ID: 955199522

View in Genome Browser
Species Human (GRCh38)
Location 3:56837819-56837841
Sequence CTGTGTGCACATGATGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955199522_955199525 2 Left 955199522 3:56837819-56837841 CCTGTGCCATCATGTGCACACAG 0: 1
1: 0
2: 4
3: 16
4: 169
Right 955199525 3:56837844-56837866 ACCTGAACAACATGCTAGAACGG 0: 1
1: 0
2: 1
3: 12
4: 134
955199522_955199527 6 Left 955199522 3:56837819-56837841 CCTGTGCCATCATGTGCACACAG 0: 1
1: 0
2: 4
3: 16
4: 169
Right 955199527 3:56837848-56837870 GAACAACATGCTAGAACGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955199522 Original CRISPR CTGTGTGCACATGATGGCAC AGG (reversed) Intronic
900474230 1:2868798-2868820 CTTTGTGCACAAGATGGGCCGGG + Intergenic
914952216 1:152126224-152126246 GTTTGTGCAGCTGATGGCACCGG + Intergenic
915106751 1:153539649-153539671 CTGTGTGCACAGCATGGCCAGGG - Intronic
915926124 1:160020956-160020978 TTGTCTTCACATGATGGAACGGG - Intergenic
916644669 1:166770860-166770882 CTGTGTGCTTATGTTGGCAGTGG - Intergenic
917452613 1:175159582-175159604 ATGTGTGCACGGTATGGCACAGG - Exonic
917895735 1:179485016-179485038 CTCTGTGCACATACTCGCACAGG - Intronic
918233427 1:182556321-182556343 CTGTGTGCAAATCCTGGCTCAGG + Intronic
918506467 1:185260113-185260135 ATGAGTGCACATGATGGCTTAGG + Intronic
920710201 1:208287602-208287624 GTGTGTGCACATGTCTGCACAGG - Intergenic
924295134 1:242579122-242579144 CATTGGGCACATGATGCCACGGG + Intergenic
1068941081 10:62681875-62681897 CTGAGTGCACATCATGACACAGG + Intergenic
1070785363 10:79159343-79159365 GGGTGTGCACAGCATGGCACAGG + Intronic
1071121171 10:82280878-82280900 CTGGGTGGCCATGCTGGCACAGG - Intronic
1071180707 10:82980147-82980169 CTGAGTGCACATGGTGCTACTGG + Intronic
1071345477 10:84687963-84687985 CTGTGGGGAAGTGATGGCACTGG + Intergenic
1071918158 10:90319472-90319494 CTCTGTGCACTGGATGGCACTGG - Intergenic
1072758694 10:98038404-98038426 GTGTGTGCAGGTGAGGGCACAGG + Intergenic
1072784801 10:98272398-98272420 CTGGGTGCACACTCTGGCACAGG + Intergenic
1073443646 10:103568132-103568154 CTGGGTGCACATGGTGCCCCTGG + Intronic
1074293687 10:112161703-112161725 GTGTGTGGACATAATGGCACAGG + Exonic
1074579968 10:114709993-114710015 ATGTGTGCACATGGTGGGAGTGG - Intergenic
1074681550 10:115912434-115912456 GTGTGTGCATATGATGAAACAGG + Intronic
1077754522 11:5011956-5011978 CTGTCTGCACTTGAGGGCTCAGG + Intergenic
1077884673 11:6378121-6378143 TTGTGTGCACATGAGTGCATGGG - Intergenic
1079134052 11:17766100-17766122 CTGTGAGCACATGGAGGCCCTGG - Intronic
1079947534 11:26763005-26763027 TTATGTGCACATGAGTGCACAGG + Intergenic
1083144304 11:60747253-60747275 CTGAGGGCTCAAGATGGCACAGG - Intergenic
1083596440 11:63920119-63920141 CTGTGTCCCCATGAGGGCAGGGG + Intergenic
1085344382 11:75758509-75758531 CAGAGTGCACATGATTGCAGAGG + Intergenic
1087739362 11:101869990-101870012 CTGTGTCAACATGATGGCCTGGG - Intronic
1087917935 11:103831714-103831736 CTGTGTGTTCATGCTGGCATTGG - Intergenic
1089632253 11:119791196-119791218 GTGTGTGCACATGTGGGCAGGGG + Intergenic
1089857695 11:121561217-121561239 CTGTGTGCAGATGAAGCCAGTGG + Intronic
1090995249 11:131860292-131860314 CTGTGTCCTCACCATGGCACAGG - Intronic
1092029283 12:5270449-5270471 GTGTGTGCACATGATGCCTGTGG - Intergenic
1093809497 12:23474521-23474543 CTGTGTCCACAAGCTTGCACTGG - Intergenic
1094726703 12:33126147-33126169 CTGTTTGGACATGGTGGCATAGG + Intergenic
1096588419 12:52641164-52641186 CTGCATGCTTATGATGGCACAGG + Intergenic
1096916159 12:55035709-55035731 CTGTGTGCACACGATTGCACTGG - Intergenic
1101951288 12:109177922-109177944 CTGTGTGCACATGAGGGCCTGGG - Intronic
1103616253 12:122154637-122154659 CTGTGTGCACAGCATGGGATGGG - Intergenic
1107405171 13:40105622-40105644 CTTTGCACACCTGATGGCACTGG - Intergenic
1107523060 13:41202243-41202265 CTATCTGGACATGGTGGCACAGG + Intergenic
1108439870 13:50440345-50440367 GTGTTTGCAAATGATTGCACTGG + Intronic
1110127648 13:71966834-71966856 CTGTTTTCACATGATAGCTCAGG - Intergenic
1112209116 13:97356759-97356781 CAGCGAGCACATGATGGCAGTGG - Intronic
1112293005 13:98161601-98161623 CTGAGTTCACATGATGGGAAGGG + Intronic
1112374061 13:98822291-98822313 CTGTCTGCACTTGATTTCACAGG + Intronic
1112457485 13:99575664-99575686 CTGTGTCCCCAGGATGGCCCCGG + Intergenic
1113292527 13:108922346-108922368 CTGTGTGTCCCTCATGGCACAGG + Intronic
1113364749 13:109665626-109665648 CTGTGTGCAGGTGATGGCCCTGG + Intergenic
1113415061 13:110122584-110122606 CTGTGTGAAGATGATGGCAGAGG - Intergenic
1114328398 14:21612549-21612571 CTTTGGCCACATGATGTCACTGG + Intergenic
1117547618 14:56805874-56805896 ATGTGTGCATTTGAAGGCACGGG - Intronic
1118914943 14:70094977-70094999 CTGTGTCCACATCCTGGCTCAGG + Intronic
1119377416 14:74206040-74206062 CTGAGTGTCCATGCTGGCACAGG - Intergenic
1121913891 14:97818654-97818676 CTGAGTGCACATCCTGGCGCAGG - Intergenic
1122791558 14:104186001-104186023 CTGTGTCCCCATGTTGTCACCGG + Intergenic
1123013165 14:105358947-105358969 CCGTGAGAATATGATGGCACTGG + Intronic
1123893451 15:24804124-24804146 CTGTGCTAACATGATGTCACAGG + Intergenic
1124641578 15:31399523-31399545 CTGTGTGGGCAGGATGGCTCTGG - Intronic
1128053274 15:64681952-64681974 CTCTGTGGAGATGAAGGCACGGG + Exonic
1129255629 15:74332522-74332544 CTGTGTGCACCTGATCCCACTGG + Intronic
1130012559 15:80163025-80163047 CTGTGTGTGACTGATGGCACTGG - Intronic
1132848694 16:2013622-2013644 CTCAGTGCACAGGATGGCAAAGG + Intronic
1133293345 16:4737167-4737189 CTCAGTGCACAGGTTGGCACTGG + Intronic
1138330920 16:56214715-56214737 CTGTGTTCCCAGGATGGCAGAGG - Intronic
1138334385 16:56241029-56241051 CTCTGTGTACATGGTGGCCCAGG + Intronic
1138423077 16:56912519-56912541 CTGTGGCCACAGGCTGGCACAGG + Intronic
1139348669 16:66321648-66321670 CACTGTGCACATGAAGGCAGAGG + Intergenic
1145372058 17:22314841-22314863 CACTGTCCACATGATGCCACTGG + Intergenic
1145375417 17:22343035-22343057 CACTGTCCACATGATGCCACTGG + Intergenic
1149435165 17:56627849-56627871 CTGTGGGCACTTGAGGGCCCAGG - Intergenic
1150720496 17:67610248-67610270 TTGTGTGCGCATGAAAGCACCGG + Intronic
1152291609 17:79443042-79443064 CTGTGAGGACCTCATGGCACAGG - Intronic
1152608421 17:81304250-81304272 CCGTGTGGACATGAGGGCAGAGG + Intergenic
1154489773 18:14911577-14911599 CTTTGTGCACATGATTGCTTTGG + Intergenic
1156426573 18:37019928-37019950 CTGTGTGAACATCCTGGTACAGG - Intronic
1156588407 18:38458799-38458821 CTGAGTACACATGAAGGCAAAGG - Intergenic
1158287243 18:55897516-55897538 CTCAGTGCACATGTTGCCACTGG - Intergenic
1159888956 18:73936623-73936645 CTGTGTGCACATGGTGACTGAGG + Intergenic
1159944739 18:74435922-74435944 GTGTGTGCACATGAGTGCACGGG - Exonic
1160202391 18:76806576-76806598 GTGTGTGCACATGAGGGCCCCGG - Intronic
1161315540 19:3615632-3615654 CTGTGGGCCCAGCATGGCACAGG - Intronic
1166784787 19:45361194-45361216 CTTTGTGCTCCTGAGGGCACTGG - Intronic
927504092 2:23602108-23602130 CTCTGTGCTCGTCATGGCACAGG - Intronic
929558738 2:42942410-42942432 CAGTGTGCACATGGAGGCAGGGG - Intergenic
933260389 2:80125551-80125573 CTCTATGCACAGGATGGCAGAGG - Intronic
934152572 2:89161795-89161817 CTGTGTCCACACTATGGCAACGG + Intergenic
934214673 2:90020123-90020145 CTGTGTCCACACTATGGCAACGG - Intergenic
935688570 2:105709762-105709784 CTGGGTGCACATGAAGGCACAGG - Intergenic
938392138 2:130914927-130914949 CTGTGGGCACATGAGGGCACTGG + Intronic
944913823 2:204337190-204337212 GTGTGTGCACATGATGGTGGAGG - Intergenic
945829603 2:214767120-214767142 TTGTGGGCACATGATGGAGCTGG - Intronic
946328108 2:218995201-218995223 CTGTGAGCACTTTTTGGCACGGG - Intergenic
946369700 2:219273223-219273245 CTGTGTGTGCATGATGCCACAGG - Intronic
948649343 2:239430299-239430321 CTGTGTGGACAGGATGACAAAGG - Intergenic
949020427 2:241738211-241738233 CTGAGTGCACACCATGGCCCAGG + Intronic
949059832 2:241950346-241950368 CTGTGTGCGCATGCTGTCTCAGG + Intergenic
1168804795 20:666036-666058 CTGTGTGCCCCTGAAGGCAAGGG + Intronic
1168861818 20:1051183-1051205 CTGTGTGCGCGTGCAGGCACTGG - Intergenic
1169813844 20:9635682-9635704 CTCAGTGAACATGAAGGCACTGG + Intronic
1171545957 20:26001472-26001494 CACTGTTCACATGATGCCACTGG + Intergenic
1173227167 20:41168689-41168711 GTGTGTGCACATGAAGCCCCAGG + Intronic
1175257207 20:57654728-57654750 CTGTCTGCACATGGAGGCCCTGG - Intronic
1176264450 20:64201837-64201859 CTGTGTGCAGACCATGGCACTGG + Intronic
1176369731 21:6055582-6055604 GTGTGTGCACATGCATGCACAGG - Intergenic
1179753788 21:43482959-43482981 GTGTGTGCACATGCATGCACAGG + Intergenic
1180758268 22:18178364-18178386 CTGTGTGCAGATGGAGGCAGTGG - Intergenic
1180768556 22:18362156-18362178 CTGTGTGCAGATGGAGGCAGTGG - Intergenic
1180777754 22:18500235-18500257 CTGTGTGCAGATGGAGGCAGTGG + Intergenic
1180810480 22:18757546-18757568 CTGTGTGCAGATGGAGGCAGTGG + Intergenic
1180826431 22:18865380-18865402 CTGTGTGCAGATGGAGGCAGTGG - Intergenic
1180931565 22:19595860-19595882 CTTTGAGCACAAGATGGCCCAGG + Intergenic
1181196624 22:21191801-21191823 CTGTGTGCAGATGGAGGCAGTGG + Intergenic
1181212903 22:21301323-21301345 CTGTGTGCAGATGGAGGCAGTGG - Intergenic
1182041994 22:27245346-27245368 CTGTGTGCAGATGCTGTCTCGGG + Intergenic
1183439688 22:37816177-37816199 CTGTGGGCACAAGGTGTCACAGG - Intronic
1203230174 22_KI270731v1_random:103044-103066 CTGTGTGCAGATGGAGGCAGTGG - Intergenic
1203276574 22_KI270734v1_random:91286-91308 CTGTGTGCAGATGGAGGCAGTGG - Intergenic
949908446 3:8879381-8879403 CTGTGTGCACATGACTGTGCAGG - Exonic
950837531 3:15935330-15935352 CTGTGTGACCTTGAGGGCACGGG - Intergenic
952879647 3:37975544-37975566 CCGTGTACATAAGATGGCACTGG - Intronic
955199522 3:56837819-56837841 CTGTGTGCACATGATGGCACAGG - Intronic
955503340 3:59606647-59606669 CTGGGTACAAAGGATGGCACTGG + Intergenic
961081919 3:124034253-124034275 CTCTGTGCACATCAGGGCCCCGG - Intergenic
961625302 3:128258204-128258226 CTTTGTGCCCAGGCTGGCACTGG + Intronic
964055175 3:152446668-152446690 CAGCGAGCACATGATGGCAATGG - Intronic
964298942 3:155266250-155266272 CTGTGTGCACATGAAGGTATAGG + Intergenic
967381197 3:188860286-188860308 CTGAGTTCAGATAATGGCACTGG + Intronic
968264385 3:197351336-197351358 CTCTGTGGTCATGATGGCAAGGG + Intergenic
975762624 4:77633836-77633858 CTGTGAGAGCATGATGGGACGGG - Intergenic
976461765 4:85320350-85320372 CTGTGGGCACATGGTGGGAGGGG + Intergenic
981627595 4:146776810-146776832 CTGTGTGCTCATTGTGGCAGTGG + Intronic
982765338 4:159340883-159340905 CTGTGTTCCCATTTTGGCACCGG + Intronic
985514653 5:335313-335335 CTGTGTGCATGTGTTGGCAGTGG + Intronic
990092939 5:52077586-52077608 CTGTTTGCAAATGATGTTACAGG + Intronic
995777408 5:115738744-115738766 ATGTGTGACCATGAGGGCACTGG - Intergenic
996110782 5:119564013-119564035 CTGTGTGCAGATGATGGACCAGG + Intronic
997952394 5:138252851-138252873 CAGTGCGCAGATGAGGGCACAGG - Exonic
1000073047 5:157758897-157758919 CTGTGTACAGAGAATGGCACAGG - Exonic
1001576677 5:172769291-172769313 CACTGTGCAAAGGATGGCACAGG + Intronic
1002574029 5:180161477-180161499 CTGTGTGGACCTGATGGGGCCGG + Intronic
1003201385 6:3964539-3964561 CAGTGTGACCCTGATGGCACTGG + Intergenic
1006933924 6:37704464-37704486 CTGTGTGCTCAGCTTGGCACTGG - Intergenic
1006984608 6:38168346-38168368 CAGTGTCCATATGAGGGCACTGG + Intergenic
1007424837 6:41740221-41740243 CTGTGAGCCCATGATGGGGCTGG + Intronic
1008439289 6:51514191-51514213 CTGTGTGTACGTGATGGCTTGGG - Intergenic
1008685176 6:53918077-53918099 CTGTGAGCACATGGTGGCACTGG + Intronic
1009965382 6:70572814-70572836 GTGTGTGCACATGCATGCACAGG + Intronic
1010633094 6:78223161-78223183 GTGTCTGCATATGATGGCCCTGG + Intergenic
1011550834 6:88529845-88529867 CTGTGTGCACAGGCAGGCCCCGG + Intergenic
1012533999 6:100273787-100273809 CTGAGTGAACATGAAGGCATAGG - Intergenic
1013647664 6:112161532-112161554 CTGTGTGCTCATTATGGACCAGG + Intronic
1016600236 6:145850053-145850075 CTCTGAGCACACCATGGCACAGG + Intergenic
1020313505 7:6887557-6887579 CTGTGTGCCAGAGATGGCACTGG - Intergenic
1021727490 7:23563561-23563583 CTGTATGCAAATGACAGCACAGG + Intergenic
1022823631 7:33986649-33986671 CTGTGTGAAGAGGATGGAACGGG + Intronic
1023503548 7:40876335-40876357 CTATGTGCACATGAAAGCTCTGG - Intergenic
1023973056 7:45005927-45005949 CTGTATGCACTTGAAGCCACTGG + Intronic
1023983114 7:45080992-45081014 CTTTGTGCACTTGCTGGGACAGG + Exonic
1024245245 7:47464786-47464808 CTGAGTGCAAATGATGGCAGAGG - Intronic
1024588321 7:50859866-50859888 CTGTGTCCACATGAAGGAAGGGG - Intergenic
1035178539 7:157072285-157072307 CAGTGTGCACTTGAAGGCATAGG - Intergenic
1035228133 7:157444757-157444779 ATGTGTGCAGAGGATGGCCCAGG + Intergenic
1035762425 8:2079042-2079064 CTGTGTGCAGAGCATAGCACAGG + Intronic
1037917371 8:22780883-22780905 CTGTGTGCAGTTCAGGGCACAGG - Intronic
1040801904 8:51351386-51351408 CTGTGTGAACATGAAGGTAGAGG + Intronic
1042036762 8:64541681-64541703 CTGTGTGCAGAGAAAGGCACAGG - Intergenic
1042326480 8:67534127-67534149 CTCTGTGCACATGATGTCATTGG - Intronic
1043950013 8:86298584-86298606 CTGTGTGCAAATGAGAGCTCAGG + Intronic
1049097517 8:140557740-140557762 CTGTGTGGGGATGAGGGCACGGG + Intronic
1049247504 8:141570611-141570633 CAGGGTGCACAGGAGGGCACAGG + Intergenic
1049432904 8:142573552-142573574 CTATGGGCACTTGGTGGCACTGG + Intergenic
1049483733 8:142840487-142840509 CTGAGCGCGCATGGTGGCACTGG - Exonic
1049576286 8:143391410-143391432 CTGTGTGCCCAACATGGAACAGG + Intergenic
1051836296 9:21341780-21341802 CTGTGTGCACATTAGGCCAGAGG - Intergenic
1054466087 9:65495351-65495373 CACTGTTCACATGATGCCACTGG + Intergenic
1055565956 9:77568696-77568718 CTGGGTGCACAAGGTGGTACAGG + Intronic
1056468113 9:86878831-86878853 ATGTGTGCACATGATGGGGAAGG - Intergenic
1057047826 9:91899481-91899503 ATGTGTGCACCTGAAGGCACCGG - Intronic
1059332796 9:113546736-113546758 CTGTGTTCCCATGCTGACACTGG + Intronic
1059964814 9:119603186-119603208 CTGAGTGTACATGATGAAACAGG - Intergenic
1186349232 X:8726709-8726731 GGGTCTGCCCATGATGGCACAGG - Intronic
1188042970 X:25391508-25391530 TTGGGTACACATGAGGGCACAGG - Intergenic
1192811380 X:74550131-74550153 CTGTGTGGACATAATGTTACTGG + Intergenic
1196526740 X:116737024-116737046 CTGTTTGCAGATGATGGGATTGG - Intergenic
1198272160 X:135065223-135065245 CTGTGTGCTCATAATGACCCAGG + Intergenic
1201471799 Y:14342762-14342784 CTCTGTGCAGGTGATGGCATGGG + Intergenic