 CAATGGGTAAAGAGGTTCCCTGG - Intronic
919369665 1:196707513-196707535 CTGTGTTTTAAGTGGTCCCCAGG - Intronic
923086812 1:230708588-230708610 CTGTGGAGAAAGAGGTTCAGTGG - Intronic
1062761711 10:27738-27760 CTGCAGATCAGGAGGTCCCCTGG + Intergenic
1064710575 10:18119981-18120003 ATGTGGATAAAGAGGCCTCCAGG + Intergenic
1067528347 10:47051911-47051933 CGGTGCAGAGAGAGGTCCCCAGG - Intergenic
1072426472 10:95334714-95334736 CTGACGATAAGGATGTCCCCGGG + Intronic
1072430314 10:95365433-95365455 CTGAGAATAAAGAGGTGGCCTGG + Intronic
1073038331 10:100579983-100580005 CTGTGGATAGAGAGATTCCCAGG + Intergenic
1073287625 10:102398284-102398306 ATGTGCATAAACAGGTACCCAGG + Exonic
1077003262 11:335974-335996 CTGAGCATAAAGAGCTTCCCTGG + Intergenic
1087718470 11:101636064-101636086 CAGTGGATCAGGCGGTCCCCTGG + Intronic
1088584700 11:111352540-111352562 CTGAGGCTCCAGAGGTCCCCAGG + Exonic
1089098446 11:115939452-115939474 ATGTGGTTCCAGAGGTCCCCAGG - Intergenic
1090099462 11:123778790-123778812 CTGTGGGTAATGAGGTTCCTGGG + Intergenic
1090395128 11:126413903-126413925 CTGGGGACAGAGAGGTCCCTGGG + Intronic
1091817142 12:3447059-3447081 CTGTGGGTGAACAGGTCCCTGGG - Intronic
1095232864 12:39762450-39762472 ATGTGGCTAAAGAGATCCCTTGG - Intronic
1095723326 12:45424857-45424879 CTCTGGAGAAAAATGTCCCCAGG + Intronic
1096649031 12:53052984-53053006 CTGTCTCTGAAGAGGTCCCCTGG + Intronic
1100623364 12:96303852-96303874 CTGTGGATAAGGGGGACCTCTGG - Intronic
1108747462 13:53409608-53409630 TTGTGGTTCAAGAGGTCACCTGG + Intergenic
1109310105 13:60683500-60683522 CTGTGGATACATAAGTCTCCAGG + Intergenic
1111291541 13:86177508-86177530 CTGTGGATATGGAGGGCCACTGG + Intergenic
1112328839 13:98461977-98461999 GTGTGGGTTTAGAGGTCCCCAGG - Intronic
1112655233 13:101445318-101445340 GTGTGGATAAAGATATCCCCAGG - Intergenic
1118003952 14:61548508-61548530 CTGTGGGTCAAGAGCTCCACAGG + Intronic
1118330986 14:64815867-64815889 GTGAGGATAAAGAGGCCCCAAGG + Intronic
1118856980 14:69631073-69631095 CTGTGGCTTCAGAGGTCTCCTGG + Intronic
1121315340 14:92958029-92958051 CGGTGGATAAAGAGGTCTTGGGG - Intronic
1122117191 14:99533701-99533723 CTGGGGAGGAAGAGGTCCCTGGG + Intronic
1122213393 14:100187687-100187709 CTGTGGCTCAAGAGGGCCCCAGG + Intergenic
1122297086 14:100711801-100711823 CTGAGGAGAAAGAGGTGGCCTGG + Intergenic
1125708782 15:41766631-41766653 CTATGGATACAGAGTTCCCAGGG + Exonic
1131115535 15:89792842-89792864 CTTTGTATAAAGAGGTCCGATGG + Intronic
1131400914 15:92124942-92124964 ATGAGGATAAAGAGGCACCCAGG + Intronic
1132873183 16:2124550-2124572 CTGTGGATTGGGAGGGCCCCGGG - Intronic
1133837313 16:9378517-9378539 CTGTGGATAAAGAGTTAACAAGG + Intergenic
1134043433 16:11084829-11084851 CTGTGGAGAAAGAGGTAGCCGGG + Intronic
1136392066 16:29971692-29971714 CTGTGGTTGAAGAGGTTCTCGGG - Intronic
1136418419 16:30117286-30117308 CTGTGGATAAGGAGGTGACTTGG + Intronic
1138330672 16:56212989-56213011 CTGTGGGCAGAGACGTCCCCAGG + Intronic
1139771364 16:69280250-69280272 CTGTGTATAAAGAGGTAGACAGG - Intronic
1141242179 16:82274332-82274354 CGGTGGTCAAAGAGGGCCCCTGG + Intergenic
1144115987 17:12091047-12091069 CTGTGAAGAGAGAGCTCCCCTGG + Intronic
1147606428 17:41776213-41776235 CTGTGCAGACACAGGTCCCCAGG + Intronic
1150850217 17:68697016-68697038 TGGTGGATAAACAGGTCCCAGGG + Intergenic
1151658615 17:75507321-75507343 CTGTGGATCATGATGACCCCAGG + Intronic
1152610278 17:81311922-81311944 CTGGGGAAAAACAGGGCCCCAGG + Exonic
1152805540 17:82354118-82354140 CTGTGGATGAAGAAATCTCCTGG + Intergenic
1152954618 18:28068-28090 CTGCAGATCAGGAGGTCCCCTGG + Intergenic
1158267479 18:55676449-55676471 CTGTTGATAAAGACATACCCAGG + Intergenic
1158817595 18:61121468-61121490 CTGTGGATAAAGATGTGGCCTGG + Intergenic
1163577338 19:18118389-18118411 CTGTGGATCGAGGTGTCCCCTGG + Intronic
1164794944 19:31018542-31018564 CTGTGACTATAGAGCTCCCCAGG + Intergenic
925030806 2:648813-648835 GTGTGGATACAGGAGTCCCCTGG - Intergenic
933383618 2:81583270-81583292 ATGTGGGGAAAGAGATCCCCAGG + Intergenic
934039776 2:88118187-88118209 CTGAGGATACAGTGATCCCCGGG - Intergenic
938614702 2:132985112-132985134 CTGTGAATAAAATGGTGCCCTGG - Intronic
939508193 2:143074914-143074936 CTGTTGATAAAGACATACCCAGG - Intergenic
941432173 2:165426331-165426353 CTGTAAATTCAGAGGTCCCCAGG - Intergenic
941567689 2:167129342-167129364 CCGTGAGTGAAGAGGTCCCCAGG - Intronic
946223023 2:218245456-218245478 CTGTGGCTAAAGAGGACCTGTGG - Exonic
947084087 2:226431431-226431453 ATGTGGGTAAATAGCTCCCCAGG - Intergenic
948927261 2:241107291-241107313 CTTGGAATAACGAGGTCCCCAGG - Intronic
1177597781 21:23267790-23267812 GTGTGGATGAAGAGGTTTCCTGG - Intergenic
1179550760 21:42142071-42142093 GTGTGGAGGAAGAGGTCACCTGG - Intronic
1180354799 22:11829645-11829667 CTGTGGCTGCAGAGGGCCCCTGG + Intergenic
1180383452 22:12162686-12162708 CTGTGGCTGCAGAGGGCCCCTGG - Intergenic
1181179283 22:21055653-21055675 CTGTGGGCACAGTGGTCCCCTGG - Intronic
1185244134 22:49764265-49764287 CTGTGGAGCAGCAGGTCCCCTGG - Intergenic
949873753 3:8610728-8610750 GTGTGGCTAAAGAGGTTACCTGG + Intergenic
950217987 3:11173059-11173081 CCCTGGATGAAGAGGTTCCCTGG + Intronic
953406129 3:42660671-42660693 CTGTGGAGAAAGTGTTACCCGGG + Intronic
955187880 3:56732491-56732513 CTGTGGATAAAGAGGTCCCCAGG + Intronic
957205381 3:77191746-77191768 CTATGCATAAACAAGTCCCCAGG + Intronic
958744381 3:98114565-98114587 CCATGTATAAAGGGGTCCCCAGG + Intergenic
967884482 3:194323812-194323834 CTCCGGATAAAGAGGTCTCGGGG + Intergenic
968359105 3:198134070-198134092 CTGCAGATCAGGAGGTCCCCTGG - Intergenic
968817339 4:2828872-2828894 CTGAGGAGAAAGAGGACCCCGGG - Intronic
968856802 4:3131162-3131184 CTGGGGATAAAGAGATGCCCTGG - Intronic
970008462 4:11432348-11432370 TTGTGGATAAAGAGTCCCACTGG - Intergenic
976231138 4:82844393-82844415 CTGTGGATAAGGTGGTACCTGGG + Exonic
980499168 4:133626604-133626626 CTGTGGCAAAACAGGTGCCCTGG + Intergenic
983195446 4:164801241-164801263 CTGTGGATAAGTAGTTCCCATGG - Intergenic
985566978 5:623966-623988 CTGAAGATAAGAAGGTCCCCAGG - Intronic
987143004 5:14964425-14964447 CACTGGATAAAGAGGACCCAGGG - Intergenic
988669030 5:33361191-33361213 CTGTTGATAAAGACATACCCAGG + Intergenic
988729842 5:33961194-33961216 CAGGGAATAAAGAGGTACCCAGG - Intronic
993837722 5:92835451-92835473 CTGTGGATCAGGAGATCCCCTGG - Intergenic
994446229 5:99878769-99878791 CTGTGGTTGAAGGAGTCCCCTGG - Intergenic
996967404 5:129322093-129322115 CTGCTGATAAAGATGTACCCAGG + Intergenic
1000794738 5:165650926-165650948 CTTTGTATAAAGAGATTCCCTGG + Intergenic
1001535877 5:172497546-172497568 CTGGGAATACAGAGGGCCCCAGG - Intergenic
1002564197 5:180100727-180100749 CTGTGGCTACAGCAGTCCCCGGG + Intergenic
1004301585 6:14463229-14463251 CTGTGGATACTGAGGTTCACAGG + Intergenic
1007135529 6:39517596-39517618 CTGGGGATAATGAGGTCCTGTGG + Intronic
1008482949 6:52005711-52005733 CTGGGAATAAAGAGTTCCACAGG + Intronic
1010011420 6:71051832-71051854 CTCGGGATAAAGAGGTGCCTTGG - Intergenic
1011745784 6:90406676-90406698 CTGTGACAAAAGAAGTCCCCAGG - Intergenic
1020205664 7:6113351-6113373 CCGTGGAGAAAGAGGTCCTGTGG - Intronic
1024236267 7:47401547-47401569 CTGGGGTTCATGAGGTCCCCAGG + Intronic
1026231920 7:68491255-68491277 CTGTGGAAACAGATGCCCCCTGG - Intergenic
1026323279 7:69286166-69286188 CTGTGGGTTAAGAAGTCCTCTGG - Intergenic
1032741128 7:134740702-134740724 TTGTGAATAAAGATGTCTCCTGG + Intergenic
1033260645 7:139841065-139841087 CTGGGGATGATGAGGTGCCCAGG - Intronic
1033428116 7:141263797-141263819 TTGTAGATTCAGAGGTCCCCAGG + Intronic
1036664056 8:10727408-10727430 CTGTGGCTAAGCAGGTGCCCTGG - Intronic
1037887313 8:22601829-22601851 CTGCGGATCCAGAGGCCCCCAGG + Exonic
1038703880 8:29876208-29876230 CTGTGGTTAAAAAGGTCAGCAGG + Intergenic
1039473255 8:37826664-37826686 CTGTGCACAAACAGGCCCCCTGG + Intronic
1040809236 8:51432190-51432212 CTGTGGATAATGAGTTGCCCAGG + Intronic
1044496741 8:92896128-92896150 CAGTGAATACAGAGGTCCCCTGG - Intronic
1047671377 8:127150729-127150751 CTATGGATTCAGAGGTCTCCAGG - Intergenic
1047790606 8:128199891-128199913 ATCTTGATAAAGAGGTCCCTTGG + Intergenic
1047844305 8:128789350-128789372 CTCTGTATAAACTGGTCCCCTGG - Intergenic
1049882494 8:145075813-145075835 CTGCAGATCAGGAGGTCCCCTGG - Intergenic
1056100487 9:83296299-83296321 CTGGGGAGATTGAGGTCCCCGGG + Intronic
1057910761 9:99018423-99018445 ATGTGGACAAAGAGCTTCCCAGG - Intronic
1185770007 X:2758605-2758627 CTGTGGATAAACATGATCCCTGG - Intronic
1185958389 X:4518227-4518249 CTGTTAATAAAGACGTACCCAGG - Intergenic
1187421594 X:19139052-19139074 CTGGGGATGAAGAGGTAACCAGG + Intergenic
1187568797 X:20479342-20479364 CTGTGGAAAACCAGGTCCACTGG - Intergenic
1189915238 X:45850488-45850510 CTGGGGATAAAGAAGCTCCCGGG - Intergenic
1201300515 Y:12501027-12501049 CTGTGGATAAACATGATCCCTGG + Intergenic