ID: 955199993

View in Genome Browser
Species Human (GRCh38)
Location 3:56842982-56843004
Sequence TTGTATAACTAGAAGTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 192}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955199993 Original CRISPR TTGTATAACTAGAAGTTTGA GGG (reversed) Intronic
902762307 1:18590243-18590265 TTATATAACTTTAAGTTTTAGGG + Intergenic
903107534 1:21095968-21095990 TTGTAGAACTAAAAATGTGAGGG - Intronic
905688256 1:39924504-39924526 TTGCATAACTGGAGGTTAGAGGG + Intergenic
907306299 1:53514903-53514925 TTGTATCACTGGAAGTTTAGGGG + Intronic
908001384 1:59683833-59683855 TTGTATAAACAGAATATTGAAGG + Intronic
908865334 1:68542315-68542337 TTGTATTTCTAAAAGTTTGCAGG - Intergenic
908869769 1:68595967-68595989 TTGTATAAATAGATGGTTTATGG + Intergenic
910313896 1:85859736-85859758 TTGTGTATCTAGAGGTTTGCAGG + Intronic
910572573 1:88722424-88722446 TTCTATAACTAGACCTTTGGAGG + Intronic
910895333 1:92063745-92063767 TAGTATATCTATTAGTTTGAAGG + Intergenic
911660205 1:100493124-100493146 TTTTATATTTAGAATTTTGAAGG + Intronic
913139760 1:115929180-115929202 ATGTATAATTAGCAGTTTCAAGG - Intergenic
917429738 1:174953665-174953687 TTTCATAACCAGCAGTTTGAAGG - Intronic
918174562 1:182031506-182031528 ATGTATAAATAGATGTTTTAAGG + Intergenic
924035551 1:239932910-239932932 TTGGATAGCTTAAAGTTTGAAGG - Intergenic
924495033 1:244579640-244579662 ATGAATAACTAGTAGTTTGAAGG - Intronic
1067672447 10:48335229-48335251 ATGATTAACTAGAATTTTGATGG - Intronic
1070111294 10:73489281-73489303 TTGTCTAATTAGAAGATTAATGG - Intronic
1071279044 10:84082896-84082918 ATTTCTAATTAGAAGTTTGATGG + Intergenic
1071412047 10:85406655-85406677 TGGTAAAACCAGAAGTATGAAGG + Intergenic
1071619421 10:87105581-87105603 TTATCTAACAAGAAGTCTGAAGG + Intronic
1073068222 10:100776771-100776793 TTGTGTAACTGGAAGCTTGGTGG - Intronic
1074621463 10:115128311-115128333 TTTTATATCTAGAAGACTGAGGG + Intronic
1081049499 11:38320168-38320190 TTGTATACCTAGTGTTTTGAGGG - Intergenic
1081234157 11:40625669-40625691 TTTTATAACAGTAAGTTTGATGG - Intronic
1084368931 11:68725059-68725081 TTGTTTAAATAGAAAGTTGAAGG + Intronic
1085920169 11:80944900-80944922 TTGTATGACTGGAAGTGTGAGGG - Intergenic
1086426113 11:86683953-86683975 CTGCATTACTAGAATTTTGATGG - Intergenic
1086506917 11:87514794-87514816 TAGGATAACTACAAGTTCGAAGG + Intergenic
1086851229 11:91811337-91811359 TTTTAGAACCAGAAGTCTGAAGG + Intergenic
1087174393 11:95082741-95082763 TTGTATAAAGAGAATATTGAGGG - Intergenic
1088388054 11:109281645-109281667 TTGTATACCTAGAAGGATCATGG + Intergenic
1090479890 11:127058824-127058846 TTGTAGATCTAGAAGTCAGAGGG - Intergenic
1091737232 12:2932827-2932849 TTTTTTAACTGGAAGTTTTAGGG + Intronic
1094281891 12:28749320-28749342 TTGTAGAATTATAAGTTTGTTGG - Intergenic
1095811399 12:46375936-46375958 CTGGATAAATAGAATTTTGAGGG - Intergenic
1096193288 12:49633628-49633650 TTGTTTGACTAGAACTGTGATGG - Exonic
1098561681 12:71880078-71880100 TTAAATAACTAAAAGTTTGGAGG + Intronic
1099789866 12:87319710-87319732 TTATATAACTAGAAAGTTGCAGG - Intergenic
1104395696 12:128430510-128430532 CTGTATAATTATAAGTTTGTTGG - Intronic
1105412263 13:20180338-20180360 TTCTACAACTAGAAGTTTGCTGG + Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1107576754 13:41732521-41732543 TTGTTTAAATATAATTTTGATGG + Intronic
1109709162 13:66141218-66141240 TTGCAAAAGTAAAAGTTTGATGG - Intergenic
1110874698 13:80494007-80494029 TTGAAAAACTACAATTTTGACGG - Intergenic
1111829004 13:93303009-93303031 TTATATAATTATAAGTTTGTTGG - Intronic
1112665723 13:101570756-101570778 TTATATAATTATAAGTTTGTTGG + Intronic
1112953179 13:105027974-105027996 TGGTATAACTCTAAGTCTGAGGG - Intergenic
1114808422 14:25865011-25865033 TTGTATTTCTAGGAGGTTGAGGG - Intergenic
1115681451 14:35743184-35743206 TTGTTTAACTATAATGTTGATGG - Intronic
1115969800 14:38932550-38932572 TTGTATACCTAGGAGTATTATGG - Intergenic
1118476646 14:66123576-66123598 TTGTATACCTTGAAGTTTTGAGG - Intergenic
1118505792 14:66410131-66410153 TAGTATATATAGAATTTTGAGGG - Intergenic
1118805642 14:69234542-69234564 TTTTATAATAAGAAGTTTTAAGG + Intronic
1121927145 14:97938126-97938148 TTGAATAACTAGAAGTAGGAAGG + Intronic
1122351617 14:101097832-101097854 TTATATAATTATAAGTTTGTTGG - Intergenic
1127493566 15:59488237-59488259 TTGTATACCTAGTTTTTTGAGGG - Intronic
1128346680 15:66857720-66857742 TTATATAATTATAAGTTTGTTGG - Intergenic
1129916514 15:79278340-79278362 CTGCATAACTAAAAGTCTGAAGG - Intergenic
1130020168 15:80223572-80223594 TTGTATATCTAGAAGGTTGCTGG + Intergenic
1135151850 16:20014373-20014395 TTATATAATTATAAGTTTGTTGG - Intergenic
1136527345 16:30840516-30840538 TTGTAAAACTTGGAATTTGATGG - Intronic
1138204962 16:55117968-55117990 TTCTGTAACTAGAACCTTGAAGG - Intergenic
1139054679 16:63168109-63168131 TTGTATCAGTATAAGTTTGTAGG - Intergenic
1139233740 16:65312402-65312424 TTTTAAAACTAGAAGTCTGGAGG + Intergenic
1146195998 17:30813614-30813636 TTTAATAACTATAAGTTTTAGGG + Intronic
1149154599 17:53611689-53611711 TTGTATAACTTGAAAATTTATGG + Intergenic
1149203021 17:54210123-54210145 TTGTACAACAAGAAGATTAAGGG - Intergenic
1153325103 18:3810650-3810672 TTATTTTTCTAGAAGTTTGAAGG - Intronic
1156708823 18:39916829-39916851 TTGTAAAACTGGAGGTTTGCTGG + Intergenic
1157610250 18:48951229-48951251 AAGTATAACAAGATGTTTGATGG + Intergenic
1160361729 18:78288641-78288663 ATGTATAACCAGAAGTGGGATGG - Intergenic
925598103 2:5577353-5577375 TTGTATATCTAGGAGTTTGAAGG - Intergenic
926839597 2:17064945-17064967 TTGTATAACGAGAAGTCAGTTGG + Intergenic
928406883 2:31021612-31021634 TTTTATAAATAGAAGTTTTATGG + Intronic
929895349 2:45955291-45955313 TGGTATAATGAGAAGTTTGGAGG + Intronic
930132968 2:47871514-47871536 TTTTATACCTATTAGTTTGAGGG - Intronic
930530703 2:52584661-52584683 TAGTAATACTAGAAGTTTAAAGG + Intergenic
934076337 2:88431812-88431834 ATGTTTAACTAGAAGTTAAATGG + Intergenic
934885788 2:98023197-98023219 TTATATAATTACAAGTTTGTTGG - Intergenic
936636821 2:114268182-114268204 AAGTATAAATAGAAGTCTGATGG + Intergenic
937591679 2:123620718-123620740 TTGTATAACCAGTTTTTTGAGGG - Intergenic
939629224 2:144514384-144514406 TCGTATAAGTAGAAGCTGGAAGG - Intronic
939698335 2:145356758-145356780 TTATATAAATAAAAGTTGGAGGG - Intergenic
940805024 2:158177658-158177680 TTGAATAACTAAAATTTTGTAGG + Intronic
940852850 2:158704648-158704670 TTTTAAAACATGAAGTTTGAGGG + Intergenic
940938870 2:159533515-159533537 TTCTACAACTTGAAGTTTGTGGG - Intronic
941521773 2:166553737-166553759 TTTTATATCTAGAACTTTAAGGG - Intergenic
941555055 2:166967939-166967961 TTGTTTATATAGAAGTTTTATGG - Intronic
944306467 2:198185431-198185453 CTGTATACCTAGAAGTTTGAAGG + Intronic
944956470 2:204817052-204817074 TTTTATCTCTAGAAGTTTGTTGG + Intronic
945818810 2:214637868-214637890 TTTTATAACTACAAATTTCAAGG - Intergenic
947080067 2:226386146-226386168 TTATAGAACAAGAAGTTTGGGGG - Intergenic
1172862727 20:38068089-38068111 TTGTAGAACTAGTGGTTTGCTGG + Intronic
1177165176 21:17593960-17593982 TTCTATAAAAATAAGTTTGATGG + Exonic
1177279507 21:18962819-18962841 ATGCATAACTAGAAGTTATATGG - Intergenic
1177520962 21:22224966-22224988 TTTTTTAACTAAAATTTTGAGGG - Intergenic
1177914700 21:27074476-27074498 TTCTATTAATAGAAGTGTGATGG - Intergenic
1179138080 21:38698279-38698301 TTGTAAAACTAGAGGCTGGATGG + Intergenic
1182168875 22:28206285-28206307 TTTTATAAGAAGAAATTTGAGGG - Intronic
1184256353 22:43289244-43289266 TTGTATAAGAAGCAGATTGATGG - Intronic
949929238 3:9065338-9065360 TTGTCAAACTAGAAGGTTGTTGG - Intronic
950839029 3:15949126-15949148 TAGTATAACCAGTAGTGTGATGG + Intergenic
952077818 3:29719576-29719598 TTGCAAAACTAGATGTTTAATGG + Intronic
952185564 3:30964250-30964272 TTAATTATCTAGAAGTTTGATGG - Intergenic
953695185 3:45152723-45152745 TTGTATAAGGGGAAGTTTGATGG + Intergenic
955199993 3:56842982-56843004 TTGTATAACTAGAAGTTTGAGGG - Intronic
955638872 3:61060207-61060229 TGGTCTATTTAGAAGTTTGATGG + Intronic
956628291 3:71288845-71288867 TTATATAACTAGCAGTCTGCTGG - Intronic
957160660 3:76605499-76605521 TTATATAACTAGAAATTCTAGGG - Intronic
957382757 3:79454519-79454541 ATGCATCACTAGAAATTTGAAGG - Intronic
958597255 3:96242876-96242898 ATATATAACCAGAAGTCTGAGGG - Intergenic
960090569 3:113634310-113634332 TTCTATAAATAGAAATTGGAAGG - Intergenic
960270235 3:115665915-115665937 TTGTTTTACTAGATGTGTGAGGG + Intronic
960345764 3:116530360-116530382 CTGTATAGGTAGAAGTTTAAAGG + Intronic
964433571 3:156629721-156629743 TCTTATAACTAGAAGTCTGAGGG - Intergenic
965327470 3:167324890-167324912 TTGTAGAAGAAGAAGTTGGAAGG - Intronic
967072933 3:185977466-185977488 TTGTATACCAAGAAGTGTCAGGG - Intergenic
967629177 3:191723292-191723314 TAATATCACTAGAAGTTAGAGGG - Intergenic
968182571 3:196607215-196607237 TTTTAAAACCAAAAGTTTGAGGG - Intergenic
970751051 4:19362050-19362072 TTCTTCAACTTGAAGTTTGATGG - Intergenic
970755535 4:19421572-19421594 TTATATAAATAGGAGTTGGATGG + Intergenic
970889832 4:21030636-21030658 TTGTTTAACTAGAAGTGTTCAGG + Intronic
971886775 4:32460123-32460145 TTATATAAATAAAAGTTTTATGG + Intergenic
972580394 4:40390503-40390525 CTGTATCCCTAGAATTTTGATGG - Intergenic
972988981 4:44799790-44799812 TTATATAAAAAGAAGTTTAATGG - Intergenic
973987930 4:56373650-56373672 CTCTAAAACTTGAAGTTTGAGGG - Intronic
974157073 4:58087624-58087646 TTATATAAATAGATTTTTGATGG - Intergenic
974524900 4:63037781-63037803 TAATATAACTAGTAATTTGATGG + Intergenic
974960277 4:68691297-68691319 TGGGATAAAAAGAAGTTTGAAGG + Intergenic
976036183 4:80823999-80824021 TTGTATCAATAAAAGTTTTATGG - Intronic
976849003 4:89523766-89523788 ATGTATAATTAGAAATTTGCAGG - Intergenic
977405195 4:96588965-96588987 ATGTCGAACAAGAAGTTTGAAGG - Intergenic
979045993 4:115865455-115865477 TTGCTTAACTTGGAGTTTGATGG - Intergenic
980498064 4:133609919-133609941 GTGCATGACTTGAAGTTTGAAGG + Intergenic
983120611 4:163879353-163879375 TTGTATAACTACAGCTTTCATGG + Intronic
983807352 4:172011655-172011677 TTCTGTAACTAGAGGTTTAAGGG - Intronic
984383174 4:179020964-179020986 TTGCATAACTAGAAGTATTCTGG + Intergenic
986488487 5:8265228-8265250 TTGGATCCCTAAAAGTTTGATGG - Intergenic
987007925 5:13730032-13730054 TAGTAGTACTAGATGTTTGAAGG + Intronic
987631224 5:20475091-20475113 TAGTATAATTAGAATTTTAATGG - Intronic
989392632 5:40917695-40917717 TATTTTAAATAGAAGTTTGAAGG - Intronic
991151111 5:63371690-63371712 ATGAATAACAAGAAGTTTTAGGG - Intergenic
991356950 5:65778638-65778660 TTGTATAACTAGAAGGTCGAGGG + Intronic
991386940 5:66101124-66101146 TTGTGTAACCAGGAGTATGATGG - Intergenic
992608377 5:78485340-78485362 TAGGATAACTACAAGTTTGAAGG + Exonic
994331870 5:98515741-98515763 TTTTATAAATAGAAGTTTATTGG + Intergenic
995787758 5:115848737-115848759 TTATACAACAAGAAGTTGGAAGG - Intronic
996247783 5:121285979-121286001 TTGGCTAACTTGAAGTTTAATGG - Intergenic
998576926 5:143326919-143326941 TTGAATAACTAGAAATTTGTTGG - Intronic
999882323 5:155879588-155879610 TTGTATAAGATGCAGTTTGAAGG + Intronic
1000215240 5:159149087-159149109 TTGTATGACATGAACTTTGAGGG - Intergenic
1001622361 5:173098425-173098447 CTGTATAACTAGAAATCAGAAGG - Intronic
1002403851 5:179013459-179013481 TTGCATAATTAGAAGTTTTCTGG + Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1005615742 6:27571229-27571251 TGATATAACTAAAAATTTGAAGG + Intergenic
1006429246 6:33984973-33984995 TTGCATAACAAGAAGTCTGGAGG - Intergenic
1007008140 6:38387127-38387149 TTGTTTAATTTGAAGTTTGTAGG - Intronic
1008192696 6:48479589-48479611 TTGTATACCAAGTATTTTGAGGG - Intergenic
1008727209 6:54436695-54436717 TTGTATAACTAGTTTTTTGAGGG + Intergenic
1008837951 6:55860524-55860546 TTGTAATGCTAGAAGTGTGAAGG - Intronic
1009320368 6:62280625-62280647 TAGTATTATCAGAAGTTTGAAGG + Intronic
1009385283 6:63079511-63079533 TTGCATATTTAGAAGTTGGAAGG + Intergenic
1011090265 6:83589909-83589931 TTGTATAACTTGTAATTTTATGG + Intronic
1011933438 6:92742290-92742312 TTGTATGAATAGAGGCTTGAAGG + Intergenic
1013937664 6:115617552-115617574 TTTTATAACTTGTAGTTTGTAGG + Intergenic
1015062908 6:128989173-128989195 TTGTATTGTTAGAACTTTGAAGG - Intronic
1015371171 6:132455128-132455150 TTGTATAGCTAAAAACTTGACGG - Exonic
1015509148 6:134020314-134020336 TTGTGTAAATAGAGGTATGAAGG - Intronic
1015792687 6:136979958-136979980 TCGTAGAACTAGAGGGTTGAGGG - Intergenic
1016053666 6:139556019-139556041 TTGTATAAATATAAATTTGGTGG - Intergenic
1016176864 6:141088914-141088936 TTGTATCATATGAAGTTTGAGGG - Intergenic
1018351024 6:162959314-162959336 TTGTATAACTAGAGGGGTCAGGG + Intronic
1023424702 7:40023359-40023381 ATGTATAATCAGAAGTTTGCAGG - Intronic
1023468004 7:40479538-40479560 CTGTATACCTAGAAGTGAGATGG + Intronic
1028411005 7:90530377-90530399 TTATATAACTGGAAGTTCAAGGG - Intronic
1028895937 7:96041758-96041780 TTATATAATTAGAAGTTGAAAGG + Intronic
1030400765 7:109046862-109046884 TTATATAAATAGAAGTTTGTTGG + Intergenic
1031494329 7:122427804-122427826 TTAAAAAACTAGAATTTTGATGG + Intronic
1032304005 7:130715555-130715577 TTATATAACAAGAAATTTGGAGG - Intergenic
1032459576 7:132100573-132100595 CTGGATGACCAGAAGTTTGAAGG + Intergenic
1034876396 7:154728441-154728463 TTAAATAACTAGAAGTCAGAGGG + Intronic
1034924805 7:155112715-155112737 TTCTAGAACTAGATGTTTAAAGG + Intergenic
1036292706 8:7507879-7507901 TTCTATGACTAAAAGTCTGAAGG + Intronic
1036329856 8:7813134-7813156 TTCTATGACTAAAAGTCTGAAGG - Intronic
1039223975 8:35367330-35367352 TTGAAAAAATAGAAGTTTAATGG - Intronic
1040994734 8:53390168-53390190 TTGAATATCTAGAAGCTTGGGGG + Intergenic
1044136320 8:88590848-88590870 TGAAATATCTAGAAGTTTGATGG + Intergenic
1044186507 8:89259140-89259162 TTGTATAAATAGAACTAAGATGG - Intergenic
1044434225 8:92143251-92143273 TTGTATAACAAGATTTTTTAAGG + Intergenic
1044776254 8:95692050-95692072 TTGTATAAGTACAACTCTGATGG + Intergenic
1044928366 8:97228533-97228555 ATGGATAACTAGAAGTTGGAAGG - Intergenic
1046286103 8:112094308-112094330 TGGTATAAATACAAATTTGAAGG - Intergenic
1050128569 9:2385692-2385714 TTTTGGAACTAGAAGTTTAATGG - Intergenic
1051520528 9:17982149-17982171 GTGTATAACTGGAAGCTTCAGGG - Intergenic
1051534271 9:18139579-18139601 TTGGATACCTAAAAGTTGGATGG - Intergenic
1052068094 9:24047864-24047886 TTGTATAACTGAAAATTTGGGGG + Intergenic
1052160413 9:25250771-25250793 TTCTATAAGTACAAGTTTGCCGG - Intergenic
1055060147 9:72059836-72059858 TTCTGGAACTAGAAGTTTTATGG - Intronic
1057000237 9:91502473-91502495 TTGTATACTTAGAAGCTTGAGGG - Intergenic
1186586354 X:10877428-10877450 TCATATAATTAGAAGTTTAAAGG - Intergenic
1186612156 X:11148339-11148361 TTGTATGTCTTGGAGTTTGATGG + Intronic
1188539730 X:31236251-31236273 TTGTAGAACAAGAAGTCTGGAGG - Intronic
1188813056 X:34676600-34676622 TTGTAGAATTACAAGTTTGTTGG - Intergenic
1189969268 X:46401537-46401559 ATGTTTAACTTGAAGCTTGATGG - Intergenic
1191047229 X:56151557-56151579 TTGTGTAACTGGATGTGTGATGG + Intergenic
1191829218 X:65397597-65397619 TTGTATACCTAGCTTTTTGAGGG - Intronic
1192588821 X:72342579-72342601 TTTTAGAACTAGAAGCTGGAGGG + Intronic
1196140500 X:112256870-112256892 TTTTATAACTAAAAGATTGCTGG - Intergenic
1196507950 X:116471271-116471293 TTCTATACCTAGATTTTTGATGG + Intergenic