ID: 955188932

View in Genome Browser
Species Human (GRCh38)
Location 3:56742071-56742093
Sequence CAGTGAGTATCATGGCACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955188932_955188938 13 Left 955188932 3:56742071-56742093 CCCTTGTGCCATGATACTCACTG 0: 1
1: 0
2: 0
3: 6
4: 187
Right 955188938 3:56742107-56742129 ACCAAGAATAGCAGTCTTCACGG 0: 1
1: 0
2: 1
3: 8
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955188932 Original CRISPR CAGTGAGTATCATGGCACAA GGG (reversed) Intronic
902996945 1:20233034-20233056 CAGTGATTTTCAGGGAACAAGGG - Intergenic
903801200 1:25969731-25969753 CAGTGAGTATCTTAGCTCAACGG + Intronic
905902615 1:41591708-41591730 CAGTGAGGACCATGGCAGAGCGG + Intronic
910565190 1:88635751-88635773 AAGTGTGTAGCATGGCATAAAGG - Intergenic
910734307 1:90435242-90435264 CAGCTAGTACCATGGCATAAAGG + Intergenic
911178895 1:94843703-94843725 CAGGGAGGGTCATGTCACAAAGG + Intronic
911279902 1:95911688-95911710 CAGTGATTCTCAGGGAACAAGGG + Intergenic
915886191 1:159723559-159723581 CAGTGATTTTCAGGGAACAAGGG - Intergenic
916931632 1:169584644-169584666 TAGTGAGTATCATAGCTCTAGGG + Intronic
919612235 1:199759543-199759565 GAGTCAGTATCCTGCCACAATGG - Intergenic
921888905 1:220334178-220334200 CAGTTAGTATCATAGCATAGAGG - Intergenic
1065679040 10:28210058-28210080 AAGTAAGTATCAAAGCACAAAGG - Intronic
1066113509 10:32219160-32219182 CAGTGATTTTCAGGGAACAAGGG + Intergenic
1067128182 10:43538214-43538236 CAGTGATTTTCAGGGAACAAGGG + Intergenic
1068152831 10:53156040-53156062 CAGTGATTTTCAGGGAACAAGGG - Intergenic
1069223326 10:65910670-65910692 CAGTGAATGGCATGGCACATGGG - Intergenic
1070700917 10:78601223-78601245 CAGGGAGGATCATGGCCCATTGG + Intergenic
1072473192 10:95733297-95733319 CAGTGATGTTCATGGAACAAGGG - Intronic
1073373030 10:103007691-103007713 CAGTGATTTTCAGGGAACAAGGG - Intronic
1074211787 10:111341826-111341848 CAGTGATTTTCAGGGAACAAGGG - Intergenic
1075979991 10:126730025-126730047 CACTTAGTATCCTGGCACACAGG + Intergenic
1077717739 11:4598862-4598884 CAGACTGTATCATGGCACAGTGG + Exonic
1078939926 11:15991204-15991226 CTGTGGGTATCGTGGCAAAAAGG - Intronic
1079319241 11:19437955-19437977 CAGTGATTATGTTGGCACAGAGG - Intronic
1081236170 11:40649483-40649505 CAGTGATTTTCAGGGAACAAGGG - Intronic
1083088664 11:60176962-60176984 TACTGAGTAGCCTGGCACAAGGG - Intronic
1083700571 11:64475128-64475150 TAGGGAGTATCATGGGACACTGG + Intergenic
1084639981 11:70419813-70419835 CTTTGAGTATCAAGGCAAAACGG + Exonic
1092657678 12:10704171-10704193 CAGTGAGTGTCACAGCACAGGGG + Intronic
1092852295 12:12640444-12640466 CAGTGATTTTTATGGAACAAGGG - Intronic
1093676190 12:21942503-21942525 CAGTGAGGATCCTGGTACTATGG + Intergenic
1094134132 12:27106198-27106220 CAGTGCGTGTCATGGCACAGAGG + Intergenic
1094184233 12:27624101-27624123 CAGTGCATGTCATGGCACAGAGG + Intronic
1096990472 12:55797633-55797655 CAGTGCACATCATGGCAGAAAGG + Intronic
1097364367 12:58695258-58695280 CAGTGATTTTCAGGGAACAAGGG + Intronic
1098454615 12:70658137-70658159 AAGTGAAAATCATGGCACACGGG - Intronic
1098839166 12:75458348-75458370 CAGTGATTTTCAGGGAACAAGGG - Intergenic
1099067121 12:77995555-77995577 CAGTGAGTGAGATGACACAAAGG - Intronic
1099816438 12:87654818-87654840 CAGGGAGTTTCATGACACCATGG - Intergenic
1101491481 12:105213866-105213888 CAGGTAGTATCATGGCACCCTGG - Intronic
1102061006 12:109931015-109931037 CTGTGAGTAGCATGGGAAAAGGG - Exonic
1102832384 12:116015669-116015691 CAATGAGTTTCAAGGCAAAAGGG + Intronic
1103692859 12:122789908-122789930 CTGTTAATAGCATGGCACAAGGG + Intronic
1104320370 12:127745161-127745183 CAGTCAGTATCCTGGCTCACTGG - Intergenic
1105656888 13:22451463-22451485 CAGGGAGCCTCAGGGCACAAAGG + Intergenic
1108047154 13:46394091-46394113 CAGTGATAATGATGGAACAAAGG - Intronic
1108799062 13:54070365-54070387 CAGTGATTTTCAGGGAACAAGGG - Intergenic
1108844751 13:54663843-54663865 ATGTGAGTATCAGGGCCCAAAGG - Intergenic
1109053834 13:57520047-57520069 CAGTGAGTTTCATGGCCAATGGG - Intergenic
1109460503 13:62650709-62650731 GAGAGAATATCATGGGACAATGG - Intergenic
1110279476 13:73676057-73676079 CAGTGTGGAGCCTGGCACAAAGG - Intergenic
1112140067 13:96631279-96631301 CAGACAATATCAAGGCACAAAGG - Intronic
1117492991 14:56271073-56271095 CAGTTAGTATCATGCCTCACGGG + Intronic
1119526243 14:75324736-75324758 CAGTGAGGACCATGGCAAATTGG - Intergenic
1119573225 14:75695011-75695033 CAGTGATGTTCATGGAACAAGGG + Intronic
1120201055 14:81538601-81538623 CAGTGATTTTCAGGGAACAAGGG - Intergenic
1120923321 14:89774334-89774356 CTGTGAGTAACATGGAATAAGGG - Intergenic
1121064881 14:90953486-90953508 CAGTGATTTTCAAGGAACAAGGG + Intronic
1124525509 15:30447674-30447696 TATTGAGTATCATGAGACAATGG + Intergenic
1124773145 15:32560010-32560032 TATTGAGTATCATGAGACAATGG - Intergenic
1125065059 15:35472586-35472608 CAATGAGTATGAAGGCAAAAAGG + Intronic
1125125742 15:36218589-36218611 CAGTGAGTTTGTTGGCATAAGGG - Intergenic
1126125436 15:45291211-45291233 CATTGAGGATTTTGGCACAAGGG - Intergenic
1134352349 16:13449673-13449695 CCGTGAATATCATGGAAGAAAGG - Intergenic
1135202796 16:20453596-20453618 CAGTGATTTTCAGGGAACAATGG + Intronic
1135216301 16:20574270-20574292 CAGTGATTTTCAGGGAACAATGG - Intronic
1135940675 16:26819215-26819237 CAGTGGCTGTCACGGCACAATGG + Intergenic
1136531812 16:30875070-30875092 CAGTGGGTTCCATGGCGCAAGGG + Intronic
1139309634 16:66017678-66017700 CTGTGAGGATGATGGAACAAAGG + Intergenic
1140060190 16:71562304-71562326 CAGTGATTTTCAGGGAACAAGGG - Intronic
1143759716 17:9092202-9092224 CATTTAGTATCATGTCACCATGG + Intronic
1145303424 17:21655750-21655772 CAGTGGGTATCATGTCCCAGTGG + Intergenic
1145346618 17:22046091-22046113 CAGTGGGTATCATGTCCCAGTGG - Intergenic
1145347488 17:22050186-22050208 CCTTGTGTTTCATGGCACAAAGG + Intergenic
1149082097 17:52669549-52669571 CAATAAATATCAGGGCACAATGG + Intergenic
1150897146 17:69225362-69225384 CAGTCAGTAACATAACACAAAGG - Exonic
1153554377 18:6295734-6295756 CACTGAGTGTCATGGCTCAGTGG + Intronic
1155072888 18:22331693-22331715 CAGTGAGTATGTTTGCAAAAAGG + Intergenic
1156883864 18:42111945-42111967 CAGTGATTTTCAGGGAACAAGGG + Intergenic
1158051251 18:53223288-53223310 CATTGAGTATACTTGCACAAAGG + Intronic
1159069804 18:63611120-63611142 CAATGACTACCATAGCACAAAGG - Intergenic
1162015228 19:7841876-7841898 CAGTGAGGGTCATGGCACAGTGG + Intronic
1164314622 19:24076000-24076022 CAGTGATTTTCAGGGAACAAGGG - Intronic
1164332481 19:24272838-24272860 CAGTGATGATCAGGGAACAAGGG + Intergenic
1165685373 19:37815534-37815556 CAGTGATTTTCAGGGAACAAGGG + Intronic
1166912573 19:46170513-46170535 CAGTGATTTTCAGGGAACAAGGG + Intergenic
1167225336 19:48235271-48235293 CATTGAATATCTTGGCATAAAGG - Intronic
925417593 2:3681892-3681914 GAGTGAGCATCATGGCCCAAAGG + Intronic
928567434 2:32567576-32567598 CAGGAAGTATCATGGGATAATGG + Intronic
929761531 2:44811224-44811246 CACAGAGTAGCATGGGACAAAGG - Intergenic
929976832 2:46643247-46643269 CAGTGATTTTCAGGGAACAAGGG - Intergenic
933598580 2:84306773-84306795 CAGTGATTTTCAGGGAACAAGGG - Intergenic
935018284 2:99205428-99205450 CAGTGATTCTCAGGGAACAAGGG + Intronic
936063926 2:109316376-109316398 CAGGGAGAAACATGGCACCAGGG - Intronic
937591565 2:123619030-123619052 CAGTGATTTTCAGGGAACAAAGG - Intergenic
938616557 2:133005011-133005033 CAGTGATTTTCAGGGAACAAGGG - Intronic
939540285 2:143485328-143485350 CAGTGACTATCATGTGAGAAAGG - Intronic
942205566 2:173617127-173617149 GAGAGAGTCTCATGGCAGAAGGG + Intergenic
945046541 2:205786966-205786988 CAGTGAGCATCATGGGGCAATGG + Intronic
945117071 2:206418362-206418384 TACTGAGTGTCATGGTACAATGG + Intergenic
1171520940 20:25773441-25773463 CAGTGGGTATCATGTCCCAGTGG + Intronic
1171555984 20:26083050-26083072 CAGTGGGTATCATGTCCCAGTGG - Intergenic
1172188274 20:33045298-33045320 CAGTGATTTTCAGGGAACAAGGG + Intergenic
1180627401 22:17203297-17203319 CCCTGAGTATCATGGCAGAGGGG + Intronic
1181116647 22:20635841-20635863 CAGTGAGTATGAGGGGTCAAGGG - Intergenic
1183055212 22:35300722-35300744 CTGTGAGTATCCTGTCACCAGGG - Intronic
1183615860 22:38944994-38945016 CAGAGACAATCATGACACAAGGG - Intergenic
950231301 3:11278075-11278097 CAGTGATTTTCAGGGAACAAGGG - Intronic
950941703 3:16899127-16899149 AAGTGAGAATCATGGTGCAAAGG - Intronic
951039942 3:17978886-17978908 CAGTGAGCATCATGGAACGGTGG + Intronic
951282957 3:20775335-20775357 ACCTGAGTATCATGGCAAAATGG - Intergenic
952045429 3:29313331-29313353 CAGTGAGTTTCATAATACAATGG - Intronic
953443394 3:42940346-42940368 CAGTGAGTGTCATGGAATACTGG - Intronic
953669052 3:44947335-44947357 CAGTCAGTGGCATAGCACAAAGG + Intronic
955188932 3:56742071-56742093 CAGTGAGTATCATGGCACAAGGG - Intronic
955676418 3:61453656-61453678 CCGTGAGTACCATGGCTCATAGG + Intergenic
956715504 3:72076248-72076270 CAGTGATTTTCAGGGAACAAGGG - Intergenic
960890667 3:122444221-122444243 CAGTGATTTTCAGGGAACAAGGG - Intronic
960902311 3:122564751-122564773 CAGTGAGTCTCTTGGCAGTAGGG - Intronic
962758568 3:138486981-138487003 CAGCGATTATCAGGGAACAAGGG - Intergenic
967965789 3:194959357-194959379 CAGTGAGTATCATGACCCCTGGG + Intergenic
970719622 4:18971111-18971133 CAGTGATTTTCAGGGAACAAGGG - Intergenic
970722367 4:19002633-19002655 CAGTGATTTTCAGGGAACAAGGG - Intergenic
976669782 4:87639214-87639236 CAGTGAGAATGAAGACACAACGG + Intergenic
977258363 4:94765790-94765812 CAGTGTGTTTCATGGAACAGTGG + Intronic
978352630 4:107836361-107836383 CAGTGAGTGTCACAGCACACTGG + Intronic
978734745 4:112073147-112073169 CAGTGATTTTCAGGGAACAAGGG + Intergenic
983219056 4:165026964-165026986 CAGAAACTCTCATGGCACAATGG - Intergenic
983705366 4:170651943-170651965 CAGTGATAATCATGCCTCAAAGG + Intergenic
988319011 5:29668980-29669002 GACTGAGAATCATGGCAGAAGGG - Intergenic
988936774 5:36091427-36091449 CAGTGATTATCATGGTAGCAAGG - Intergenic
989036002 5:37172624-37172646 CAGTAAGTTTCATGGGACAGGGG + Intronic
992522420 5:77568333-77568355 CAGTGAAAATCCTGGCACAAAGG - Intronic
993367278 5:87049435-87049457 CAGTGATTTTCAGGGAACAAGGG - Intergenic
996146885 5:119987469-119987491 CAGTGATTTTCAGGGAACAAGGG - Intergenic
997628042 5:135344659-135344681 CAGTGACTATCTTTGCACAGTGG + Exonic
997702970 5:135917822-135917844 CAGTGAGTATGAAGGCCCCAAGG + Intergenic
999563440 5:152830537-152830559 CAGTGTGTGTCATGGGGCAAAGG - Intergenic
1000691570 5:164327562-164327584 CAGTGATTTTCAGGGAACAAGGG - Intergenic
1000932773 5:167271847-167271869 ATGTCAGTATAATGGCACAAGGG + Intergenic
1001576496 5:172767910-172767932 AAGTGAGTATCATGAAACACCGG - Intergenic
1005527736 6:26667779-26667801 AAGTTAGAATCATGGCAGAAGGG + Intergenic
1005543059 6:26833899-26833921 AAGTTAGAATCATGGCAGAAGGG - Intergenic
1009013877 6:57876069-57876091 AAGTTAGAATCATGGCAGAAGGG - Intergenic
1011590904 6:88969846-88969868 CAGTGATTTTCAGGGAACAAGGG - Intergenic
1011801506 6:91021314-91021336 CACTGAGTCTAATGGCATAATGG - Intergenic
1012303095 6:97614342-97614364 CAGCTAGTATCATAGCAAAAGGG - Intergenic
1013182477 6:107729925-107729947 CAATGAGATTCATAGCACAATGG - Intronic
1013500239 6:110742455-110742477 CAGTGATTTTCAGGGAACAAGGG + Intronic
1016789695 6:148055085-148055107 CAGTGATTTTCAGGGAACAAGGG - Intergenic
1016921769 6:149302469-149302491 CAGGGAGTATAATTGCCCAAAGG + Intronic
1017854665 6:158339725-158339747 CAGTGATTTTCAGGGAACAAGGG - Intronic
1018122300 6:160647183-160647205 CAGTGGGTCCCATGGCATAAAGG + Intronic
1018139859 6:160820620-160820642 CAGTGATTTTCAGGGAACAAAGG + Intergenic
1021636385 7:22698274-22698296 CTGTGAGAATCATAGCACTAGGG - Intergenic
1022547086 7:31199895-31199917 CAGCCAGTGTCTTGGCACAAAGG + Intergenic
1025281419 7:57628404-57628426 CAGTGGGTATCATGTCCCAGTGG + Intergenic
1025303310 7:57837103-57837125 CAGTGGGTATCATGTCCCAGTGG - Intergenic
1027566563 7:79801954-79801976 CAGTGATTTTCAGGGAACAAGGG + Intergenic
1028350319 7:89838720-89838742 CAATGAGTATCATAGAACCATGG + Intergenic
1031513856 7:122679093-122679115 CAGTGATTTTCAGGGAACAAGGG + Intronic
1031763069 7:125738199-125738221 CAGTGATTTTCAGGGAACAAGGG - Intergenic
1035835711 8:2749868-2749890 CAGTGAGAATCCTAGCACAGTGG + Intergenic
1036118453 8:5987212-5987234 CAGTGATTTTCAGGGAACAAGGG - Intergenic
1036188075 8:6642703-6642725 CACTGAGTGTCCTGACACAACGG + Intronic
1038198022 8:25385775-25385797 CAGTAAGTATCATGGAGAAAAGG + Intronic
1043484304 8:80683633-80683655 CAATGAGCCTCTTGGCACAATGG + Intronic
1044070309 8:87751921-87751943 CAGTGATTTTCAGGGAACAAGGG - Intergenic
1044086306 8:87946009-87946031 CAGTGATTTTCAGGGAACAAGGG - Intergenic
1044182268 8:89210862-89210884 CAGTGATTTTTATGGAACAAGGG + Intergenic
1044307841 8:90657962-90657984 CAGTGATTTTCAGGGAACAAGGG - Intronic
1045593565 8:103627307-103627329 CAGTGATTTTCAGGGAACAAGGG - Intronic
1045954390 8:107889794-107889816 CAGTGATTTTCAGGGAACAAGGG - Intergenic
1046043999 8:108942315-108942337 CAGTGATTTTCAGGGAACAAGGG + Intergenic
1046300355 8:112278168-112278190 CAGTGAGTAGGGTGGCCCAAGGG + Intronic
1051736663 9:20206966-20206988 GAGTAAGTATAATGGCATAATGG - Intergenic
1055348712 9:75362872-75362894 CAGTGATTTTTATGGAACAAGGG - Intergenic
1055932193 9:81570995-81571017 CAGTGACTATCCTGCCAGAATGG - Intergenic
1056030720 9:82550535-82550557 CAGTGAGTTTAATAGCAAAATGG + Intergenic
1056082695 9:83113442-83113464 CAGTGATTTTCAGGGAACAAGGG + Intergenic
1056888334 9:90466085-90466107 CAGTGTGTTTCAGGGCACACTGG - Intergenic
1058105058 9:100961092-100961114 CTGTGTGTATCATTGCACACTGG + Intergenic
1060383518 9:123200249-123200271 AAGTGGGTTTCATGGCAGAATGG - Intronic
1060575680 9:124690859-124690881 AATTGTGTATCATGGCATAATGG - Intronic
1186898193 X:14026293-14026315 CAGTGAGCACAATGGCATAATGG + Intronic
1186994585 X:15106183-15106205 CAGTGATTTTCAGGGAACAAGGG - Intergenic
1195255340 X:103084321-103084343 CAGTGAGTGTCCTGGCAAAGTGG - Exonic
1195838282 X:109144027-109144049 CAGTGATTTTCAGGGAACAAGGG + Intergenic
1196311177 X:114167658-114167680 CAGTGATTTTCAGGGAACAAGGG - Intergenic
1196637036 X:118014091-118014113 CAGTGATTTTCAGGGAACAAGGG + Intronic
1197709042 X:129653399-129653421 CAGTGAGTTTCCTGGGGCAAGGG - Intronic
1198157646 X:133977597-133977619 CAGTGTGTATCATGTCACCCTGG - Intronic
1199360813 X:146916067-146916089 CAGTGATTTTCAGGGAACAAGGG - Intergenic
1202097801 Y:21271957-21271979 AAGTGACAATCATGGCAGAAGGG + Intergenic