ID: 955197555

View in Genome Browser
Species Human (GRCh38)
Location 3:56819339-56819361
Sequence TAAAACATGGAGAAGGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 469
Summary {0: 1, 1: 1, 2: 3, 3: 39, 4: 425}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955197555 Original CRISPR TAAAACATGGAGAAGGATGA GGG (reversed) Intronic
901411647 1:9088348-9088370 TAATAGGTGGAGAAGGAGGAGGG - Intronic
901784505 1:11615900-11615922 TAAAATATGGATGATGATGATGG - Intergenic
902444210 1:16451835-16451857 TAGAACATGAAGAAGAAGGAAGG + Exonic
903361747 1:22781332-22781354 AAAAAGAAGAAGAAGGATGAGGG + Intronic
903441115 1:23388532-23388554 TAAACCATGGAGAAGAATGCTGG + Intronic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
905704857 1:40047654-40047676 TAAAACATGTAGAAGTAGAAAGG + Intronic
905865943 1:41376888-41376910 AAAAACATAGAGCAGGATCAGGG + Intronic
906261623 1:44396054-44396076 TAAAAAATGGAGAATAATGATGG + Intergenic
906415360 1:45617574-45617596 GAAAACATGGAGGAGGAGGTGGG + Exonic
906474594 1:46160315-46160337 TAAAACATGGAAGAAGAAGATGG + Intronic
907179936 1:52560636-52560658 AAAATCCTGGAGATGGATGATGG + Intergenic
907385594 1:54123343-54123365 TATAAAATGGAGATAGATGATGG + Intergenic
908441864 1:64163085-64163107 TAAAAGATGGAGGAGTCTGAGGG + Intronic
908779507 1:67676820-67676842 TTAAACTTGGAGAAGAATGAAGG + Intergenic
909010388 1:70328214-70328236 TAAAATATTGAGAAGGATAAAGG + Intronic
909250726 1:73352125-73352147 TAAAACATGGACAAGGGAGCGGG + Intergenic
910035637 1:82784299-82784321 TAAATCATGGTGGAAGATGAAGG + Intergenic
910502667 1:87910676-87910698 TAAAACATTGTGAAGTATGCAGG - Intergenic
911157325 1:94649876-94649898 TTGAACATGCAGAAGCATGATGG + Intergenic
912028426 1:105207517-105207539 TAAAACAAGTAGAAGCTTGAAGG + Intergenic
912280857 1:108311874-108311896 TCAAACATGCGGAAGGATGATGG - Intergenic
912311164 1:108622854-108622876 TAAAACAGGGAGGTGGCTGAAGG - Intronic
912451371 1:109769701-109769723 TAAGAGATTGGGAAGGATGAGGG + Intronic
914250155 1:145915398-145915420 TAAATCACTGAGAAAGATGAAGG + Intronic
916191405 1:162182064-162182086 TAGTACATGAAGAAGGAAGATGG - Intronic
916803643 1:168237807-168237829 TAAGATATGGAGAAGGATGCTGG + Intronic
916865072 1:168847926-168847948 TAAAACATGTTGGAGGAAGAAGG + Intergenic
917020593 1:170582085-170582107 TGTAACATGGAGGTGGATGAAGG - Intergenic
918000950 1:180495046-180495068 TAAAACTGGGACAAGGAAGATGG + Intronic
918016597 1:180639828-180639850 TCAAACATGGAAGAGGATAAAGG + Intronic
918365883 1:183807222-183807244 TCAAACATGTGGAAGAATGAAGG + Intronic
920285983 1:204880153-204880175 TTAAACATGGACAGGGATGAGGG - Intronic
920447328 1:206028609-206028631 TAAAAGATGGAAAAGGAGGGAGG - Intergenic
920546142 1:206820233-206820255 TAAGACAAGGGAAAGGATGAAGG + Intronic
920601696 1:207331777-207331799 AAAAACGTCTAGAAGGATGAAGG - Intronic
921037530 1:211396085-211396107 TAGAAAATGGAAAAGGAGGACGG - Intergenic
921952769 1:220948522-220948544 TAAAATATGTGGAAGGGTGAAGG - Intergenic
922061254 1:222094564-222094586 GAAGCCATGGAGAAGGAGGATGG - Intergenic
922897452 1:229111452-229111474 CATGACATGGGGAAGGATGAAGG + Intergenic
923359705 1:233198896-233198918 TAATGAATCGAGAAGGATGAGGG + Intronic
923460202 1:234203060-234203082 TGAAACATGGAGAAAGGAGAAGG - Intronic
923513411 1:234673302-234673324 TCACACAGGGAGAAGGATGTAGG + Intergenic
923718844 1:236450129-236450151 TAAAAGATGATGAATGATGAGGG + Intronic
924672171 1:246140194-246140216 TAAAACAGGTAAAAGGATGATGG + Intronic
924827937 1:247561623-247561645 TAATAAATGGAGAAGGAAAATGG - Intronic
1064196857 10:13250706-13250728 TAAAGCAGAAAGAAGGATGAAGG + Intergenic
1064894235 10:20215846-20215868 TAAAACCGGGAGAATCATGATGG + Intronic
1065050373 10:21785800-21785822 AAAAAGATGGAAAAGGAGGAGGG + Intronic
1065282072 10:24149612-24149634 TAAAAATGGGAGAAGGATGAAGG + Intronic
1065933760 10:30502151-30502173 TAAAACATTAAGAAACATGATGG - Intergenic
1066543077 10:36470129-36470151 TTTACCATGGAGAAGAATGAGGG + Intergenic
1066637505 10:37520770-37520792 AAATACATGGAGAGGGATAATGG + Intergenic
1067241023 10:44493694-44493716 AAAAAGAAAGAGAAGGATGAAGG - Intergenic
1068460898 10:57327045-57327067 TAAAAAAAGGAGGAGGAAGAAGG - Intergenic
1068752294 10:60608974-60608996 TAAAACATAGAAAATCATGAGGG - Intronic
1069981539 10:72256050-72256072 GAAAACATCTAGAAGGATGCTGG - Intergenic
1070047752 10:72855870-72855892 TAAAACATGGATAAGGTAAAAGG + Intronic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070729460 10:78815719-78815741 TAACACATGGAGAACAGTGATGG - Intergenic
1071778094 10:88811577-88811599 TAGAGAATAGAGAAGGATGAAGG - Intronic
1072101574 10:92234117-92234139 AAAAAAAAGGAGAAGGATAAAGG + Intronic
1072135415 10:92540891-92540913 TAAAACACAGAGTAGGATGTAGG + Intronic
1072487765 10:95872804-95872826 TAAAACCTGGAGAAAGAAGATGG - Exonic
1072618483 10:97064777-97064799 TAAAGCATGGAAAAGGAAGGAGG - Intronic
1073740982 10:106406572-106406594 TAAAAGAAAGAGAAGGATGGAGG + Intergenic
1075372914 10:121952990-121953012 AAAAGCATAGTGAAGGATGAAGG - Intergenic
1077346432 11:2058873-2058895 TAAAGCATGGAGAAAGAGAATGG - Intergenic
1079270851 11:18984377-18984399 TAAGAGTTGCAGAAGGATGAAGG - Intergenic
1079365293 11:19803730-19803752 AAAAGCAGGGAGAAGAATGAGGG - Intronic
1080680761 11:34473648-34473670 AAAAAAAAGGAGGAGGATGAGGG - Intergenic
1081752959 11:45525065-45525087 AAAAAGATAGAGAAGGATAAGGG - Intergenic
1082720203 11:56665013-56665035 AAAAACATGGAGAATGAGGCTGG + Intergenic
1082968271 11:58990890-58990912 TAAAAATTGGACAAGGATTATGG - Intronic
1085874329 11:80387825-80387847 TAAAGCATATAGAAGGATGCAGG - Intergenic
1085923152 11:80982598-80982620 TAATACATTGAGGAGGATGTGGG - Intergenic
1089042778 11:115469366-115469388 TATAAAATGGGGAAGGATAATGG - Intronic
1089913625 11:122128981-122129003 AAATACATGGAGAATTATGAAGG + Intergenic
1090072005 11:123551864-123551886 CGAAAAATTGAGAAGGATGATGG - Intronic
1090647835 11:128780238-128780260 GAAAACAAGGAGGGGGATGACGG - Intronic
1090981671 11:131727849-131727871 TAAAACATGCAGAAGACAGAGGG - Intronic
1091079880 11:132656466-132656488 TTAAAAAGGGAGAAGGAGGAAGG - Intronic
1092020173 12:5195427-5195449 TAAATCTGGGAGAAGAATGATGG - Intergenic
1093056298 12:14559088-14559110 TAAAAAATGGAAAAGTATAATGG - Intronic
1093385212 12:18544778-18544800 GAAACCAAGGAGATGGATGAGGG - Intronic
1093820015 12:23603710-23603732 GAACACATGGAAAAGGATCAGGG - Intronic
1093960768 12:25270392-25270414 TAAAACAGGGATGGGGATGAGGG + Intergenic
1094134820 12:27113684-27113706 GAAAAAATGGAGTAGGATAAGGG - Intergenic
1094352172 12:29539409-29539431 TAATAAAAGGAGAAGAATGAGGG - Intronic
1094794237 12:33951771-33951793 TACAACATGGAGTAAGGTGAAGG - Intergenic
1095359382 12:41318002-41318024 TAAAGCAATGAGAAGAATGAAGG - Intronic
1096510089 12:52122893-52122915 AAAGACATGTAGAAGGAGGAAGG - Intergenic
1097644843 12:62224169-62224191 TAAAACATGGAGGAGGTTTTAGG + Intronic
1097894438 12:64810253-64810275 GAAAACATGGAGAAGGAGAATGG - Intronic
1098281313 12:68865491-68865513 AAGAAGATGGAGAAGGATGAGGG - Intronic
1098622175 12:72614984-72615006 TATAAATTGGAGAAGGAGGAGGG + Intronic
1099210200 12:79776148-79776170 TAAAACATGTATCAGGAAGAAGG + Intronic
1099210877 12:79787027-79787049 TAAAGCAGGGATAAGGAAGAAGG - Intronic
1099831583 12:87850229-87850251 AAATACATGCAGAGGGATGAGGG + Intergenic
1100212232 12:92409551-92409573 TAAAGCATGAGGAAGGATGTAGG - Intergenic
1100743172 12:97617546-97617568 TAAAACAAGGAGAAAGAAAAAGG + Intergenic
1100833284 12:98539351-98539373 TAAAACATGTAGAAGAGTGGAGG + Intronic
1101023564 12:100578135-100578157 GTAAACCTGGAGAAGGATGATGG + Intronic
1101310923 12:103578133-103578155 AAAAACCTGGAGATGGATGGTGG + Intergenic
1101353226 12:103952821-103952843 AAAGACATGGAGGAGGATGAGGG + Intronic
1101646989 12:106640657-106640679 TAATACTTAGAGAAGGGTGAAGG - Intronic
1102787632 12:115617460-115617482 TAACACAAGGACAATGATGATGG + Intergenic
1106167479 13:27261689-27261711 CAAATCATGGGGAAGGATGAAGG - Intergenic
1106228274 13:27801469-27801491 CAGAGCATGGAGAAGTATGATGG + Intergenic
1106520506 13:30493413-30493435 GCAGACATGGAGAAGGATAAGGG + Intronic
1107972695 13:45659362-45659384 TAAAACATTGTGCAGGATAAGGG - Intergenic
1108128968 13:47276557-47276579 CAAGGCATGGAGAAGGAGGAAGG + Intergenic
1108361803 13:49674699-49674721 TAAAGGATGGAGGAAGATGAGGG + Intronic
1108411346 13:50150588-50150610 TAATAAATGGATAAGGATTATGG + Intronic
1108973131 13:56402143-56402165 AAAAAAATGGAGAAAGATGGTGG + Intergenic
1109163545 13:59005370-59005392 AAAAAAATGGAGAAAGATAAGGG - Intergenic
1109911048 13:68910900-68910922 AAAAAAAAAGAGAAGGATGAGGG - Intergenic
1110252090 13:73391750-73391772 TCACCCAGGGAGAAGGATGAAGG + Intergenic
1110372543 13:74756167-74756189 AAAAACATGAAAAAGCATGAAGG + Intergenic
1110559348 13:76893837-76893859 TAAAACCAGGAGAAGGATACAGG - Intergenic
1111018202 13:82408446-82408468 GAAAACATGTAGAAGGTTCATGG - Intergenic
1111978834 13:94995951-94995973 TAAAAATTGGAGTAAGATGAAGG + Intergenic
1112379043 13:98871349-98871371 GAATACATGGAGAAGAATGATGG + Intronic
1112464196 13:99629391-99629413 TAAAACCTGGAGGAGGGGGAAGG - Intronic
1112857492 13:103789244-103789266 GAAAAGATTGAGAAGAATGAGGG + Intergenic
1114863843 14:26562523-26562545 AAAGACAAGGAGAAGGGTGAGGG + Intronic
1115138016 14:30134440-30134462 AAAAACATGGAGAATGAAGTAGG - Intronic
1116097709 14:40392711-40392733 TGAGACATGGAAAATGATGATGG + Intergenic
1116245152 14:42401508-42401530 CAAAATTTGGAGAAAGATGATGG - Intergenic
1116423802 14:44765498-44765520 TAAAACCTGAGGAAGGATAATGG + Intergenic
1118263790 14:64273823-64273845 TGAAAAATAGAGAAGGAGGAGGG - Intronic
1118411779 14:65487114-65487136 TCTAACTTGGAGAAGGATGGTGG + Intronic
1118832835 14:69450850-69450872 TAAAACAGGAAGAAGAATAATGG - Intronic
1121391146 14:93575936-93575958 TAAAACATGGAACATGATTATGG + Intronic
1126880498 15:53090300-53090322 TAGAAAATGAAGAAGGAAGAAGG - Intergenic
1128095609 15:64952253-64952275 AAAAAGAAGGAGAAGGAAGAAGG - Intronic
1128512297 15:68320775-68320797 CAAAACTTGTAGAAGGATAATGG - Intronic
1128955286 15:71935248-71935270 AAAAAAATGAAGAAGGAAGATGG - Intronic
1129255065 15:74329796-74329818 TAGAAGATGGGGAAGGAGGAGGG + Intronic
1129977487 15:79834318-79834340 TACAACCTGGAGAAGGATGGTGG - Intronic
1133661122 16:7918859-7918881 GAAAACATGAAGAAAGATAAAGG + Intergenic
1133669596 16:8005430-8005452 TAAGCCATGGAGAAAAATGAGGG - Intergenic
1133797778 16:9060175-9060197 TTAAATATGGAGAAGAAGGAAGG + Intergenic
1133895268 16:9921121-9921143 TAAAACAGGCAGAAGAATAAAGG - Intronic
1134038185 16:11048194-11048216 TAATACATGGAGAAGCACGGGGG - Intronic
1134913136 16:18046791-18046813 GAAAACATGGAAAGGGTTGAAGG - Intergenic
1135003768 16:18801002-18801024 TAAAACTTGGACAAGGGTGGAGG - Intronic
1135845636 16:25916034-25916056 TCAGACATGGAGGAGGATAAGGG + Intronic
1137362019 16:47827004-47827026 CAAAATATTGACAAGGATGAGGG - Intergenic
1137376367 16:47955461-47955483 TAAAACAAGGAGAAGGAAATTGG - Intergenic
1137773111 16:51033979-51034001 CCAAACAGGGAGAAGGGTGAGGG - Intergenic
1139282307 16:65781193-65781215 TGAATCATGGAGCAGAATGAGGG + Intergenic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1140150395 16:72357600-72357622 TATAACATGAAGAAGAATGGAGG - Intergenic
1140193400 16:72837168-72837190 GAGAAAATGGAAAAGGATGAAGG - Intronic
1142902434 17:3020399-3020421 TAGACCAGGGAGGAGGATGAGGG + Intronic
1143655454 17:8291107-8291129 AAAAACAGTGAGAAGGAGGAAGG + Intronic
1143743505 17:8972519-8972541 GAATACATGTAGAAGGAAGATGG + Intergenic
1147670239 17:42172865-42172887 TAAGACATGGAGAAGCATAGTGG + Intronic
1148534934 17:48430820-48430842 TAACACAGGGAGAAAGCTGAGGG + Intergenic
1149230407 17:54527291-54527313 TAAAACTTGGACAAGGACTAGGG - Intergenic
1149697885 17:58630829-58630851 TCAATCATGGGAAAGGATGAGGG + Intronic
1153448737 18:5202317-5202339 TAAAAGATGGAAAAGGAATAAGG + Intergenic
1153489500 18:5632217-5632239 TAAAACAATGAGTAGAATGAAGG + Intergenic
1154425386 18:14268112-14268134 TTAATCATGGAGAAGCATGGGGG + Intergenic
1156200707 18:34828367-34828389 AAATACATGGAGAAGGCTCACGG + Intronic
1156273117 18:35555564-35555586 CAAAATGTGGAGAAGGATGGAGG + Intergenic
1157335616 18:46735069-46735091 TCCAGCATGGAGAAAGATGAAGG - Intronic
1158561085 18:58514289-58514311 AAAAACTGGGAGAAGGAAGAAGG - Intronic
1159290182 18:66407507-66407529 TAAAACAGGTAAAAGGATGATGG - Intergenic
1159802901 18:72923018-72923040 TAAATCATGGGGAAAGGTGAAGG + Intergenic
1159905493 18:74086843-74086865 TAATAAATGGAGAAAGATGCAGG + Intronic
1162458018 19:10797553-10797575 TAACACATGGAGGGGGAGGACGG - Intronic
1162972096 19:14186949-14186971 AAAAACAGGGAAAAGGATGGCGG - Intronic
1167457460 19:49604726-49604748 TAAAACTTGGAGATGGATGGTGG - Intronic
1167507242 19:49877380-49877402 TACAATATGGAGAAGGAAGTGGG + Exonic
1167754009 19:51399581-51399603 TAAGGCTTGCAGAAGGATGAAGG + Intergenic
1167827620 19:51988125-51988147 TAAAACTTAGAGAAGGAAAAGGG + Intergenic
1167875689 19:52410330-52410352 TAAAAGAGGGAGAAGGGTGGGGG + Intronic
1168464942 19:56594844-56594866 GAAGAGATGGAGAAGGAGGAGGG - Intergenic
925053314 2:834228-834250 TAGAACAGGGAGAAGGGAGAAGG + Intergenic
926300029 2:11595864-11595886 AACAACATGGTAAAGGATGAAGG - Intronic
926903045 2:17777456-17777478 TAATACAGGCAGAAGGAAGATGG + Intronic
927157780 2:20231499-20231521 TGAGGCTTGGAGAAGGATGAAGG + Intergenic
927369932 2:22342941-22342963 CAAAACAAGGAGCAGAATGAAGG + Intergenic
927749435 2:25653994-25654016 TGATACATGTGGAAGGATGAGGG - Intronic
928302122 2:30134653-30134675 GAAAACATTGAGAAGTATTAGGG - Intergenic
929097988 2:38281987-38282009 GAATAATTGGAGAAGGATGAAGG - Intergenic
929976047 2:46635984-46636006 TAAAAAATGAAAAAGGATAATGG + Intergenic
930067337 2:47337758-47337780 AAAAACATGGAGAGGGAAGGTGG - Intergenic
930329804 2:49967956-49967978 TAAAATATGGTGAAGAATTATGG - Intronic
930338297 2:50079008-50079030 TTAATAATGTAGAAGGATGATGG - Intronic
930412480 2:51042888-51042910 TAAAACATACAGAAAGATTAAGG - Intergenic
930454431 2:51587738-51587760 TAATACAGGGAAAAGGATAATGG - Intergenic
930520995 2:52467423-52467445 GAAGAGATGGAGTAGGATGATGG - Intergenic
930560468 2:52954233-52954255 TGAGACATGAAGAAAGATGAGGG - Intergenic
930613106 2:53564810-53564832 TAAAACATGGAAAAGAGAGAAGG - Intronic
931015503 2:57975471-57975493 TAAAAAATAGAGATGGAGGAAGG - Intronic
931533917 2:63250646-63250668 TAGAACAATGAGAAAGATGAGGG + Intronic
932067703 2:68583971-68583993 GGAAAGATTGAGAAGGATGAGGG - Intronic
932086050 2:68762582-68762604 TAAAAGAAGGAGAACCATGAGGG - Intronic
932116552 2:69055238-69055260 TAAAACTTCAAGAAGGATGTGGG - Intronic
932301274 2:70668703-70668725 AAAGACATGGAGAAGGAATATGG + Intronic
933283830 2:80362333-80362355 TAAAGCAAGAAAAAGGATGAGGG + Intronic
933689118 2:85165912-85165934 CAAAACATGAAGAATGGTGAGGG - Intronic
933706335 2:85293425-85293447 TTAATCATGGAGAAAGGTGAAGG - Intronic
934879340 2:97960344-97960366 TTAAACATGAAGAAGGTGGATGG - Intronic
935856171 2:107276828-107276850 CAAAGAATGGAGAAGGTTGATGG + Intergenic
935930356 2:108117618-108117640 TAGAACTTGGAGAGAGATGAGGG + Intergenic
936800795 2:116262485-116262507 TCAAACATGAAGAAGGAGGCAGG + Intergenic
937230198 2:120393995-120394017 TAAAAAATGGAAAAGAAGGAGGG - Intergenic
939462299 2:142512876-142512898 TACACTATGGAGAAGGAAGAAGG + Intergenic
941209857 2:162624400-162624422 TATAACATGGATTAGGAGGAAGG + Intronic
941980700 2:171453382-171453404 AAAAACATGCAGAAAGATGAAGG - Intronic
942475595 2:176316552-176316574 AAAAAAATGGACAAGCATGATGG - Intronic
942644720 2:178097360-178097382 ATAATCATGGAGAAAGATGAAGG + Intronic
943498344 2:188653059-188653081 CAAAACAAGGAGAAAAATGATGG + Intergenic
944284836 2:197937833-197937855 TAAAACCAAGAGAAGGATCAAGG + Intronic
945136989 2:206639975-206639997 TAAAGCAGGGAAAAGGATGATGG - Intergenic
945155438 2:206832850-206832872 TAAATGAAGGAGAAGGAGGAAGG - Intergenic
945700142 2:213159536-213159558 TAAAGCAGGTAGAAGGATGGTGG - Intergenic
946812527 2:223541061-223541083 TAAATCATGGTGGAGGGTGAAGG - Intergenic
946846720 2:223865669-223865691 TAATATATGTAGAAGGATGCTGG + Intronic
947227075 2:227850927-227850949 TAAAGCAGGGAAGAGGATGATGG - Intergenic
947629716 2:231644269-231644291 GAGAACATGAAGCAGGATGAGGG - Intergenic
948011917 2:234655798-234655820 TAAAATCTGGAGTAGGAGGATGG - Intergenic
948881644 2:240860798-240860820 CAGAACAAGGACAAGGATGAGGG + Intergenic
1168873195 20:1148414-1148436 CAAAACATGGAGCAGGATTTGGG - Intronic
1169303516 20:4468202-4468224 TGAAAGATGGAGAAAGGTGATGG + Intergenic
1170510173 20:17068270-17068292 TAAAATATGGAGGAGGAGGCAGG + Intergenic
1170970404 20:21110745-21110767 TAAAACAGGGAAAAGAATGTTGG + Intergenic
1171723078 20:28585130-28585152 TAAAACAAAGAGTAGGATTAGGG + Intergenic
1171754969 20:29097985-29098007 TAAAACAAAGAGTAGGATTAGGG - Intergenic
1171787679 20:29484571-29484593 TAAAACAAAGAGTAGGATTAGGG + Intergenic
1171860274 20:30394808-30394830 TAAAACAAAGAGTAGGATTAGGG - Intronic
1171960300 20:31488621-31488643 ACAAACATGGACAAGGATGTGGG + Intergenic
1173343344 20:42175083-42175105 AAGAACATGGAGAAGGAAGAGGG - Intronic
1174101567 20:48130292-48130314 GCAAACCAGGAGAAGGATGATGG + Intergenic
1175354930 20:58357315-58357337 TAAAACATTAAGAAGGAGGCAGG - Intronic
1175499106 20:59436952-59436974 GAAAGCAGGTAGAAGGATGAAGG - Intergenic
1176843962 21:13862403-13862425 TTAATCATGGAGAAGCATGGGGG - Intergenic
1176846650 21:13881724-13881746 TTAATCATGGAGAAGCATGGGGG - Intergenic
1177294919 21:19161593-19161615 GAAAAAATGAAGAAGGATGATGG - Intergenic
1177688965 21:24478326-24478348 GAAAACATGGAGATGGCTCAAGG - Intergenic
1178218551 21:30628621-30628643 TAATATAGGGTGAAGGATGATGG - Intergenic
1178340264 21:31779903-31779925 TAAAAGATGGAGATGCATAAAGG - Intergenic
1178669064 21:34574935-34574957 TAAAACATGGACAATGGTTACGG + Intronic
1179086765 21:38225306-38225328 TAAAACAAGGAGAAGCCTTAGGG - Intronic
1179116691 21:38499778-38499800 GAAAAAATGGAGAAGGAGAAAGG + Intronic
1180164473 21:46016472-46016494 TTAAAAAAGGAGAAGAATGAAGG - Intergenic
1180296633 22:10943801-10943823 TAAAACAAAGAGTAGGATTAGGG + Intergenic
1181829488 22:25548353-25548375 TAAAAGAGGGAGAAGGAGGGAGG + Intergenic
1182786882 22:32915450-32915472 TAAAAAATAAAGCAGGATGACGG + Intronic
1183899554 22:40994824-40994846 TAAAAGATAGTGAATGATGATGG + Intergenic
1185126198 22:49012079-49012101 TAAGACATGGGGAAGAAGGAGGG - Intergenic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949465878 3:4343143-4343165 TATAACATGGAGATGGGAGATGG + Intronic
951006656 3:17623709-17623731 TAAATCATTGAGAAAGATGCTGG - Intronic
951474946 3:23094907-23094929 GAATACATGGAGAAGGAAGGAGG + Intergenic
951781207 3:26364685-26364707 CAAAACAGGGAGAAGGAAAAAGG - Intergenic
951842579 3:27049806-27049828 AAAAACATGGATAAGGACGAAGG - Intergenic
952350074 3:32526462-32526484 TAAAACATGTAAAAGGATTTGGG - Exonic
953887856 3:46727695-46727717 TAAAAGATGGAGAATGAAGGAGG + Intronic
954140991 3:48605351-48605373 AAAAACATGGAGAAGGATTATGG - Intronic
954773234 3:52992876-52992898 AAAATCATAGAGAAAGATGAAGG - Intronic
954829344 3:53406112-53406134 TAAAAAATGACAAAGGATGAAGG + Intergenic
955197555 3:56819339-56819361 TAAAACATGGAGAAGGATGAGGG - Intronic
955349100 3:58180812-58180834 AAAAACCTGCAGAAGCATGAAGG - Intergenic
955713710 3:61806419-61806441 CAGAACCTGGATAAGGATGATGG - Intronic
957562253 3:81837474-81837496 TTCAACATGAAGAAAGATGAAGG - Intergenic
958080400 3:88739029-88739051 TAAAACAAGGTGAACTATGATGG + Intergenic
958116295 3:89222654-89222676 TAAAAAATTGAGAAGGGTGAAGG + Intronic
959081483 3:101806360-101806382 TAAAACATGGGGGAGGGTGGAGG - Intronic
959337328 3:105082320-105082342 CACAACATGGAGGAAGATGAAGG + Intergenic
959644751 3:108685584-108685606 TAAAATATGGAGAAAAGTGATGG + Intronic
959977493 3:112477796-112477818 TAAAATATGGAGTGAGATGAGGG + Intronic
960067134 3:113386038-113386060 GCAAACATTGAGAAAGATGAAGG - Intronic
960162495 3:114365597-114365619 TGAAACAAGGAGGAGGATGTGGG + Intronic
960239522 3:115324071-115324093 TAAAACATGGAAAAAGATCTGGG + Intergenic
960873397 3:122273704-122273726 TACAGCATGGAGAAGGATGATGG + Intronic
962850690 3:139306462-139306484 TGAAAAATGGGGAAGAATGAAGG + Intronic
963385146 3:144583161-144583183 TTAAACATGTAGAAGCATAATGG + Intergenic
963738018 3:149043278-149043300 AAAAACATAGAAAAGGATGTAGG + Intronic
963969683 3:151415975-151415997 TAAAACATGCGGAAGGACAAAGG + Intronic
964346971 3:155763754-155763776 TAAAAAAAGGAGAAGGAATATGG - Exonic
964888200 3:161508818-161508840 TAAAGCAGGGACAAGGATCAGGG - Intergenic
966290757 3:178355274-178355296 GAAAACAGGGAAAAGTATGATGG + Intergenic
967059498 3:185859508-185859530 TAAGACCTGGAGAATGAGGAAGG - Intergenic
967137815 3:186527374-186527396 AGAAACATGGAGCAGGATGAGGG + Intergenic
968698263 4:2042919-2042941 TAAATCGGGGTGAAGGATGAGGG - Intronic
970064859 4:12081680-12081702 CAAGACATGGAGAAGGGGGATGG + Intergenic
971806770 4:31368419-31368441 TAAAACATGGAGCAGCAAAATGG - Intergenic
971928332 4:33044319-33044341 TAAAAGATTGAGAATGAGGATGG + Intergenic
972210623 4:36832139-36832161 GAGAAGATGGAGTAGGATGAGGG - Intergenic
972708993 4:41574657-41574679 TAAAACAATGACAGGGATGATGG - Intronic
972838946 4:42908633-42908655 TAAAACCTGAAGAGGGATGGGGG + Intronic
972848521 4:43019559-43019581 AAAACCATAGAGAAGGAAGAAGG - Intronic
972980386 4:44692504-44692526 TGAAACATGGGGAAGCAGGAGGG + Intronic
973686105 4:53371378-53371400 TACAACAGGGTGAAGGATAATGG + Intergenic
974103279 4:57440581-57440603 TAAAAAAGGTAGAAGGAGGAAGG - Intergenic
974198440 4:58607597-58607619 TAAAACATACAGAAGGAAGAAGG - Intergenic
976168748 4:82282411-82282433 AAAAAAATGGAGGAGGAGGAAGG + Intergenic
977009295 4:91615495-91615517 AAAAACAGGGAGTAGAATGATGG + Intergenic
977866428 4:102033846-102033868 TAAAAAATGGAAAAGGATTTTGG - Intronic
978252611 4:106650614-106650636 AAAATCATGGTGAAAGATGAAGG - Intergenic
979388910 4:120103591-120103613 TAAAACATGTAGAACAATGTTGG - Intergenic
980113633 4:128658688-128658710 TAGAACAGGGAGAAGGAAAAGGG + Intergenic
980869241 4:138592469-138592491 TAAAGCATGAAGGAGGCTGATGG - Intergenic
981165091 4:141548367-141548389 TAGAACAAGGAAAAAGATGAAGG + Intergenic
982926245 4:161340298-161340320 TAAAAAATGTAGAAGGAAGGGGG + Intergenic
983161979 4:164427772-164427794 GAAGACAAGGAGAAGGAAGAGGG + Intergenic
983484868 4:168321516-168321538 TGAAATATGCAGAAGGCTGAGGG - Intergenic
983693475 4:170500603-170500625 AAGAACATGGAGAAGAATGTGGG - Intergenic
983874111 4:172856450-172856472 TAAAGCATGGATAGGGAAGAAGG - Intronic
984543452 4:181070133-181070155 TAAAACGTGGAGAAGGATGATGG + Intergenic
984795554 4:183657351-183657373 TAAAATATGGGAAAGGATTAGGG - Intronic
985045122 4:185932760-185932782 TAAGTCATAGAGAAGGATCATGG - Intronic
986131325 5:4934280-4934302 AAAAACAGGGATAATGATGAAGG + Intergenic
986245991 5:6007249-6007271 AAGAACATGGAGACAGATGAAGG - Intergenic
987047919 5:14124828-14124850 AAAAAAATGGAGAAGGAGGCCGG + Intergenic
987619446 5:20321300-20321322 TAAAACATGGCAAGGGATCAAGG - Intronic
987665014 5:20925952-20925974 TAAAAGATGTAGAAGAATCATGG + Intergenic
988247500 5:28706466-28706488 TAAAGTTTGGAGAAGGATGATGG - Intergenic
988351776 5:30118142-30118164 GAAAATCTTGAGAAGGATGAAGG + Intergenic
988790118 5:34600101-34600123 AAAAGCATAGAGAAGGAAGAAGG + Intergenic
989077978 5:37585284-37585306 TAAAAAATGGACAAGGAGGCTGG - Intronic
990779012 5:59337107-59337129 CAAAAAGAGGAGAAGGATGAAGG + Intronic
990796953 5:59554344-59554366 TAAAAAATGGAGGGGGATGGGGG - Intronic
991637663 5:68722493-68722515 TAATGCATGGAGGAGGAGGAAGG + Intergenic
992228183 5:74639503-74639525 CAAAACCTGGAGAAGGGTGCGGG - Intronic
992247105 5:74837124-74837146 TAAAGGATGGAGAAGGAGAAGGG - Intronic
992501298 5:77346800-77346822 TAAAACAAGAGGAAGGAGGAAGG + Intronic
993378959 5:87183658-87183680 TAAAAGAGGGAAAGGGATGAAGG - Intergenic
995773408 5:115697968-115697990 AAAAACACTGAGAAGGAAGAAGG + Intergenic
996504098 5:124249956-124249978 TAAGATATGGAGGAGGAAGATGG - Intergenic
998047484 5:139000319-139000341 TTAAACATGAATAAGGATGAAGG + Intronic
998355922 5:141536563-141536585 AAAAACAGGGAAAAGGATGGGGG + Intronic
998921332 5:147071468-147071490 TGAAAGATGGAGACAGATGATGG - Intronic
999823577 5:155252842-155252864 TAAGACATGGAGAAGCCTCAGGG + Intergenic
999848654 5:155513365-155513387 TAAAACTTGGGGAAGGAAGTAGG - Intergenic
999959974 5:156744163-156744185 TAAAACAGGGATAACAATGAGGG - Intronic
1000409417 5:160922450-160922472 TAAAGAATGGAGGAGGATGTGGG + Intergenic
1000636339 5:163647926-163647948 AAAAAAATGGAAAAGGAGGAAGG - Intergenic
1000742893 5:164992391-164992413 TACAACAAAGAGAAGAATGATGG - Intergenic
1002430727 5:179202424-179202446 TAGGAGATGGAGAAGGAAGAAGG - Intronic
1002672230 5:180877066-180877088 AGAAACATAGAGTAGGATGAAGG - Intergenic
1003220236 6:4154714-4154736 TTAAAGATGGAGAGGGATGTGGG + Intergenic
1003428936 6:6021380-6021402 TAAAACCTGGATTAGGAAGAGGG - Intergenic
1006223957 6:32520439-32520461 TAAAGCAGAGAGAAGGATTAAGG + Intronic
1006227927 6:32556195-32556217 TAAAGCAGTGAGAAGGATTAAGG + Intronic
1007209032 6:40176825-40176847 GAAAAAATGGAGATGGTTGAAGG + Intergenic
1009583476 6:65566357-65566379 TCACACAAGGGGAAGGATGAGGG + Intronic
1011166946 6:84459148-84459170 TAAAACATTGAGTACCATGATGG - Intergenic
1011342317 6:86330447-86330469 TATTACATAGAGAAGAATGAAGG + Intergenic
1011618422 6:89219493-89219515 AATAACAAGGAGAAGGAAGATGG + Intronic
1012290285 6:97447169-97447191 AAAAAACAGGAGAAGGATGAGGG - Intergenic
1012320945 6:97844767-97844789 TAAATCATGGAGAAATATGGAGG - Intergenic
1012762768 6:103322784-103322806 TAAAGATTGGAGAAGGAGGAGGG - Intergenic
1014247167 6:119081133-119081155 TACAACATGGAGGAAGGTGAAGG + Intronic
1014535270 6:122606769-122606791 AAAAACATGGAGTATGATGATGG + Intronic
1015085011 6:129280019-129280041 GAAAACAGGGACAAGGAAGAAGG - Intronic
1015172751 6:130272019-130272041 TAAAAGATGGATGATGATGATGG - Intronic
1015964162 6:138681788-138681810 TAACACATGGTGAAATATGAGGG - Intronic
1016546882 6:145233796-145233818 TACAACATGTAGGATGATGAAGG - Intergenic
1016706263 6:147111618-147111640 TAAAACATGGAGAAAGTTAGAGG - Intergenic
1017022275 6:150149915-150149937 CAAAACATAGAGAATGAGGAAGG - Intronic
1017128687 6:151090093-151090115 TAAAACATTGTGATGGATGATGG - Intronic
1019494974 7:1333475-1333497 TAAAAAAAGGAGAAGAAGGAGGG - Intergenic
1019874652 7:3798980-3799002 TAATAAATGTAGAAGAATGAGGG - Intronic
1020113397 7:5460891-5460913 AAAAATATGGTGAGGGATGAAGG - Intronic
1020490732 7:8780831-8780853 TAAAAAATGGAAATGGATGTGGG + Intergenic
1021334634 7:19384545-19384567 TAAAACAGAAGGAAGGATGATGG - Intergenic
1021494418 7:21258812-21258834 GAAAACATGGAGAGGGAGAAGGG - Intergenic
1021681983 7:23142240-23142262 TAAAATATAGAGAAGGATGTGGG - Intronic
1022141992 7:27500676-27500698 CAAACCAGGGAGAAGGAGGAGGG + Intergenic
1022296928 7:29064322-29064344 TACAACATGGAGAAACGTGACGG + Intronic
1023307525 7:38846748-38846770 AAAGACATGAACAAGGATGATGG + Intronic
1023874747 7:44280908-44280930 TAAAACCAGGAGAGGGATGAGGG + Intronic
1024382737 7:48717681-48717703 GAGATCATGGAAAAGGATGAGGG + Intergenic
1024869911 7:53952516-53952538 TAACATATGGAGAAGTATGTGGG - Intergenic
1026147541 7:67760365-67760387 AAAATCATGGTGAAGGGTGAAGG - Intergenic
1027505229 7:79009006-79009028 AAAAAAAAGGAGAAGGAAGAGGG - Intronic
1027693722 7:81381890-81381912 AAAATCATGTAGAAGTATGATGG + Intergenic
1027852816 7:83470582-83470604 TAAAACATGGAATGGGAAGAAGG - Intronic
1030849877 7:114470797-114470819 AAAAACATGGAGAAGGAGGATGG - Intronic
1030956226 7:115855959-115855981 ACAATCATGGAGGAGGATGAAGG + Intergenic
1031132877 7:117853273-117853295 TAAAAAATGAAAAAGGAAGAGGG - Intronic
1031460195 7:122039329-122039351 TAAAACATTTAGAAGAGTGAAGG + Intronic
1031750016 7:125560187-125560209 TAAAAAATGTAAAAGGATGGTGG - Intergenic
1032412637 7:131709149-131709171 TAATAAATGAAGAAGGAAGAAGG - Intergenic
1032876071 7:136039613-136039635 TATAAAATGGAGAAGGAGGAAGG - Intergenic
1033033495 7:137848241-137848263 GAAAACATAGAGGTGGATGAGGG - Intergenic
1033446104 7:141423533-141423555 TAGAATATGGAGGAGGAGGAGGG + Intronic
1033498876 7:141927428-141927450 CAATAAAGGGAGAAGGATGAAGG + Exonic
1033609282 7:142950438-142950460 TAAAACTTGGTGCAGGGTGAGGG - Intronic
1037947868 8:23000326-23000348 TTAAACATCGAGAAGGGGGAGGG - Intronic
1038325678 8:26571146-26571168 GAAAACATGGACTAGGAGGAAGG - Intronic
1039986530 8:42452453-42452475 GAAGAGATGGAGAAGGAGGAAGG + Intronic
1040428093 8:47309630-47309652 GAAAAGATGGAGAAGAAAGAGGG - Intronic
1041743779 8:61184176-61184198 GAAAACAAGAAGAAGGATCAAGG + Intronic
1041940562 8:63382525-63382547 TAAGACAAGGAGAAAAATGAAGG + Intergenic
1042311061 8:67379859-67379881 AAGAACAAGGAGAAGGAAGAAGG - Intergenic
1042400277 8:68337033-68337055 TAATAAAAGTAGAAGGATGATGG + Intronic
1042765153 8:72313517-72313539 TAATACATGTAAAAGGATAATGG - Intergenic
1043047847 8:75350510-75350532 TAGTACATGAAGAATGATGATGG - Intergenic
1043160120 8:76836584-76836606 GCTAACATGGAGAAAGATGAGGG + Intronic
1043803815 8:84645509-84645531 GAAAACATGGAAAAGGAGAAAGG - Intronic
1043839507 8:85086204-85086226 TAAAAAATGAAGAAGGACGGTGG + Intergenic
1044801948 8:95966151-95966173 TAAGAGAGGGAGAAGGAGGAAGG + Intergenic
1044941963 8:97352700-97352722 TAAGAACTGGAGAAGGATGGGGG - Intergenic
1045656859 8:104395956-104395978 TCAAACATTAAGAAGGATGGAGG + Intronic
1045903038 8:107307949-107307971 TAAAAACTGGAGAAGGATAGTGG - Intronic
1046336978 8:112803423-112803445 TAAAACATTGAGTAGGCTCAGGG - Intronic
1046626445 8:116581551-116581573 TAAAACTAGGAGAATGAGGAAGG - Intergenic
1048010273 8:130449958-130449980 TGACACATAGAGAAGTATGATGG + Intergenic
1048826004 8:138427783-138427805 TAAAATATGGAAAATGATCAGGG - Intronic
1048939102 8:139381737-139381759 TAAATAATGGAAAAGGTTGAAGG + Intergenic
1050536234 9:6633266-6633288 TAAAACATGCAGAAGGAGAGAGG - Intronic
1051264577 9:15298458-15298480 AAAATCATGGTGAAAGATGAAGG + Intronic
1051605932 9:18917824-18917846 TCATCCATGGAGAAGGATGAGGG - Intergenic
1052913088 9:33901878-33901900 AAAAACATTCAGAGGGATGATGG - Intronic
1053086999 9:35233615-35233637 TACATCATGGAGAAGGAAAAAGG - Intronic
1053747457 9:41213968-41213990 TAAAACAAAGAGTAGGATTAGGG - Intergenic
1054338925 9:63836554-63836576 TAAAACAAAGAGTAGGATTAGGG + Intergenic
1054741839 9:68813980-68814002 TAAAACCTGTAAAAAGATGAGGG + Intronic
1054952992 9:70873877-70873899 TAAAAATAGGAGAAGGAAGAAGG - Intronic
1055654077 9:78436380-78436402 TAAAGCATGAAGGAGGAAGATGG + Intergenic
1056863696 9:90210850-90210872 TTCCACATGGAGAAGAATGAAGG + Intergenic
1057016622 9:91657862-91657884 GAAAACAAGGAGATGGAGGAGGG - Intronic
1057945769 9:99326753-99326775 TAAAAAATGGAAAGTGATGAAGG + Intergenic
1057997330 9:99829824-99829846 TAAAATATGGGGGAGGCTGATGG - Intronic
1058376743 9:104330799-104330821 GAAAAGATGAAGAAGGAAGAAGG + Intergenic
1058399006 9:104591899-104591921 TTAAACATGGAGAAAAATAAGGG + Intergenic
1058700645 9:107597431-107597453 TAAAAGAAGCAGCAGGATGAAGG - Intergenic
1058953183 9:109922453-109922475 AAAAAGATGGAAAAGGAGGAAGG + Intronic
1059345637 9:113625971-113625993 GGAGGCATGGAGAAGGATGAAGG + Intergenic
1059611380 9:115900739-115900761 GAAAAGGAGGAGAAGGATGAGGG - Intergenic
1059785431 9:117577635-117577657 TGAAACATGGTGATGGATAATGG + Intergenic
1059897433 9:118882654-118882676 TAAAACACTGAAAATGATGATGG + Intergenic
1202803498 9_KI270720v1_random:24940-24962 TAAAACAAAGAGTAGGATTAGGG + Intergenic
1203448283 Un_GL000219v1:82049-82071 TAAAACAAAGAGTAGGATTAGGG + Intergenic
1186114161 X:6287834-6287856 TAATACATGGATAAAGCTGAAGG - Intergenic
1186223427 X:7373796-7373818 GAAGACTTGGAGAAGTATGAGGG - Intergenic
1187248526 X:17575526-17575548 GAAAACATGGAGGAGGGGGAGGG - Intronic
1187251389 X:17601306-17601328 GAAATCATGGAGAAGCAGGAAGG + Intronic
1187516922 X:19980603-19980625 TAAAAGAAAGATAAGGATGAAGG + Intergenic
1187634280 X:21210124-21210146 AAAATCATGGAGGAAGATGAAGG - Intergenic
1188275726 X:28198417-28198439 AAAAACATTGAGGAGGAGGATGG - Intergenic
1189171915 X:38917369-38917391 TAAAAAAAGGAGAAGAATCAGGG - Intergenic
1189314010 X:40040907-40040929 TAAAAGAAGGAGAAGGAGGAGGG - Intergenic
1190087689 X:47409943-47409965 TAAAAAATGAAGAAGGAGGCTGG - Intronic
1190364068 X:49675389-49675411 TACAACAGGGAGAAAGGTGATGG - Intergenic
1190462591 X:50693221-50693243 TAAAAAATGGACAGGGATGTAGG + Intronic
1190834392 X:54087033-54087055 TGAAACATTGGGAAAGATGAGGG - Intronic
1191740284 X:64429746-64429768 TAAAACAAGGAAAAGGAAGCAGG + Intergenic
1191836061 X:65463267-65463289 AAATAAATGGAGAAGAATGATGG + Intronic
1192347951 X:70327463-70327485 TGAAACAAGGGGAAGGATGAAGG + Intronic
1193576462 X:83203911-83203933 TAAGACATGGAGAAGAATCTGGG - Intergenic
1194973838 X:100373295-100373317 TAAAACTAGGAGAAGGAGGCTGG - Intronic
1195832971 X:109080516-109080538 TAAAACAAGGAGAAAGTGGAAGG - Intergenic
1196334285 X:114512840-114512862 CAAAAAATGGAGAAGGTAGAGGG + Intergenic
1196526247 X:116730235-116730257 TAAAACATGGAAAAGAATAATGG + Intergenic
1197222107 X:123924244-123924266 TAAAATATGGAGCAGGTGGAGGG - Intergenic
1198187253 X:134265608-134265630 TGAAACATTGGTAAGGATGAGGG + Intergenic
1198742783 X:139858437-139858459 GAGAACATGTAGAATGATGAAGG - Intronic
1198797679 X:140416304-140416326 TGAAACAAGGAGAAGGAGCAGGG - Intergenic
1199843330 X:151672823-151672845 CCACACATGCAGAAGGATGATGG - Intronic
1201592975 Y:15636062-15636084 GAAGACTTGGAGAAGTATGAGGG - Intergenic
1202017057 Y:20420516-20420538 AAAAACATGGAGAAAGATAAAGG - Intergenic