ID: 955195486

View in Genome Browser
Species Human (GRCh38)
Location 3:56801786-56801808
Sequence GGCAGCCGCCATGGTGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 299}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955195486_955195497 13 Left 955195486 3:56801786-56801808 CCTTGGCCACCATGGCGGCTGCC 0: 1
1: 0
2: 3
3: 29
4: 299
Right 955195497 3:56801822-56801844 GGGATGTCACCGCTGACCCTAGG 0: 1
1: 0
2: 0
3: 13
4: 97
955195486_955195491 -8 Left 955195486 3:56801786-56801808 CCTTGGCCACCATGGCGGCTGCC 0: 1
1: 0
2: 3
3: 29
4: 299
Right 955195491 3:56801801-56801823 CGGCTGCCGGGCCTGCCCTTTGG 0: 1
1: 0
2: 1
3: 14
4: 192
955195486_955195492 -7 Left 955195486 3:56801786-56801808 CCTTGGCCACCATGGCGGCTGCC 0: 1
1: 0
2: 3
3: 29
4: 299
Right 955195492 3:56801802-56801824 GGCTGCCGGGCCTGCCCTTTGGG 0: 1
1: 0
2: 1
3: 21
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955195486 Original CRISPR GGCAGCCGCCATGGTGGCCA AGG (reversed) Intronic
900196871 1:1381023-1381045 GGCAGCCCCCAAGGTCGCCCTGG - Intergenic
900280368 1:1863423-1863445 GGCAGCAGCCACAGTGGGCAAGG - Intronic
900346144 1:2211083-2211105 GGCACCCGCCGTGGTGCCCAAGG - Intronic
900550085 1:3250253-3250275 GGCTGCCACCTTGGAGGCCACGG - Intronic
900796628 1:4712191-4712213 GGCGGCCGCCCTCGTGCCCAAGG + Exonic
900971924 1:5996553-5996575 GGAAGCCGGCAGGGTGGGCATGG - Intronic
901640159 1:10689016-10689038 AGCAGCGGCCAGGGTGGTCAGGG + Intronic
901787592 1:11635037-11635059 GCCAGCAGCCCTGGGGGCCATGG + Intergenic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
903900390 1:26640511-26640533 AACAGTGGCCATGGTGGCCACGG - Intergenic
903901280 1:26647527-26647549 AACAGTGGCCATGGTGGCCACGG + Intergenic
904493998 1:30876708-30876730 GACAGCCGCCGTGGTGGGCGGGG + Exonic
905167797 1:36093244-36093266 GGCCCCAGCCATGGTGGCAATGG - Exonic
905223421 1:36464346-36464368 GGGCGCCGCCATGCTGGCCCAGG + Exonic
905672258 1:39799550-39799572 GGCAGCGGCGACGGGGGCCATGG - Intergenic
905674702 1:39817258-39817280 GGCAGCGGCGACGGGGGCCATGG + Intergenic
905791066 1:40789877-40789899 GGCAGCCTCCTTTGTGGGCAGGG - Intronic
905876072 1:41432855-41432877 GGCAGGCTCCCTGCTGGCCATGG + Intergenic
909479518 1:76116438-76116460 GGCTGCCTCCATGGTAACCATGG - Intronic
914028030 1:143930371-143930393 CGCGGGCGCCATGGTGGCAATGG + Intergenic
914197357 1:145454467-145454489 GGCGGCCGCTATGGGGGCCCCGG - Intergenic
914900209 1:151707574-151707596 CACGGCAGCCATGGTGGCCATGG + Exonic
915082362 1:153360875-153360897 GGCCACAGTCATGGTGGCCACGG + Exonic
915758101 1:158282639-158282661 GGCAGGAGGCATGGTGGTCAGGG + Intergenic
918117303 1:181508445-181508467 CCCAGCAGCAATGGTGGCCAAGG - Intronic
923369391 1:233295466-233295488 CGCAGCCGGCATGGTGTCCCAGG - Exonic
923755131 1:236785244-236785266 GGGAGCAGCAGTGGTGGCCATGG + Intergenic
1062951288 10:1505738-1505760 GGCGGCTGCCATGGTGGGGACGG - Intronic
1063173650 10:3532721-3532743 GGCAGGCACCATCCTGGCCAGGG - Intergenic
1063239573 10:4153918-4153940 GGCAGCCCCCCTGGCAGCCAGGG + Intergenic
1063655141 10:7980813-7980835 GACAGCCACCATGGAGGCCAGGG + Intronic
1068381267 10:56255980-56256002 GGGAGCAGCCAAGATGGCCATGG - Intergenic
1068447862 10:57146484-57146506 GACATCAGCCAGGGTGGCCAAGG + Intergenic
1069535296 10:69248511-69248533 GGGGGCCGCCATGGTGACCGCGG + Exonic
1071158069 10:82713965-82713987 AGGAGCCGCCATGGTTGTCATGG + Intronic
1072152817 10:92696717-92696739 GGCCTCCTCCATGGAGGCCAAGG - Intergenic
1073823470 10:107291884-107291906 GACAACTGCCAGGGTGGCCAAGG - Intergenic
1074455514 10:113592425-113592447 GGGAGTCGCCAAGGTGGACATGG - Intronic
1074721700 10:116270948-116270970 GGCATCCGGCCTGGAGGCCAAGG - Exonic
1075139389 10:119818148-119818170 GACAGACTCCATCGTGGCCAGGG + Intronic
1075399603 10:122151507-122151529 GTGAGCAGCCAAGGTGGCCATGG + Intronic
1075441212 10:122480532-122480554 TGAAGCCCCCATGCTGGCCATGG + Intronic
1075486500 10:122826346-122826368 TGCAGGCCCCATGGAGGCCAAGG + Intergenic
1076056181 10:127375021-127375043 GGCAGCAGCCAAGGTCGCCCAGG - Intronic
1076329484 10:129654091-129654113 GGCAGCCACCGAGGTGGGCAAGG - Intronic
1076421587 10:130335852-130335874 GGCAGCCACCGTGGTGGGTAGGG + Intergenic
1076603617 10:131675289-131675311 GGCAGCAGCCAGGGCAGCCAGGG + Intergenic
1076629823 10:131845801-131845823 GGGAGCGGCCATGGTGACCATGG + Intergenic
1077184022 11:1228511-1228533 GGCAGCCCCCATGGATGGCAGGG + Intronic
1077328889 11:1975356-1975378 GGCACACACCAGGGTGGCCAGGG + Intronic
1079237108 11:18698877-18698899 CGCCGCCGCCATGGTGTCCCCGG + Exonic
1082785179 11:57312855-57312877 GGCTGCCTCCCTGGTAGCCAGGG + Exonic
1083448448 11:62726790-62726812 GGCGGCAGCCATGGAGGCCGCGG - Exonic
1083619522 11:64042039-64042061 GGCAGCGGCCATGGTGGGCCAGG + Intronic
1084084547 11:66849036-66849058 GGCAGGGGCCAAGGTGGCCAAGG - Exonic
1084165394 11:67372884-67372906 GGAACCCTCCATGGTGCCCACGG - Intronic
1085707362 11:78798756-78798778 GGGAGGCCCCCTGGTGGCCAAGG - Intronic
1086872389 11:92054328-92054350 GCCAGCTGCCACTGTGGCCAAGG + Intergenic
1202811868 11_KI270721v1_random:30535-30557 GGCACACACCAGGGTGGCCAGGG + Intergenic
1091802640 12:3334219-3334241 GGCAGCAGACATGGTGACCACGG - Intergenic
1093125368 12:15322445-15322467 GGCAGCCGCGGTGGTGGCGGCGG + Exonic
1093892168 12:24535067-24535089 GGAAGCCACCATGGAGCCCAAGG + Intergenic
1095258397 12:40068627-40068649 AACAGCCGCCAAGATGGCCAGGG + Intronic
1095313456 12:40728801-40728823 GGCAGGCAGCATGGTGGCCAAGG + Intronic
1095625036 12:44304478-44304500 GACACCAGCCAGGGTGGCCAAGG + Intronic
1096781515 12:53994841-53994863 GGCGGCGGCCGTGGTGGCCGGGG + Intronic
1097232844 12:57522824-57522846 CGCATGCGCCATGGGGGCCAGGG - Exonic
1100607509 12:96163646-96163668 GGCAGCCACCATGGTTGCAGTGG + Intergenic
1102678082 12:114672075-114672097 GGCCGCCGCCATGGAGGGCAGGG + Exonic
1102915656 12:116750099-116750121 GGTGGCCGCCATGGTGGAAATGG - Exonic
1102962033 12:117099271-117099293 GGCAGCGCCCATGGTGCCCGCGG + Exonic
1103972098 12:124678799-124678821 GGCAGCCGGCACCGTCGCCATGG - Intergenic
1106568954 13:30909477-30909499 AGCAGCCACCAAGATGGCCAGGG + Intronic
1107711835 13:43158239-43158261 GGGCACCTCCATGGTGGCCATGG + Intergenic
1109961720 13:69639703-69639725 GACACCAGCCAAGGTGGCCAAGG - Intergenic
1112187331 13:97139898-97139920 GGCAGCAGCTGTGGTGGGCAGGG + Intergenic
1112562960 13:100529906-100529928 GGGAGGCGCCATGGTGGCCGTGG - Intronic
1112652560 13:101415849-101415871 GGCAGCGGCCCTGGTGCCGAGGG + Intronic
1112692882 13:101916634-101916656 GGCCGCGGCCATGGTGGCCCCGG + Intronic
1113798063 13:113070196-113070218 GGCAGCCGCCCTGATGCTCACGG + Intronic
1117843087 14:59881200-59881222 GGCACAAGCCAGGGTGGCCAAGG - Intergenic
1117870700 14:60197767-60197789 GACAGCAGCCAGGGTGGCCAAGG + Intergenic
1118603575 14:67487280-67487302 GGAAGGGGCCCTGGTGGCCAGGG - Intronic
1119083816 14:71721751-71721773 GACACCAGCCATGGTGGCCAAGG - Intronic
1119147358 14:72329462-72329484 GGCAGGCGGCCTGGTGGCCAAGG + Intronic
1119149311 14:72343674-72343696 GGCAGCTGCCAGGGTGGCCCGGG - Intronic
1119304179 14:73593767-73593789 GCCAGCCTCCTTGCTGGCCATGG + Exonic
1119745898 14:77043730-77043752 CACAGCCTCCATGGTTGCCATGG - Intergenic
1119780063 14:77271288-77271310 GCCAGCCGCTATGGTGGCCTGGG + Exonic
1119788026 14:77327210-77327232 AGGAGCTGCCTTGGTGGCCACGG + Intronic
1120392314 14:83924469-83924491 GGAAGCAGCCATGGTGGGCATGG - Intergenic
1121051186 14:90819925-90819947 GGCAGCTGCCAGAGTGGCCCGGG - Intergenic
1121123600 14:91392111-91392133 AGCAGCTGTCATGGTGGCCATGG - Intronic
1121522573 14:94596506-94596528 GGCAGACACCATCTTGGCCAAGG + Intronic
1122393518 14:101407020-101407042 GGCAGCCACCCAGGTGTCCATGG - Intergenic
1122412868 14:101534865-101534887 GGCAGCCACCATGGTCGGCAGGG + Intergenic
1122517604 14:102319755-102319777 CGCATCCGCCATGGCGGCCGAGG - Exonic
1123007466 14:105330715-105330737 GGCAATCGCCATGGTACCCAGGG + Intronic
1124368516 15:29090451-29090473 GCCAGCCCCCAGGGTGGCCCTGG - Intronic
1126979647 15:54227388-54227410 GGCAGGCTCCATGGTGGAAAGGG - Intronic
1127155835 15:56123556-56123578 GACACCAGCCAGGGTGGCCAAGG - Intronic
1127271151 15:57403178-57403200 GGCAACCTCCATGGTGGTCTTGG + Intronic
1127359518 15:58232548-58232570 AGCAGCTGCCATGGTGGGCCTGG + Intronic
1130046639 15:80450916-80450938 GGTGGCCGCCATGGGGGCAACGG - Exonic
1130715571 15:86330110-86330132 GGCAGCAGCCACAGTGGGCAGGG - Intronic
1131259202 15:90879898-90879920 CGCAGGCGCCATGGTGGCCCTGG + Exonic
1131323585 15:91421254-91421276 GACACCAGCCAGGGTGGCCAAGG - Intergenic
1131478670 15:92763501-92763523 GGTGGCCTCCATGGTGTCCAGGG - Intronic
1132798880 16:1741708-1741730 GGCTGCCTTCACGGTGGCCAGGG + Intronic
1132959265 16:2613057-2613079 GGCAGCCCCCATGGGGGAGACGG - Intergenic
1132972325 16:2695032-2695054 GGCAGCCCCCATGGGGGAGACGG - Intronic
1132973393 16:2699925-2699947 GGCTGCCACCAGGCTGGCCAGGG - Intronic
1133054176 16:3137283-3137305 GGCAGCCCCCTTGGAGGCCCAGG + Exonic
1134474815 16:14564031-14564053 GTCGGCCTCCATGGTGGCCAAGG - Intronic
1138360872 16:56425817-56425839 GGCCGACGGCCTGGTGGCCAGGG - Intergenic
1139252607 16:65510429-65510451 GGCAGCCCCCAGGGGGGCCGAGG + Intergenic
1140209109 16:72957431-72957453 AGCAGGCGTCATGGCGGCCATGG + Exonic
1141002108 16:80317830-80317852 GGCAGGCGCCAGTGTGGGCAAGG + Intergenic
1141479906 16:84299654-84299676 GGCAGCCACCATGCGGGCCTCGG + Intronic
1141647032 16:85373140-85373162 AGCAGCAGCCAATGTGGCCATGG + Intergenic
1141647042 16:85373173-85373195 GGCACCCACCCTGGTGGACAAGG - Intergenic
1141912098 16:87067100-87067122 GGCAGGCGCCAAGGGGGGCAAGG + Intergenic
1142110409 16:88328066-88328088 GGCACACGCCATGGGAGCCACGG + Intergenic
1142429005 16:90016429-90016451 GGCAGCCCCCAAGGTCTCCAGGG + Intronic
1142766150 17:2065343-2065365 GCCAGCCACCATGGAGGCCCAGG - Intronic
1142849724 17:2698548-2698570 GGCAGCCACCAGGGGCGCCATGG - Exonic
1143633397 17:8151295-8151317 CGCCGCCGCCACGGTCGCCAGGG + Intronic
1143788166 17:9272275-9272297 GGCAGCGTCCTTAGTGGCCAAGG - Intronic
1144272992 17:13637211-13637233 TGGAGCCGCCATGTTGGACAAGG + Intergenic
1144530562 17:16034787-16034809 GGCAGACGCCAGGGTGGGCCTGG - Exonic
1146485016 17:33235686-33235708 GGCTGCCTCCATGGAGGCCAAGG - Intronic
1147442983 17:40458677-40458699 GGCAGCCGCCGTGGTGCCTCAGG - Intergenic
1149421057 17:56511113-56511135 CGCAGCGGCCGTGGTGGCCCAGG + Intronic
1150357253 17:64497143-64497165 GGCGTCCGCCATGGTGGGCGGGG - Intergenic
1150445392 17:65224269-65224291 GGCTGGGGCCATGGTGGCCCAGG + Intronic
1150791253 17:68201413-68201435 GGCAGGCGCCCTGGCAGCCAGGG - Intergenic
1151564279 17:74888919-74888941 GGCAGTCCCCATGGTGACCCAGG + Intronic
1151882501 17:76903873-76903895 AGCAGCCTCCAAGGCGGCCAGGG - Intronic
1152076714 17:78164504-78164526 GGCAGGGGCCAGGGTGGGCATGG - Intronic
1152138511 17:78522236-78522258 GGTAGCCGCCATGGTGGCCGTGG - Intronic
1152381527 17:79944831-79944853 GGCAGCAGGCAGGGTGGCCACGG + Intronic
1152678382 17:81653251-81653273 GTCAGCCACCAGGGTGGCCGGGG - Exonic
1152815866 17:82407450-82407472 GCCAGCCGCCCAGGAGGCCAAGG - Intronic
1155184270 18:23373462-23373484 GGCAGCCACCACAGTGCCCAGGG + Intronic
1158137598 18:54224237-54224259 GGCAGCGGCCTTGGCGGCGACGG - Exonic
1160802112 19:974925-974947 GGCAGTGGCCATGCTGGCCGTGG + Exonic
1160818501 19:1047207-1047229 GGCAGCCTTCGCGGTGGCCACGG + Exonic
1161047904 19:2146171-2146193 TGCAGCCGTCATGGTGGGGAGGG - Intronic
1161061471 19:2217276-2217298 GGCAGGTGCCATGGAGGACATGG + Intronic
1161433093 19:4245565-4245587 GGGTTCCACCATGGTGGCCATGG + Intergenic
1161686997 19:5707839-5707861 GGGAGCTGCCTCGGTGGCCAGGG + Intronic
1161752511 19:6108817-6108839 GGCAGCCGCCAGAATGGCCCGGG + Intronic
1161999394 19:7733549-7733571 GGCAGTGGCTAGGGTGGCCAGGG + Intronic
1162026814 19:7899071-7899093 TGCGGCCACCATAGTGGCCATGG + Exonic
1162861065 19:13506149-13506171 GGCAGCCGCCGGGGTGGTCGTGG - Exonic
1162909272 19:13840649-13840671 GGGCGCCGCCATGCTGGGCACGG - Intergenic
1162917087 19:13880490-13880512 GGCAGCCTCCTAGGTGGACATGG - Exonic
1163154172 19:15431147-15431169 GGAAAACGCAATGGTGGCCATGG - Intronic
1163728208 19:18934362-18934384 GGAAGCAGCCAGGCTGGCCAGGG - Exonic
1163737730 19:18991725-18991747 GACAGCTTCCATGTTGGCCATGG - Intronic
1164989941 19:32675956-32675978 GGGAGCCACCGTGGAGGCCAGGG + Exonic
1165466728 19:35979060-35979082 TGCAGTTGCCATGGAGGCCACGG - Intergenic
1165533336 19:36422049-36422071 GCCAGCCTCCTTGCTGGCCATGG + Intergenic
1165792618 19:38500969-38500991 GGCAGCCGCCTCGCTGGACACGG + Exonic
1165849123 19:38838970-38838992 GGGGGCCGCCATGGTGGAGATGG - Exonic
1166053278 19:40273888-40273910 GGCAGCCTCCATAGGGGCCTTGG - Intronic
1166247317 19:41538354-41538376 GGCACCTGCCAAGGTTGCCAGGG + Intergenic
1167013872 19:46826913-46826935 TCCAGCAGCCCTGGTGGCCAGGG - Intergenic
1167056062 19:47112337-47112359 GGCGGCCGCCATGTTGGGCCGGG - Intronic
1167419516 19:49394833-49394855 GGCAGCCACCATGGTGGCGTGGG + Intronic
1167459045 19:49614784-49614806 AGCAGCTGCCATGGTGGCCCAGG + Intronic
1167594060 19:50418270-50418292 GGCAGCCACCAGGGTCCCCAGGG - Intronic
1167858927 19:52267578-52267600 GGCACACTCCATGGTGGCCTAGG - Intergenic
1168064279 19:53910196-53910218 GGAGGCAGCCAGGGTGGCCAGGG + Intronic
1168064559 19:53911659-53911681 GGAGGCAGCCAGGGTGGCCAGGG + Intronic
1168301507 19:55407577-55407599 GGCCGCAGCCATGGTGAGCACGG - Exonic
926150840 2:10424854-10424876 GGCACCTTCCAGGGTGGCCAGGG - Intronic
927723511 2:25403306-25403328 GGGTTCCGCCATGTTGGCCAGGG + Intronic
928052486 2:28013841-28013863 GGGAGCAGCCATGGAAGCCATGG - Intronic
929532892 2:42763537-42763559 GGCAGCTGCCCGGGTGGCCGGGG - Exonic
929965142 2:46529014-46529036 GGCAGCCTCCAGAGGGGCCAAGG + Intronic
932100980 2:68898659-68898681 GGAAGGGGCGATGGTGGCCATGG + Intergenic
934521464 2:95022682-95022704 GGCACCTGCCCTGGTGGACAGGG - Intergenic
934696661 2:96405063-96405085 GGCAGCTGCCGTTGTGCCCAGGG + Intergenic
935384381 2:102485715-102485737 GGCAGGGGCCATGTTGGCCCTGG + Intronic
943681211 2:190769998-190770020 GGCATCCTTCATGGTGGCAAAGG - Intergenic
943967260 2:194353432-194353454 GACACCAGCCAGGGTGGCCAGGG + Intergenic
947118457 2:226795637-226795659 GGCAGCAGCCATGGTGGCCCTGG + Exonic
947587370 2:231364885-231364907 AGCAGCCCCCAAGGTGGTCAGGG - Intronic
947812018 2:233010756-233010778 GGCAGCCATCCTGGAGGCCAGGG - Intronic
947885568 2:233566744-233566766 GGGCGCCGCCATGTTGGCGAGGG + Intronic
948459280 2:238121302-238121324 GGCATCTCCCATGGTGTCCAGGG + Intronic
948932526 2:241141362-241141384 GGCAGCCACCGGAGTGGCCATGG - Intronic
949075563 2:242055440-242055462 GTCAGGAGCCATGGGGGCCATGG - Intergenic
1168753194 20:297973-297995 GGCGGCCGCCATGGCGACCCCGG + Exonic
1169169801 20:3455800-3455822 GGCTTCAGCCATGTTGGCCAGGG - Intergenic
1172128505 20:32639756-32639778 GGCAGTGGCCAAGGTGGCCTTGG - Intergenic
1172181890 20:33008556-33008578 GGCAGCGGCCAGGGCAGCCATGG + Exonic
1172700718 20:36852221-36852243 GGGAGGGACCATGGTGGCCAGGG - Intronic
1172812623 20:37660021-37660043 GGCATTCACCATGTTGGCCAGGG + Intergenic
1176064584 20:63188008-63188030 GGGGGCCTCCATGCTGGCCATGG + Intergenic
1176179420 20:63742449-63742471 GGCAGGCGGCATGGAGGCCGTGG - Exonic
1176259131 20:64169991-64170013 GGCAGCCTCCATGGCAGCCTGGG - Intronic
1178900276 21:36592824-36592846 GGCAGTGGGCAAGGTGGCCAGGG - Intergenic
1179708211 21:43194603-43194625 GGCTGCCGGCATGGAGGTCAAGG - Intergenic
1179883314 21:44302462-44302484 GGCAGCAGCAGTGGTGGCCTGGG - Intronic
1179917695 21:44488384-44488406 GGCACCTGCCAAGGTCGCCAGGG + Intergenic
1179925050 21:44529645-44529667 GGCAGCGGTCATATTGGCCAGGG - Intronic
1180001591 21:44997734-44997756 TGCAGCCTCCACAGTGGCCAGGG + Intergenic
1180220616 21:46355872-46355894 GGCAGCCACCCTGGGGGTCATGG + Intronic
1181275401 22:21684862-21684884 GGCAGCCACCATGAAGGCCCCGG + Exonic
1182157746 22:28091634-28091656 GGCTGACCCCATGGTGGACATGG + Intronic
1182858491 22:33538685-33538707 GGCAGCCACCATGCTTGGCACGG + Intronic
1183748452 22:39705612-39705634 GGCATAGGCCATGCTGGCCAGGG + Intergenic
1184836981 22:47029609-47029631 GGCAGCCTCGATCTTGGCCAAGG + Intronic
1184924190 22:47625916-47625938 GGCAGAGGGCAGGGTGGCCAGGG - Intergenic
1185345872 22:50310351-50310373 GGCAGCCGGGAGGGTGACCAAGG - Exonic
949500571 3:4676692-4676714 GGCAGCAGCCATGGGAGTCATGG - Exonic
950147932 3:10665030-10665052 GGGAGCCACCATGGTTGCCTAGG - Intronic
950316377 3:12004872-12004894 CGCAGCCGCCAGGAAGGCCAAGG + Exonic
952342983 3:32460547-32460569 GGCAGACGGCATGGAGGCCGAGG - Intronic
952409269 3:33032786-33032808 TGCAGCTGCCATGGTAGCCTAGG - Intronic
954155788 3:48684417-48684439 CACAGCAGCCATGGTGTCCACGG + Intronic
954431574 3:50473505-50473527 GGCAGCCCCACTGGGGGCCAAGG + Intronic
954665145 3:52247649-52247671 GGCAGCAGCTAAGGTGGCCTCGG + Intronic
954733553 3:52685805-52685827 AGCAGCAGCCGTGGCGGCCACGG - Exonic
955195486 3:56801786-56801808 GGCAGCCGCCATGGTGGCCAAGG - Intronic
955688402 3:61566697-61566719 GAGTGCCGCCATGTTGGCCAGGG + Intronic
956655983 3:71550923-71550945 TGAAGCCGCCATTGTTGCCAGGG + Intronic
957300034 3:78380146-78380168 GGCAGCAGCATTGGTGACCATGG - Intergenic
958839453 3:99186239-99186261 GACACCAGCCATGTTGGCCAAGG + Intergenic
960939184 3:122922475-122922497 GGCGGCAGCCCTGGTGGCCGGGG - Intronic
961028926 3:123585157-123585179 GGCAGCCGCCATCTTGGCTGAGG + Exonic
961295772 3:125883104-125883126 GGCAGCAGCCAGGGAAGCCAGGG - Intergenic
961512139 3:127409600-127409622 GGCAGCCACCACGGGGGCCGGGG - Intergenic
961563121 3:127745143-127745165 GAAAGCCGCCATCGGGGCCAGGG + Intronic
962598978 3:136976271-136976293 GGCAGCAGTCATGGTGGGTAGGG + Intronic
964370708 3:155997309-155997331 GGCTTTCGCCATGTTGGCCAGGG - Intergenic
967840931 3:194003869-194003891 GGTTCCCGCCGTGGTGGCCACGG + Intergenic
968830646 4:2931603-2931625 GGCACCCTGGATGGTGGCCATGG + Exonic
968902976 4:3439838-3439860 GACATTCGCCATGCTGGCCATGG + Exonic
968975958 4:3822176-3822198 GGCAGCCTCCCTGGGGTCCAAGG - Intergenic
970194589 4:13542175-13542197 GGCAGCCGACCTGCTGGCCTCGG - Exonic
970612553 4:17739254-17739276 GGGATCCGCCATGGTGGCTGAGG - Intronic
971444228 4:26725136-26725158 GGCAGCAGCCATGAAGACCATGG - Intronic
972638440 4:40904839-40904861 GGCAGAGACCACGGTGGCCAGGG + Intronic
974292224 4:59947793-59947815 GACGGCAGCCAGGGTGGCCAAGG + Intergenic
974530963 4:63107468-63107490 GACAGCAGCTATGGAGGCCATGG + Intergenic
975109654 4:70609219-70609241 GGCAAACACCAAGGTGGCCAGGG + Intergenic
978934687 4:114359980-114360002 GGCACCAGCCTGGGTGGCCAAGG - Intergenic
979155984 4:117391774-117391796 GACATCAGCCACGGTGGCCAAGG + Intergenic
986208449 5:5648002-5648024 CGCAGCAGGCATGGTGGTCAAGG + Intergenic
990946232 5:61252667-61252689 TGAAGCCGCCGTGGTGGCCGCGG + Intergenic
992027107 5:72681315-72681337 GGCAGCAGCCATGGTAGGCAAGG + Intergenic
992078907 5:73216160-73216182 GGCGGCGGCCAGGGCGGCCAGGG + Intergenic
992166189 5:74054311-74054333 GTCAGGGGCCATGGTGGCTATGG - Intergenic
992934460 5:81687502-81687524 GACACCAGCCAGGGTGGCCAAGG + Intronic
994853762 5:105090630-105090652 GACACCAGCCATGGTGGCTAAGG + Intergenic
995271744 5:110227830-110227852 GGCACCGCCCATGGTGGGCAGGG - Intergenic
997529459 5:134572977-134572999 GGCTCACGCCATGCTGGCCAAGG - Intronic
1001147243 5:169195504-169195526 GTCAGCCCCAGTGGTGGCCAGGG - Intronic
1001260814 5:170227019-170227041 GACAGCCCCCATGGTGGCCAGGG - Intergenic
1001598572 5:172914477-172914499 GGCAGACCCCAGGGTGGCCCCGG + Intronic
1002174193 5:177392177-177392199 GTGAGCCACCATGCTGGCCAAGG - Intronic
1002499502 5:179638661-179638683 GGCAGCCCCCAAGCTGGACAGGG - Intergenic
1002515045 5:179751510-179751532 GGCTTTCGCCATGCTGGCCAGGG - Intronic
1004516853 6:16327999-16328021 GGCAGGCAGCGTGGTGGCCACGG + Exonic
1004548352 6:16621527-16621549 GGCATTCTCCATGTTGGCCAGGG - Intronic
1006010031 6:31034963-31034985 GGGAGCCACCAAGGAGGCCACGG + Exonic
1006079750 6:31558404-31558426 GGCTGCAGCCCTGGTGGCCAGGG + Exonic
1006312630 6:33271646-33271668 CGCAGCCGCCATGGTCGCAGCGG + Exonic
1006644371 6:35505944-35505966 GGGATCCGGCATGGGGGCCACGG - Intronic
1010514110 6:76752858-76752880 GACACCAGCCAGGGTGGCCAAGG + Intergenic
1011108044 6:83804460-83804482 AGCAGAGGCCATGGTGGCCCTGG - Intergenic
1013062024 6:106644062-106644084 GGGTGTCGCCATGTTGGCCAGGG + Intronic
1013934942 6:115582822-115582844 GGGAGCCTCCCTGGTGGACATGG + Intergenic
1014392243 6:120877140-120877162 GGCAGACCCCATGAAGGCCAAGG - Intergenic
1014430573 6:121365694-121365716 GACACCAGCCAGGGTGGCCATGG + Intergenic
1015578886 6:134702157-134702179 GACACCAGCCAGGGTGGCCAAGG - Intergenic
1018774354 6:166999424-166999446 GGCGGCCGCAGTGGTGGCCGAGG + Exonic
1019095851 6:169578269-169578291 GGCAGCCCACATGGTCGCTATGG - Intronic
1019132552 6:169887991-169888013 GGCAGCTGCCATTGTAGACAAGG - Intergenic
1019267007 7:123369-123391 GGCTGCTGCCATGGTGGCTGTGG - Intergenic
1019377127 7:698865-698887 GACAGCCGCCATGGTGGGTGAGG - Intronic
1021808217 7:24377569-24377591 TGCAGCAGCCATGGGGGTCATGG - Intergenic
1022480630 7:30741009-30741031 GGCAGCAGCCAGGGTGTGCAGGG + Intronic
1023108007 7:36782175-36782197 CCCAGCAGCCATGGTGGCCCTGG + Intergenic
1023861635 7:44220529-44220551 GGCAGCCACCATGCTGTCCCTGG + Intronic
1023872963 7:44272600-44272622 TGCTGCCGACATGGTTGCCAGGG - Intronic
1024507302 7:50172801-50172823 GGCAGCTGCCATGGCAGCAAAGG - Intergenic
1030953836 7:115825924-115825946 GGCAGCTGTCCTTGTGGCCAGGG + Intergenic
1033684184 7:143623774-143623796 AGCAGCAGCAATGGTCGCCATGG - Intronic
1033687360 7:143702993-143703015 AGCAGCAGCAATGGTCGCCATGG - Exonic
1033700428 7:143833849-143833871 AGCAGCAGCAATGGTCGCCATGG + Intergenic
1036797224 8:11764970-11764992 GGGTTCCGCCATGTTGGCCATGG - Intergenic
1037151061 8:15635703-15635725 GGCAGCAGCCATGCTAGTCAAGG - Intronic
1037951135 8:23019360-23019382 GCCAGCCGCCCTGGAGGCCGTGG - Intronic
1044921563 8:97175003-97175025 GGCAGAAGCCAGGGAGGCCAAGG - Intergenic
1047209371 8:122828637-122828659 GGCGGCAGCCCTGGTGGCCATGG + Intronic
1047435818 8:124834788-124834810 GGCAGCAGCCGTGGCAGCCAAGG - Intergenic
1049451808 8:142666038-142666060 GGCAGCCGGCTTGGAGGCCATGG + Exonic
1049592551 8:143469153-143469175 GGCAGCTTCCTGGGTGGCCAGGG - Intronic
1049773042 8:144392530-144392552 GGCGGCCTACATGGTGGACATGG + Exonic
1049797223 8:144502387-144502409 AGGAGCCTCCATGGGGGCCAGGG + Intergenic
1049963728 9:760134-760156 CAAACCCGCCATGGTGGCCATGG - Intergenic
1051991813 9:23161313-23161335 GGCACCAGCCATGATGGACAGGG - Intergenic
1054762499 9:69015598-69015620 GGCGGCTGACATGGTGGCCTGGG - Intergenic
1056797660 9:89669793-89669815 GGCAACAGCCAGGATGGCCAAGG + Intergenic
1056931417 9:90880955-90880977 CGCAGCTGCCATGCTGCCCAAGG - Intronic
1057030180 9:91769368-91769390 GGCTGCCACCAAGGAGGCCAGGG - Intronic
1057458554 9:95237525-95237547 GGCGGCCGCCGTGTTGGACAGGG - Intronic
1058754905 9:108075226-108075248 GGCAGCAGCCAGAGTGGCCCAGG + Intergenic
1060283503 9:122228908-122228930 GGCAGCAGCCAGGGAGGCCGGGG - Intronic
1060539469 9:124419892-124419914 GGCAGCAGCCATGCTGGGCAGGG - Intergenic
1061399673 9:130361549-130361571 GGCACCAGCCATGATGCCCAGGG - Intronic
1061804092 9:133128518-133128540 GTCAGCCGCCATCCTGGCCCCGG + Intronic
1062151675 9:135022525-135022547 GGCAGGCGCCACAGTGGCCCAGG + Intergenic
1062177336 9:135171083-135171105 GGCCTCTGCCCTGGTGGCCATGG + Intergenic
1062595472 9:137297146-137297168 GGCAGGCCCCTTTGTGGCCAGGG - Intergenic
1062595787 9:137298573-137298595 GGCAGCCCCAGTGATGGCCAGGG - Intergenic
1062696325 9:137877958-137877980 GGCGGCCGCTATGGGGGCCCCGG + Exonic
1062718757 9:138023878-138023900 GGCTGCGGCCATGGGGTCCACGG + Intronic
1190924892 X:54894324-54894346 GCCAGCAGCAGTGGTGGCCATGG - Intergenic
1192088088 X:68121690-68121712 GACACCAGCCATGGTGGCTATGG + Intronic
1192487181 X:71537997-71538019 GGCAGCCGCCTTGGTAGCAGCGG + Exonic
1193076702 X:77363144-77363166 GCCAGCCTCCACAGTGGCCACGG - Intergenic
1193469041 X:81876773-81876795 TGCAGCCGGCATGGTGGCAGTGG + Intergenic
1194033366 X:88842417-88842439 TGCAGCCTCCATGATGGCGATGG - Intergenic
1197796600 X:130305188-130305210 GGCATCAGCCATGGAGGGCAGGG + Intergenic
1198406640 X:136319312-136319334 GTCAGCTGCCATGTTTGCCAGGG - Intronic
1199499777 X:148496976-148496998 GGTAGTCCCCATGGTGCCCATGG + Intergenic
1200258172 X:154596881-154596903 GGAAGCAGCCTTGGTGGACAGGG + Intergenic