ID: 955195516

View in Genome Browser
Species Human (GRCh38)
Location 3:56801882-56801904
Sequence GCCGCCGCCGCCCGGCATCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 246}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955195516_955195519 -2 Left 955195516 3:56801882-56801904 CCACGATGCCGGGCGGCGGCGGC 0: 1
1: 0
2: 4
3: 20
4: 246
Right 955195519 3:56801903-56801925 GCGACACGGAGACCGACAGCCGG 0: 1
1: 0
2: 0
3: 2
4: 50
955195516_955195522 10 Left 955195516 3:56801882-56801904 CCACGATGCCGGGCGGCGGCGGC 0: 1
1: 0
2: 4
3: 20
4: 246
Right 955195522 3:56801915-56801937 CCGACAGCCGGCTTCTAGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 58
955195516_955195525 24 Left 955195516 3:56801882-56801904 CCACGATGCCGGGCGGCGGCGGC 0: 1
1: 0
2: 4
3: 20
4: 246
Right 955195525 3:56801929-56801951 CTAGCCGGGCAGGACTCGACTGG 0: 1
1: 0
2: 0
3: 0
4: 30
955195516_955195520 9 Left 955195516 3:56801882-56801904 CCACGATGCCGGGCGGCGGCGGC 0: 1
1: 0
2: 4
3: 20
4: 246
Right 955195520 3:56801914-56801936 ACCGACAGCCGGCTTCTAGCCGG 0: 1
1: 0
2: 0
3: 0
4: 29
955195516_955195526 25 Left 955195516 3:56801882-56801904 CCACGATGCCGGGCGGCGGCGGC 0: 1
1: 0
2: 4
3: 20
4: 246
Right 955195526 3:56801930-56801952 TAGCCGGGCAGGACTCGACTGGG 0: 1
1: 0
2: 0
3: 1
4: 45
955195516_955195523 14 Left 955195516 3:56801882-56801904 CCACGATGCCGGGCGGCGGCGGC 0: 1
1: 0
2: 4
3: 20
4: 246
Right 955195523 3:56801919-56801941 CAGCCGGCTTCTAGCCGGGCAGG 0: 1
1: 0
2: 0
3: 6
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955195516 Original CRISPR GCCGCCGCCGCCCGGCATCG TGG (reversed) Intronic
900118954 1:1040545-1040567 CCCGCCCCCGCGCCGCATCGGGG - Intronic
900160693 1:1222133-1222155 TCCGTCGCTGCCCGGCATCCTGG - Intronic
900359357 1:2280612-2280634 GCCGCCGCCGCCTGTCTTCTCGG - Intronic
900359364 1:2280655-2280677 GCCGCCGCCGCCTGTCTTCTCGG - Intronic
900359371 1:2280698-2280720 GCCGCCGCCGCCTGTCTTCTCGG - Intronic
900359391 1:2280828-2280850 GCCGCCGCCGCCTGTCTTCTCGG - Intronic
900359398 1:2280871-2280893 GCCGCCGCCGCCTGTCTTCTCGG - Intronic
900359405 1:2280914-2280936 GCCGCCGCCGCCTGTCTTCTCGG - Intronic
900359412 1:2280957-2280979 GCCGCCGCCGCCTGTCTTCTCGG - Intronic
900359419 1:2281000-2281022 GCCGCCGCCGCCTGTCTTCTCGG - Intronic
900359426 1:2281043-2281065 GCCGCCGCCGCCTGTCTTCTCGG - Intronic
900641715 1:3690794-3690816 GTCGTGGCCGCCCGGCAGCGTGG - Intronic
901066640 1:6497457-6497479 GCCGCGGCGGCCCCGCCTCGGGG + Intronic
902690538 1:18107957-18107979 GCCGCCGCGGCCAGGCAGCCCGG - Exonic
903828624 1:26161888-26161910 TTCGCCGCCGCCCGGCTCCGGGG + Exonic
903923395 1:26817332-26817354 GCCGCCGCCGCCCGACCGCCGGG + Intergenic
904794795 1:33051202-33051224 GCCGCCGCCGCCCGACCGCCGGG + Intronic
905414385 1:37794395-37794417 GCCGCCGCCGCCCCGCACCGCGG + Exonic
905867136 1:41382460-41382482 GCCGCCGCCGCCGGGCCGCTGGG + Exonic
906436899 1:45803928-45803950 GCCGCCGCCGCCCGACCGCCGGG + Exonic
906486625 1:46240363-46240385 GCCGCCGCCGCCCGACCGCCGGG + Intergenic
907010633 1:50959898-50959920 GCCGCCGCCGCCGGGCGCCGAGG + Exonic
907038360 1:51236448-51236470 GCCGCCGCCGCCCCGCGGGGGGG + Exonic
907444566 1:54499516-54499538 GCCGCCGCCGCTCGGCGAGGCGG - Intergenic
917359315 1:174159349-174159371 GCCGCCGCCGCCCGGCAGAGTGG + Intergenic
919847038 1:201648808-201648830 GCCGCCGCCGCCGGGCGCCTTGG - Exonic
919916970 1:202144775-202144797 GCCGCCGCCGCCCTCCCTCGCGG + Intergenic
921414471 1:214870536-214870558 GCCGCCGCCGCCCGACCACCGGG - Intergenic
922134901 1:222815135-222815157 CGCGCCGCCGCCCGGCGCCGCGG + Intergenic
923783009 1:237042462-237042484 GCCGCCGCCGCCGAGCTCCGCGG + Exonic
924259246 1:242212595-242212617 GCAGCAGCCGCCAGGCAGCGGGG + Intronic
924436677 1:244048895-244048917 GCCGCCGCCGCCGGACTTGGTGG - Intergenic
1063035671 10:2284438-2284460 GCAGCCACCGCCCAGCATGGGGG - Intergenic
1063498340 10:6530504-6530526 GCCGGCTCTGCCCGGCAACGGGG + Intronic
1064030503 10:11880014-11880036 GCCCCAGCCACCCTGCATCGTGG + Intergenic
1064208965 10:13347769-13347791 GCCGCCGCCGCGCGGGGCCGGGG - Intronic
1065342979 10:24723688-24723710 GCCGCCGCCGCCGCGCTCCGAGG + Intergenic
1066406909 10:35127082-35127104 GGCGCCGCCGCCCAGCAACCCGG - Intronic
1067369776 10:45672589-45672611 GCTGCCGCCGCCGGCCGTCGTGG - Intronic
1070140325 10:73733398-73733420 GCTGCCGCCGCCCCGTCTCGGGG - Intergenic
1070570646 10:77637747-77637769 GCCGCCGCCGCCGCGGAGCGCGG + Intronic
1070570677 10:77637845-77637867 GCCGCCGCCGCCCGCCCGGGGGG + Intronic
1071618083 10:87094639-87094661 CCCGCCGCCGCCCCGCAGCCGGG - Exonic
1072891541 10:99329496-99329518 GCCGCCGCCGCCTGGCTGCTGGG + Exonic
1072950151 10:99840239-99840261 GCCGCCGCCGCCCGACCGCCGGG - Intronic
1075768946 10:124917259-124917281 GCCGCCGCCGCCAGGTAACCGGG + Intergenic
1076298290 10:129404327-129404349 GCCGCCACCGACAGGCGTCGGGG + Intergenic
1076401880 10:130190216-130190238 GCCGCCACCGCCCGCCGCCGAGG - Intergenic
1076749859 10:132537325-132537347 GCCGCCGGCGCCCGGAACCCAGG + Intergenic
1077309747 11:1883036-1883058 GCCCCAGCAGCCCGGCCTCGCGG + Intronic
1083904889 11:65662975-65662997 CCCGCCGCCGCCCGGCGCAGGGG + Exonic
1084122675 11:67078409-67078431 GCCGCCTCCGCCCAGCCTTGGGG + Intergenic
1089442906 11:118531243-118531265 GCCCCCGCCCCCCGCCACCGGGG - Intronic
1089543663 11:119206280-119206302 GCCGCCGCCGCCGGCTATCCGGG - Exonic
1091762470 12:3096108-3096130 GCCGCCGCCGCCCGACCGCCGGG - Intronic
1092172758 12:6384045-6384067 GCCCCTCCCGCCCCGCATCGAGG + Exonic
1095439318 12:42227061-42227083 GCCGCCGCCGCCCGACCGCCGGG + Intronic
1096022510 12:48333877-48333899 GCCGCCGCCGCCCGACCGCCGGG - Intergenic
1096848154 12:54419078-54419100 GCCGCCGCCACCCAGGGTCGGGG - Exonic
1098426085 12:70366614-70366636 GCCGCCGCCGCGCGACAGCAGGG - Exonic
1101150365 12:101877708-101877730 GCCGCCGCCTCCAGGCAGCCCGG + Exonic
1101356809 12:103986628-103986650 GCCTCTGCCTCCCGGGATCGAGG - Intronic
1102647655 12:114414288-114414310 GACGCGGCCGCCCGGCCTCTCGG + Intergenic
1103074159 12:117968910-117968932 GCTGCCGCCGCCGGGCTCCGGGG + Intronic
1103954247 12:124567581-124567603 GCCGCGGCCGCCGGGGAGCGCGG - Intronic
1105472065 13:20703730-20703752 GCCGCCGCCGCCCCGAGCCGGGG - Intronic
1106776812 13:33016785-33016807 GCCGCTGCAGCCCGCCACCGGGG + Exonic
1107595684 13:41960956-41960978 GCCACGGCGGCCCGGCCTCGCGG - Exonic
1108373355 13:49792301-49792323 GCCGCCGCCTCCCGTCACCGCGG - Intronic
1112652760 13:101416513-101416535 GCCGCCGCCGCCGGGCAGGCTGG + Intergenic
1113981574 13:114281390-114281412 GCCGCCGGCGCCCCGCTTCCGGG + Intergenic
1114069770 14:19097718-19097740 GCCGCCGCCGGCCACCGTCGTGG + Intergenic
1114092492 14:19302285-19302307 GCCGCCGCCGGCCACCGTCGTGG - Intergenic
1115399455 14:32939959-32939981 GCCGCCGCCTCCCTGCCTCCCGG + Intronic
1118030469 14:61813044-61813066 CCCGCTGCCACACGGCATCGAGG - Intergenic
1118186649 14:63543600-63543622 GCCGCTTCCGCCCGGCAGTGGGG + Intergenic
1118351004 14:64972376-64972398 GCCGCCGCCGCCCCGGAGAGAGG + Intronic
1121042215 14:90758573-90758595 GCAGCCGCCGCCAGGGGTCGCGG - Intronic
1122690323 14:103529202-103529224 GCCGCCGCCGCCGCGCGTCGCGG + Exonic
1122719867 14:103716021-103716043 GCCGCCCCGGCCCGGCCCCGCGG + Intronic
1122964049 14:105112809-105112831 GCCGCCGCCGCCCGACCGCCGGG - Intergenic
1125524837 15:40368305-40368327 GCTGCCGCCGCCCGGCGGCCAGG + Exonic
1125852801 15:42920623-42920645 GCCGCCGCCGCCAGTAAACGCGG - Intronic
1128374790 15:67066737-67066759 GCCGCCGCCTCCCGCCCCCGCGG + Intronic
1129814620 15:78540705-78540727 GCCCCCGCCGGCCGCCGTCGGGG + Intronic
1131144337 15:90001667-90001689 GCCCCCGCCGGCCGGCAGCGCGG - Intronic
1132186727 15:99807077-99807099 GCCGCCGTCGCCACGCACCGAGG + Intergenic
1132428960 15:101745634-101745656 GCCGCCGTCGCCACGCACCGAGG - Intronic
1132661558 16:1063612-1063634 GCCGCTGCCGCCCAGTATGGGGG - Intergenic
1132704530 16:1237367-1237389 ACCGCCGCATCCCAGCATCGGGG - Intergenic
1132706983 16:1249058-1249080 ACCGCCGCATCCCAGCATCGGGG + Intergenic
1133063893 16:3192620-3192642 GCCGACGCCCCCCGGGATCGTGG - Intergenic
1134134352 16:11669190-11669212 GCCGGCGCCGCCGGGCAGGGTGG + Intronic
1136318312 16:29466699-29466721 GCCAGCGCAGCCCAGCATCGCGG - Exonic
1136432887 16:30206048-30206070 GCCAGCGCAGCCCAGCATCGCGG - Exonic
1137618207 16:49858860-49858882 CCCGCCGGCGCCTGGGATCGAGG + Intergenic
1138450777 16:57092574-57092596 GCCGCCGCCGCCCGCCCGCCCGG + Exonic
1138651575 16:58464065-58464087 CCCGCCGCCTCCGGGCGTCGCGG - Exonic
1139364884 16:66427179-66427201 GCTGCCTCGGCCCGGGATCGCGG + Intergenic
1139435471 16:66934347-66934369 CCCGCCGCCGCCTACCATCGCGG + Exonic
1140223186 16:73058439-73058461 GCCGCCACCGCCCGGACGCGGGG - Intronic
1145205640 17:20983902-20983924 GCCGCCGCCGCCCGACCGCCGGG + Intergenic
1146229487 17:31095282-31095304 TCCGCCGCCCCCCGGCCGCGGGG + Exonic
1146256009 17:31391848-31391870 GCCCGCGCCGCCCGCCATCCGGG - Exonic
1147143728 17:38473663-38473685 GCCCCCGCACCCCGGCATCACGG - Intronic
1147686262 17:42288514-42288536 GCCGCCGCCGCCAGGAACCCCGG + Exonic
1147963157 17:44179904-44179926 GCCGCCGCCGCCCGACCGCCGGG + Intergenic
1148060131 17:44830325-44830347 CCCGCCGCGGCCCGGGAGCGGGG + Intronic
1148337430 17:46851335-46851357 GCCGCGCCCGCCCGGGGTCGCGG - Intronic
1149908700 17:60550736-60550758 GCCGCCGCCGCCCGACCGCCGGG + Intergenic
1149996717 17:61409635-61409657 GCCGGCGCCGCCCGGCCTCGCGG - Intergenic
1150311081 17:64129975-64129997 GCTGCTGCTGCCCGGCCTCGGGG - Exonic
1150549033 17:66192097-66192119 GTCGCCGCCGCCCAGCAGCCCGG + Intergenic
1150561972 17:66302500-66302522 GCCCCCGCCGCTCGTCCTCGCGG + Intergenic
1153514432 18:5891179-5891201 GCGGCCGCCGCTCGGCGCCGCGG + Exonic
1153711956 18:7809195-7809217 GCCGCCTCCTACCGGCATCCTGG - Intronic
1155221469 18:23689687-23689709 GCGGCGGCCGCGCGGCCTCGGGG + Exonic
1155392132 18:25349692-25349714 GGCGCCGCGGCCCGGCAGCCAGG + Intronic
1156036625 18:32772139-32772161 GCCGCCGCCGCCCGGCTCGGAGG + Exonic
1158436059 18:57436048-57436070 GTCGCCGCCGTCCAGGATCGAGG - Exonic
1158601944 18:58863514-58863536 GCCGCCGCCGCCCGGCCCGGCGG + Intronic
1158954700 18:62526616-62526638 GCCGCCGCCGCCGCGCACCCGGG + Intronic
1160199826 18:76787370-76787392 GCCGCGCCCACCCGGCATGGGGG + Intergenic
1160703654 19:519321-519343 GCCGCCGCCCCCCGACGGCGCGG - Exonic
1160745440 19:709100-709122 CCCGCCCCCGCCCGGCACCGCGG + Exonic
1160897205 19:1408353-1408375 GCCGCCGCCTCCCGGCTTCCTGG + Intronic
1161802683 19:6424644-6424666 GCCGCCGCCGCCCGCCGGCGGGG - Exonic
1162470866 19:10871471-10871493 GTCGCCGCGGCCCGGCCCCGTGG - Intergenic
1162954721 19:14091386-14091408 CCCGCCGCCGCTCGGCCTCCTGG + Intergenic
1163807084 19:19405931-19405953 CCCTCCGCCGCCCGGCCCCGCGG + Intronic
1164653367 19:29901815-29901837 GCCGCCGCCGCCCGACCGCCGGG - Intergenic
1165850861 19:38849706-38849728 GCCGCCGCCGCCCGCCGCCCCGG + Exonic
1166261410 19:41644132-41644154 GCCGCCGCCGCCCGACCGCCGGG + Intronic
1166361637 19:42255023-42255045 GGAGCCGCGGCCCGGAATCGGGG - Exonic
1166780653 19:45340884-45340906 GCCCCCGCCCCCCATCATCGCGG - Intronic
1167391261 19:49196647-49196669 GCCGGCGCCGCCCGGCTCCCTGG + Exonic
1168154021 19:54463370-54463392 GCCGGCGCCGCCTGGCCGCGAGG - Exonic
1168339176 19:55613990-55614012 GCCCCTGCCGCCCGCCTTCGGGG + Exonic
927567270 2:24123770-24123792 GCCGCAGGCGCCCGGCCTAGTGG + Intronic
928186412 2:29115253-29115275 GCCGGGGCCGCCTGGCTTCGCGG + Intronic
929777428 2:44937927-44937949 GCCTCCGCCTCCCGACATCCTGG + Intergenic
930787148 2:55282099-55282121 GCAGGCGCCGCCCCGCAGCGAGG + Intergenic
933908239 2:86914788-86914810 GCCGCCGCCGCCCGTCCAGGTGG - Intronic
934079048 2:88452271-88452293 GCCGCCGCCCCCCGGGGCCGCGG - Exonic
935248167 2:101237327-101237349 GCCCCCACCCCCCGGCATGGTGG + Intronic
936038398 2:109129980-109130002 GCCCCCGCCGCCCGCGAGCGTGG - Exonic
941906122 2:170716901-170716923 GCCGCCGCCGCCCTACAAAGAGG + Exonic
944457614 2:199911533-199911555 GCCGCTGCCGCCCGGGTTCATGG - Exonic
948116033 2:235494629-235494651 GCCGCCGCCGCCCCGCGCCCCGG - Exonic
948910305 2:240999251-240999273 GCGGCAGCCGCCGGGCACCGAGG + Intronic
1169214733 20:3786517-3786539 GCCGCCGCCGCCCCGGGGCGGGG + Exonic
1172277227 20:33686285-33686307 GCCGCCGCCGCCTGTCACCCGGG - Exonic
1172640188 20:36436104-36436126 GCCGCCGCCGCCGGGCACCTGGG - Exonic
1172668228 20:36615331-36615353 GCCTCAGCCGCCCTGCATCCTGG - Exonic
1173279815 20:41618204-41618226 GCCGCCGCAGCCCCTCATCCCGG + Intronic
1175428783 20:58888948-58888970 GCCCGCGCCCCCCGCCATCGCGG + Intronic
1175926780 20:62475204-62475226 GCCGCCGCTGCCGGGCCCCGAGG + Exonic
1176062693 20:63179157-63179179 GCCGCCTCCGCCCCGCCCCGCGG - Intergenic
1176217718 20:63956131-63956153 GGCGCCGCCGCCTGGCCTCCGGG + Intronic
1176550163 21:8217355-8217377 GCCGCCGCCGCCGCGCGCCGAGG - Intergenic
1176569091 21:8400390-8400412 GCCGCCGCCGCCGCGCGCCGAGG - Intergenic
1176577005 21:8444625-8444647 GCCGCCGCCGCCGCGCGCCGAGG - Intergenic
1176952669 21:15064962-15064984 GCCGCCGCCTCCCGAGTTCGGGG + Exonic
1178487398 21:33027671-33027693 GCCGCCCCCGCCCCCCAGCGGGG - Exonic
1178992522 21:37367365-37367387 GGCCCCGCCGCCTGGAATCGGGG + Intronic
1179511816 21:41878805-41878827 GACGACGCCGCCCGGCGGCGGGG + Exonic
1180488237 22:15820281-15820303 GCCGCCGCCGGCCACCGTCGTGG + Intergenic
1180962033 22:19766491-19766513 GCCGCCGGCCCCGGGCAGCGAGG - Exonic
1182667595 22:31970872-31970894 GCCGCGGCCGCCAGGCTCCGTGG + Intergenic
1183708145 22:39487593-39487615 GCCGCTGCCGCCCAGCAAGGCGG + Exonic
1183845077 22:40536326-40536348 GCCGCCGCCGCCCGACCGCCGGG + Intronic
1184662613 22:45972322-45972344 AGCGCCGCCGCCCTGCATCGGGG - Intronic
1185255072 22:49827409-49827431 GCCGCCTCGGCCCGGCCTCTCGG - Intronic
1185321277 22:50201219-50201241 GGCGCCGCCGCCCGGTCCCGAGG + Exonic
1203255056 22_KI270733v1_random:133687-133709 GCCGCCGCCGCCGCGCGCCGAGG - Intergenic
1203263112 22_KI270733v1_random:178766-178788 GCCGCCGCCGCCGCGCGCCGAGG - Intergenic
950829244 3:15859017-15859039 ACCGCTCCCGCCCGGCAGCGGGG + Intronic
952301276 3:32106564-32106586 GCCACCCCCGCCCGGCGCCGGGG - Exonic
952382888 3:32818196-32818218 GCCGCCGCCCCCCGACGACGTGG - Exonic
953909282 3:46883505-46883527 GCCGCCGCCGCCGGCCCTGGTGG - Exonic
954080492 3:48210750-48210772 GCCGCCGCCGCCCGACCGCCAGG + Intergenic
955195516 3:56801882-56801904 GCCGCCGCCGCCCGGCATCGTGG - Intronic
955916481 3:63912635-63912657 GCCGCCGCCGCCGCGCGGCGCGG - Exonic
959419621 3:106112747-106112769 GCCGCCGCCGCCCGACCGCCGGG - Intergenic
961664395 3:128487025-128487047 GCCGCCGCCGCCGGCCATGGAGG - Exonic
962583540 3:136819225-136819247 GCCGCCGCCGACCGGCTCCCGGG - Exonic
966866111 3:184260004-184260026 GCCGCCGCCGCCAGGCACTCCGG - Exonic
968353337 3:198080748-198080770 GCCGCCCCCTGCCGGCAGCGCGG - Intergenic
968803160 4:2756196-2756218 GCAGCCGCTGTCCGGCCTCGTGG + Exonic
968879785 4:3293001-3293023 GCCACCGCCCCCCGGGGTCGAGG - Intergenic
969240349 4:5893050-5893072 GCCGCCGCAGGCCCGCACCGAGG - Exonic
970202879 4:13627488-13627510 GCCGCCGCCGCCGGGCCCCGGGG - Exonic
970333081 4:15003944-15003966 GCTGCCGCCGCCCGGGGTGGTGG - Exonic
972533052 4:39977571-39977593 GCCGCCGCCGCCCGCCCGCCCGG + Exonic
973996891 4:56467631-56467653 GCTGCCGCCGCTCGCCATCTTGG - Exonic
978777201 4:112516013-112516035 GCCGCCGCCGCCGGGGCTCTTGG - Exonic
981128399 4:141132617-141132639 GCCGCCGCCGCCCGCCGCCCCGG + Exonic
982616133 4:157637867-157637889 GCCGCCGCCGCCCGACCGCCGGG - Intergenic
987050347 5:14143370-14143392 GCCGCCGGCGCCCGTGATCCCGG + Intergenic
992373686 5:76170962-76170984 GCCGCCGCCGCCCGACCGCCGGG + Intronic
993502075 5:88675874-88675896 GCCGCCGCCGCCCGCGCTCTCGG + Intergenic
995052737 5:107724770-107724792 GCCGCCGCCGCCGGGGGCCGGGG - Intergenic
998071064 5:139198305-139198327 GCCGCGGCCGCCTGGAATTGTGG - Exonic
1000985213 5:167858732-167858754 GCCGCCGCCGCCCGACCGCCGGG + Intronic
1001529865 5:172454328-172454350 GCCGCCGCGGCGCAGCATCGTGG - Exonic
1002186166 5:177455779-177455801 GCCGCCGCCGCCCTATAGCGAGG + Exonic
1002341446 5:178518916-178518938 GCCGCCGCCGCCCGACCGCCGGG - Intronic
1002580940 5:180209140-180209162 GCCGCCGCCGCCCGACCGCCCGG + Intronic
1002895554 6:1378270-1378292 GCAGCCGCCGCCGGGCACCGCGG - Intergenic
1004216788 6:13711265-13711287 GCCGCCGCCCCCGGCCACCGCGG - Exonic
1005583144 6:27251744-27251766 GACACCGCCGCCCGGCACTGTGG - Exonic
1005883206 6:30075414-30075436 TCCGCCGGCGACCGGCACCGAGG - Exonic
1005959933 6:30687278-30687300 GCCGCCCCCGCCCGGCCCCCTGG - Exonic
1006492097 6:34396882-34396904 GCCGCCGCCGCCCGACCGCCGGG + Intronic
1007327288 6:41072475-41072497 GCCGCCCCCGCCCGGTAGCGGGG + Exonic
1007674461 6:43581666-43581688 GCCGCCGCCGCCCGACCGCCGGG - Intronic
1013225593 6:108117859-108117881 GCCTCCACCGGCCGGCCTCGGGG - Intronic
1014724990 6:124962684-124962706 GCCACCGCCGCTCGGCTCCGCGG - Exonic
1015476505 6:133664192-133664214 GCCGCCGCCGCCCGACCGCCGGG + Intergenic
1015625873 6:135181002-135181024 GCCGCCGCGACCCGGGAGCGGGG + Intergenic
1016714141 6:147204238-147204260 GCCGCCGCCGCCTCGCTCCGCGG - Intergenic
1017672409 6:156779286-156779308 GCCGCCGCCGCCTGGGACTGGGG - Exonic
1019474157 7:1236125-1236147 GCCGCCGCCGCCCGCCGCCAAGG + Exonic
1021872114 7:25017857-25017879 GCCGCCGCCGCCCGACCGCCGGG + Intergenic
1022375228 7:29806425-29806447 GCCGCCGCCGCCCCGCGGCAGGG - Intergenic
1022485121 7:30771810-30771832 GCTGCCGCCGCCCCGGAGCGCGG - Intronic
1029496349 7:100897100-100897122 GGCGCCGCCGCCAGGGACCGCGG + Intergenic
1032525833 7:132577563-132577585 CCCGCCGCCGCCCGGCTTGCCGG + Intronic
1033159100 7:138981278-138981300 GGCGCCCCGGCCCGGCCTCGCGG + Exonic
1034618151 7:152436203-152436225 GCCGCCCCCGCCGGGCCCCGCGG - Intergenic
1035508139 8:150703-150725 GCCGCCGCCGCCCGACCGCCGGG - Intergenic
1036536903 8:9658414-9658436 GCCGCCGCCGCCCGACCGCCGGG - Intronic
1036910779 8:12755438-12755460 GCCGCCGCCGCCCGCCGCCACGG + Exonic
1037620879 8:20562458-20562480 GCCCCCCCCGCCCGGCCCCGTGG + Intergenic
1037816847 8:22116964-22116986 GCCGCCGCAGCCCTGCATCCAGG + Exonic
1037980104 8:23247019-23247041 GCTGCCCCCGCCCGCCCTCGCGG - Intronic
1038727564 8:30095257-30095279 GCCGCCGCCGCCCCGACTGGGGG - Intergenic
1038727616 8:30095468-30095490 GCCGCCGCCGCCTCGGGTCGTGG + Exonic
1040599517 8:48870231-48870253 GCCGCCACCGCCCGGCCGGGAGG + Intergenic
1043463919 8:80486775-80486797 GCCGCCGCCGCCCGGTGCCCCGG - Exonic
1044660437 8:94590117-94590139 GCCGCCGCCGCCCGACCGCCGGG + Intergenic
1046871294 8:119208374-119208396 GCCGCCGCCGCTCAGCTCCGCGG - Exonic
1047687089 8:127315782-127315804 GCCGCCGCCGCCCGACCGCCGGG + Intergenic
1048484238 8:134832214-134832236 GCCGCCGCCGCGCGCCATGACGG - Intergenic
1049145976 8:141001271-141001293 GCCGACGCAGCACGGCCTCGAGG - Intronic
1049419546 8:142510758-142510780 CCCGCCGCCGCCAGGCCCCGCGG - Intronic
1049565251 8:143334784-143334806 TCCCCCGCCGCCCGGCCTCCCGG - Exonic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1052362162 9:27573222-27573244 GCCGCCGCCGCCGGGAAGCCCGG + Intronic
1053312077 9:37026606-37026628 GCCGCCGCCTCCCGGCGCCAAGG + Intronic
1053457039 9:38241453-38241475 GCCGCCGCCGCCCGACCGCCGGG + Intergenic
1056475276 9:86946750-86946772 GCCGCCGCCGCCCAGCAGCGCGG + Exonic
1056475286 9:86946773-86946795 GCCGCCGCTGCCCGCGATGGTGG - Exonic
1058053290 9:100427261-100427283 GCCGCCGCCGCCCGGCGTTCGGG + Intronic
1059210831 9:112513613-112513635 GCCGCCGCCGCCCGACCGCCGGG + Intronic
1060064750 9:120494966-120494988 GCCGCCGCCGCCCGACCGCCGGG + Intronic
1060347375 9:122828586-122828608 GCCGCCGAAGCCCGACAGCGCGG + Exonic
1060979822 9:127785683-127785705 GCCGCCTCCGCCGGGCTGCGCGG - Intronic
1061975836 9:134067735-134067757 GCGGCGGCCGCCCGGGGTCGCGG - Intronic
1061984119 9:134119156-134119178 GCCGCCGCCGCCCGACCGCCGGG - Intergenic
1062430658 9:136525582-136525604 GCCGCCGCAGCCCCGCACCCAGG - Intronic
1203771065 EBV:50427-50449 GCGGCCGGCGCCCGTCCTCGGGG - Intergenic
1203471456 Un_GL000220v1:116827-116849 GCCGCCGCCGCCGCGCGCCGAGG - Intergenic
1203479277 Un_GL000220v1:160799-160821 GCCGCCGCCGCCGCGCGCCGAGG - Intergenic
1185457621 X:318713-318735 GCCGCGGCCGCTCGGCTCCGCGG - Exonic
1185457752 X:319230-319252 GCCGCCGCCGCCGAGGCTCGGGG - Intergenic
1191618341 X:63190429-63190451 GCCGCCGCCGCCCGACCGCCGGG - Intergenic
1192361749 X:70445104-70445126 GCCGCCGCCGCCGGGCTCCCTGG - Exonic
1192621051 X:72680747-72680769 GCCGCCGCCGCCCGACCGCCGGG + Intronic
1195036350 X:100973487-100973509 GCCGCCGCCGCCCGACCGCCGGG - Intronic
1195716949 X:107826685-107826707 GCCGCCCCCGCCCCGCACCCCGG - Intronic