ID: 955201856

View in Genome Browser
Species Human (GRCh38)
Location 3:56858789-56858811
Sequence CAAGAGATGGAGAGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1003
Summary {0: 1, 1: 0, 2: 6, 3: 115, 4: 881}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955201847_955201856 26 Left 955201847 3:56858740-56858762 CCTTGAATGTTTCAGTAGCATCA 0: 1
1: 0
2: 2
3: 11
4: 200
Right 955201856 3:56858789-56858811 CAAGAGATGGAGAGGGTGGAGGG 0: 1
1: 0
2: 6
3: 115
4: 881

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955201856 Original CRISPR CAAGAGATGGAGAGGGTGGA GGG Intronic
900018183 1:169071-169093 CAGGTGATGGAGAGGGTGGGAGG + Intergenic
900048442 1:527667-527689 CAGGTGATGGAGAGGGTGGGAGG + Intergenic
900070668 1:769519-769541 CAGGTGATGGAGAGGGTGGGAGG + Intergenic
900269759 1:1781055-1781077 GCAGGGATGGGGAGGGTGGAGGG + Intergenic
900714732 1:4137008-4137030 CAAGAGAGGGAGAGGATGGAAGG - Intergenic
900805308 1:4763713-4763735 AAAGAGAGGGAGAGGAGGGAGGG - Intronic
901021605 1:6258831-6258853 CAACACATGGACAGGGTGGGCGG - Intronic
901152559 1:7113487-7113509 CTAGGAATGGAGAGGGAGGAAGG + Intronic
901336411 1:8453072-8453094 AAAGAGAGGGAGAGAGAGGAAGG + Intronic
901475536 1:9486749-9486771 AAAGTGATGGAGAGGTTGTAGGG - Intergenic
901652148 1:10749181-10749203 CAAGATGGGGACAGGGTGGAGGG - Intronic
902538974 1:17138925-17138947 GAGTGGATGGAGAGGGTGGAAGG + Intergenic
902691538 1:18112937-18112959 AAGGAGGTGGAGAGGGAGGATGG - Intronic
902700281 1:18167656-18167678 CAGCAGAAGGAAAGGGTGGACGG - Intronic
902793265 1:18783624-18783646 CAAAGGGTGGAGAGGGAGGAGGG + Intergenic
903057155 1:20644227-20644249 CATGGGATGGATAGGATGGATGG + Intronic
903221897 1:21873896-21873918 CAGGGGGTGGAGAGGGTGGGGGG - Intronic
903321815 1:22547872-22547894 GAAGAGATGGAGTGGGGAGAGGG - Intergenic
903480866 1:23652401-23652423 ACAGAGAGGGAGAGGGAGGAGGG + Intergenic
903687967 1:25146458-25146480 CAAGGGAGGGAGAGAGTGGGAGG - Intergenic
903848201 1:26290830-26290852 TCAGAGATGCAGAGGGTGGGGGG + Intronic
904377591 1:30091501-30091523 GAAGGGATGCAGAGGATGGAGGG + Intergenic
904469533 1:30727905-30727927 GAAGAGAGGGAGAGGGAGGGAGG - Intergenic
904469549 1:30727959-30727981 GAAGAGAGGGAGATGGTGGGAGG - Intergenic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
904894107 1:33801192-33801214 AGAGAGATGGAGAGTGAGGATGG - Intronic
905184498 1:36186806-36186828 CTAGAGATTGAGAGGGAGCATGG + Intergenic
905407706 1:37746949-37746971 CAAGAGCTAGAGGAGGTGGATGG + Intronic
905566260 1:38967511-38967533 GAAGAGATGGAGGAGGTGGAAGG + Intergenic
905799632 1:40834892-40834914 AAAGAGATGGAGAGGGTGCTGGG + Intronic
905942963 1:41878825-41878847 CAGGAGATGGGGAGGAAGGAAGG - Intronic
905993228 1:42358291-42358313 CAAGAGTTTGTCAGGGTGGAAGG - Intergenic
906018886 1:42609114-42609136 GAAGAGGTGGAGAAGGTGGAAGG - Intronic
906098864 1:43243190-43243212 GAAGAGAGAGGGAGGGTGGATGG - Intronic
906197576 1:43938469-43938491 TGAGAGATGGAGAGGGTCGAGGG + Intergenic
906526829 1:46498304-46498326 CAAGAGATTGTGAGGGAGGCAGG - Intergenic
906539162 1:46571952-46571974 CAGGAGATGGTGTGGCTGGAAGG - Intronic
906798252 1:48714488-48714510 CGAGAGATTGAAGGGGTGGATGG - Intronic
906882765 1:49610550-49610572 TAAGAGATGGAGACACTGGAAGG + Intronic
907082412 1:51636130-51636152 CAAGAGAGAGAGAGGAAGGAAGG - Intronic
907110634 1:51923347-51923369 CAGGAGAGGGAGAGGCTGGCAGG + Intronic
907259695 1:53208281-53208303 CAAGGGATGGAATGAGTGGATGG + Intronic
907683751 1:56589933-56589955 AAAGAGAGAGAGAGGGAGGAAGG + Intronic
907865591 1:58396535-58396557 CAAGAGATGGAGAGAGACAAAGG + Intronic
907933308 1:59019777-59019799 CAAGAGATGCAGGGAGTGGCAGG + Intergenic
908048900 1:60206013-60206035 GGAGGGATGGAGTGGGTGGAGGG + Intergenic
908109070 1:60876687-60876709 GAGGAGATGGGGAGAGTGGATGG - Intronic
908304859 1:62802072-62802094 CAGGAGAGGGAGAGGTTAGAGGG - Intronic
908412023 1:63876360-63876382 CAAGTGATGCACAGGGTGGGAGG - Intronic
909205586 1:72753019-72753041 GAAAAGATGGAGAGAGTGAAAGG - Intergenic
909979815 1:82085363-82085385 GAAGAGGTGGAGAAGGTGGAGGG + Intergenic
910120211 1:83779841-83779863 CAAGAGAGGGAGAGGGAGACAGG + Intergenic
910285184 1:85545775-85545797 GAGGAGATGCAGAGGGAGGAGGG + Intronic
910523294 1:88148504-88148526 GAAGAGAGGGAGAGGGAGGGAGG + Intergenic
910556599 1:88541464-88541486 CAAGAGAGAGAGAGAGAGGAGGG + Intergenic
910778305 1:90898708-90898730 GAAAACATGGAGGGGGTGGATGG + Intergenic
910980111 1:92951926-92951948 ACAGAGAAGGAGAGGGTGGGGGG - Intronic
911253029 1:95600475-95600497 CAAGTGATGGTGAGGATGCAGGG - Intergenic
911323742 1:96444964-96444986 CAAGAGATGTGGAAGGAGGAAGG + Intergenic
911452474 1:98081281-98081303 GAAAAGGTGGAGAAGGTGGAAGG + Intergenic
911724873 1:101232736-101232758 TAAAAGATGGAGGTGGTGGATGG + Intergenic
911786529 1:101956471-101956493 GAAGAGAAGGTGAGGGTAGATGG - Intronic
911991270 1:104699679-104699701 CAAAAGGTGGAGGAGGTGGAAGG - Intergenic
912664727 1:111568758-111568780 GAAGAGATGGAGGAAGTGGAAGG - Intronic
912696721 1:111847744-111847766 CAGCAGCTGGAGAGGGAGGATGG + Intronic
912794841 1:112686693-112686715 CAAGAGGAGGAGGGGTTGGAGGG - Intronic
912823703 1:112886975-112886997 AGAGAGATGGTGAGGGTGGTGGG - Intergenic
915584310 1:156835934-156835956 CAAGAAACGGAGAGGGAGAAGGG - Intronic
915777244 1:158503016-158503038 CAAGAGAGAGACAGAGTGGAAGG + Intergenic
916320666 1:163499733-163499755 CAAGAGAGGGAGACCGTAGAAGG + Intergenic
916392398 1:164344784-164344806 GAAGATAAAGAGAGGGTGGATGG - Intergenic
916427946 1:164699630-164699652 CAGGGGATGGAGAGGACGGAGGG + Intronic
916737983 1:167624985-167625007 AGAGAGAGGGAGAGGGAGGAGGG - Intergenic
916744015 1:167670524-167670546 GAGGAGATGGAGAGGGTGCTGGG - Intronic
917726541 1:177833236-177833258 CAAGAGAGAGAGAGAGTGCAGGG + Intergenic
918184720 1:182116527-182116549 GAAGAGGTGGTGAGGGAGGAGGG + Intergenic
919055572 1:192565762-192565784 GAGGAGGTGGAGAGGGAGGAAGG + Intergenic
919463305 1:197903237-197903259 GAATTGATGGAGAAGGTGGAGGG + Intronic
919675319 1:200376542-200376564 CAAGAGGTGGATAGGGTGGATGG - Intergenic
920006304 1:202836014-202836036 CTGGAGATGGAGAGAGGGGAAGG - Intergenic
920467918 1:206203803-206203825 GGAGATTTGGAGAGGGTGGAGGG - Intronic
920728428 1:208459892-208459914 CATGAGATGCATATGGTGGAAGG - Intergenic
921193864 1:212733483-212733505 GGAAAGATGGAGAGGGTGGAAGG - Intronic
921581759 1:216903778-216903800 CCAGAGCTGCAGAGGGTGGTTGG - Intronic
921993827 1:221396073-221396095 GAAGAGATGGACAAGGAGGAAGG - Intergenic
922106029 1:222514934-222514956 CAGGTGATGGAGAGGGTGGGAGG + Intergenic
923037214 1:230292638-230292660 CAAGAGAAGGAGAGAGAGGAAGG - Intergenic
923276426 1:232400755-232400777 AAAGCGATGGAGAGGCTGAACGG - Intronic
923378444 1:233390353-233390375 GAAGAGGTGGAGGAGGTGGAAGG - Intergenic
923384471 1:233452996-233453018 GGGGAGATGGAGAGGGGGGAGGG - Intergenic
923934147 1:238742873-238742895 GAAAAGGTGGAGAGGGTGGAAGG + Intergenic
1062772792 10:116496-116518 CAACAGCTTGAGAGGGTGGAGGG - Intergenic
1062922844 10:1293036-1293058 GAAGAGATGCAGAGGGAGGGAGG + Intronic
1063107440 10:3004813-3004835 CAAGTGTTGGAGAGGGTGTGGGG - Intergenic
1063426453 10:5953664-5953686 CAAGAGAAGGAGAGAGTGACTGG + Intronic
1063488200 10:6439522-6439544 AAAGAGGTGGAGGAGGTGGAAGG - Intronic
1064002297 10:11673741-11673763 TAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1064198597 10:13265575-13265597 CAAGAAATGAAGAGTGTGGCCGG + Intergenic
1064294766 10:14068877-14068899 AAAGAGAGGGAGAGGGAGGGAGG - Intronic
1064294774 10:14068907-14068929 AAAGAGAGGGAGAGGGAGGGAGG - Intronic
1064414451 10:15136406-15136428 ACAGAGAGGGAGAGGGAGGAAGG + Intronic
1065225275 10:23537292-23537314 GAAGAAATGGAGGGAGTGGAAGG - Intergenic
1065480724 10:26191374-26191396 GAATAGATGGAGGAGGTGGAGGG - Intronic
1065853117 10:29807331-29807353 AAAGAGATGGAGAGAGAGAAAGG + Intergenic
1066268961 10:33803367-33803389 CTAGAGATGGAGGAGATGGAAGG + Intergenic
1066453041 10:35548728-35548750 AAAGAGGTGGAGAAGGTGGAAGG + Intronic
1066728150 10:38412399-38412421 CAGGTGATGGAGAGGGTGGGAGG - Intergenic
1068530475 10:58180365-58180387 GAAGAGAGAGAGAGGGAGGAAGG - Intergenic
1069357787 10:67607521-67607543 GAAGAGATGGAGGAGGTGGAAGG + Intronic
1069416950 10:68208910-68208932 TAAGAGATGGAGGGGCTGGGAGG + Intronic
1069711956 10:70495336-70495358 CAAGAGAAGGAGAGGGAGGGAGG - Intronic
1069733272 10:70633330-70633352 GAAGAGATGGAGGAGGTGGAAGG - Intergenic
1070160746 10:73865469-73865491 CAACAGCTGGAGAGGCTGGGTGG - Intronic
1070353212 10:75613387-75613409 TAAGAAACGGAGAGGATGGAGGG + Intronic
1070555768 10:77526857-77526879 GGAGATATGGAGAGGGAGGATGG - Intronic
1070815211 10:79318527-79318549 AAAGATATGGCCAGGGTGGATGG - Intergenic
1070838495 10:79467043-79467065 CAGGGGCTGGGGAGGGTGGAGGG + Intergenic
1071295768 10:84218124-84218146 CAAGGGATGGAGAGGGAGAATGG + Intronic
1071603897 10:86971707-86971729 AAAGACATGGAGCGGGTGGACGG - Intronic
1071997075 10:91160141-91160163 CAACAGATGGAAATGGAGGAAGG - Intergenic
1072291848 10:93971184-93971206 GAAAAGATTGAGAGGTTGGATGG + Intergenic
1072908221 10:99474978-99475000 CAAGAAAAGGAGAGGGAAGAGGG + Intergenic
1073056223 10:100704438-100704460 GAGGAGATGGAGAGGGCAGAGGG - Intergenic
1073393410 10:103198067-103198089 AAAGAGAGGGAGAGGAAGGAAGG + Intergenic
1073756101 10:106582341-106582363 GCAGAGATGGGGAGGGTGAATGG - Intronic
1073775829 10:106784999-106785021 CAAGGGATGAAGAATGTGGATGG - Intronic
1074104751 10:110380880-110380902 CAAGTGACGGAAAGGGTGTAGGG - Intergenic
1074539032 10:114349796-114349818 CAAGAAATGGCGAGGGGGGCGGG + Intronic
1074784666 10:116828422-116828444 AAGGAGATGGAGAGGTAGGAAGG - Intergenic
1074947097 10:118290837-118290859 CAAGAGATTGAGTAGGTGGAAGG + Intergenic
1075118850 10:119649882-119649904 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1075275443 10:121088971-121088993 ATTGAGATGCAGAGGGTGGATGG + Intergenic
1075300699 10:121321307-121321329 GAAGAGGTGGAGAAGGTGGAAGG + Intergenic
1075925877 10:126251672-126251694 GATGGGATGGAGAGGATGGATGG + Intronic
1076118020 10:127914132-127914154 CAAGAGAGAGAGTGGGTGGGGGG - Intronic
1076192562 10:128492968-128492990 AAAGAGATGAAAAAGGTGGAGGG + Intergenic
1076239924 10:128897083-128897105 CAAGAGAGGGAAAGAGTGGAAGG + Intergenic
1076281567 10:129250821-129250843 GAAGAGTTCAAGAGGGTGGAAGG - Intergenic
1076383926 10:130044022-130044044 AGAGAGAGGGAGAGGGAGGAAGG + Intergenic
1076435267 10:130436801-130436823 CAAGAGAGAGAGAGAGGGGAGGG - Intergenic
1076974786 11:164267-164289 CAGGTGATGGAGAGGGTGGGAGG + Intergenic
1077165874 11:1138047-1138069 GAAGAGATGGAGGAGGTGGAAGG + Intergenic
1077439054 11:2559842-2559864 CCAGAGACAGAGAGGGAGGAAGG - Intronic
1077449106 11:2624743-2624765 CAAGAGATGGCGGTGGTGGGGGG - Intronic
1077739990 11:4835168-4835190 GAAGAGAGAGAGAGGGGGGAGGG - Intronic
1078380724 11:10837711-10837733 CAAGAAAGGGGGAGGGGGGAAGG - Intronic
1078566723 11:12421127-12421149 CATGAGATGGACAAGGTGGTGGG + Intronic
1078836130 11:15031814-15031836 GAAGAGGTGGAGTAGGTGGAAGG - Intronic
1078994919 11:16687314-16687336 CAAGAGAGAGAGTGGGTGGAAGG + Intronic
1079132497 11:17755661-17755683 CATGAGATGGAGAGGCTGCAGGG + Intronic
1079515609 11:21264439-21264461 CAGGAGATGGGAAGGCTGGAGGG + Intronic
1080232393 11:30032560-30032582 GAAGAGGTGGAGGAGGTGGAAGG - Intergenic
1080320946 11:31008417-31008439 CAAGAGATGGAAAAGAGGGATGG + Intronic
1080790857 11:35521349-35521371 AATGAGAGGGAGAAGGTGGAAGG - Intronic
1080927327 11:36770970-36770992 CAAGAGAAGTAGAGGGTTCATGG - Intergenic
1080936725 11:36871270-36871292 GGAGAGATGGAGGGGGTGGGAGG + Intergenic
1081073449 11:38639565-38639587 AAAGAGATGGAGTGGCTGAATGG - Intergenic
1081279716 11:41193976-41193998 GAAGAGATGGAGGAGATGGAAGG - Intronic
1081509018 11:43749221-43749243 CAATAAATTGAGAGGGTGAAGGG + Intronic
1081963468 11:47155095-47155117 GGAGAGAGGGAGAGGGAGGAAGG - Intronic
1082099710 11:48162392-48162414 AAAGGGAGGGAGAGGGAGGAGGG - Intronic
1082255257 11:50027136-50027158 CTAGAGCTGGAGAGGCTGGGAGG - Intergenic
1082986561 11:59174384-59174406 CATCAGAAGGTGAGGGTGGAGGG + Intronic
1083060259 11:59862486-59862508 GAAGAGAAGGAAAGAGTGGAGGG + Intronic
1083593746 11:63909479-63909501 CAAAGGAAGGGGAGGGTGGATGG + Exonic
1083811818 11:65110639-65110661 CAAAAGAGGGCGAGGGTGCAGGG + Intronic
1083827584 11:65212090-65212112 AAGGAGATGGAGGGGTTGGAGGG - Intergenic
1084335648 11:68456085-68456107 CAAGAGGTGTTGAGGCTGGACGG - Intergenic
1084919555 11:72458124-72458146 AAAGTGAGGGAGAGGGAGGAAGG + Intergenic
1085508248 11:77072239-77072261 CAAGAGATGGAGGAGGTGGAAGG - Intronic
1085510697 11:77086704-77086726 CAGGGGATGGAGTGGGAGGAGGG - Intronic
1085837192 11:79969698-79969720 CAAATGAATGAGAGGGTGGAAGG + Intergenic
1085989478 11:81824422-81824444 CAAGAAATTTGGAGGGTGGAAGG - Intergenic
1086156415 11:83671683-83671705 CAAGAGAGGGAAAGGGAGTAGGG - Intronic
1086490657 11:87355122-87355144 CATGAGACGGGGAAGGTGGATGG - Intergenic
1086789175 11:91014137-91014159 CAAGAGGTGGTGAGGGTGTAAGG + Intergenic
1087903244 11:103666284-103666306 CAAGAGAGGCAGAGTGTGCAGGG - Intergenic
1088098592 11:106129407-106129429 GAGCAGTTGGAGAGGGTGGAGGG + Intergenic
1088457851 11:110050911-110050933 GGAGAGATAGAGAGGGAGGAGGG - Intergenic
1088900446 11:114112403-114112425 TGAGAGATGGAGAAGGTAGAGGG + Intronic
1089011188 11:115133113-115133135 TAAGGGATGGTGAGGGTGGTTGG - Intergenic
1089119055 11:116119032-116119054 GAAGAGAGGTAGAGGGTGCAGGG - Intergenic
1089145861 11:116329319-116329341 CAAGACATGGGTAGGGTGGCCGG + Intergenic
1089292727 11:117448065-117448087 CAAGACATGAAGAAGATGGAGGG + Intronic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1089519982 11:119057003-119057025 CAAGAGGTAGCGGGGGTGGATGG - Exonic
1089542785 11:119200379-119200401 CAGGAGAAGGAGGTGGTGGAGGG - Intergenic
1089547005 11:119235604-119235626 GAATAGGTGGAGGGGGTGGAAGG + Intronic
1090093370 11:123720123-123720145 CATAAGATGAAGAGAGTGGATGG - Intergenic
1090521375 11:127483098-127483120 CAAGAGAAGGAAAAGGTGGCTGG + Intergenic
1090667662 11:128925486-128925508 CATGAAAGGGAGAGGGTGGGAGG - Intergenic
1090703558 11:129316582-129316604 CAAGAGAGGGAGGAGGTGAAGGG - Intergenic
1090955934 11:131512851-131512873 CAAGACAGGGAGAGGGTGGGGGG - Intronic
1091029177 11:132169041-132169063 CAAAAGAAGGAGGGGGTGGATGG - Intronic
1091229878 11:133981377-133981399 CAGGAGAGGGAGAGGCAGGAAGG + Intergenic
1091776720 12:3189469-3189491 CTACAGAGGGAGAGGGTGCAGGG + Intronic
1091869971 12:3881290-3881312 CAGGAGAGGGTGAGGGAGGAAGG + Intergenic
1091909109 12:4214523-4214545 AAAGAAATGGAGAGGGAGCAGGG + Intergenic
1091918648 12:4287154-4287176 CAAGAGGTGGAGATGGTGAGAGG + Intronic
1092053911 12:5493256-5493278 CAACAGAATGAGAGCGTGGATGG + Intronic
1092213626 12:6664969-6664991 CAAGAGTTGGTGAGAGTGGGAGG + Intergenic
1092465688 12:8729528-8729550 CACAAGATGGAGAGTGGGGAGGG + Intronic
1092968250 12:13666358-13666380 GAAGAGAGAGGGAGGGTGGAAGG + Intronic
1093744227 12:22721555-22721577 GAAGAGATGGAGAAGCAGGAGGG + Intergenic
1094047113 12:26179276-26179298 CAGGAGAAGGTGAGGGCGGAGGG + Intronic
1094272597 12:28633526-28633548 GAAGAGATGGAGGAGGTAGAAGG + Intergenic
1094528650 12:31251071-31251093 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1094655499 12:32416000-32416022 AAAGACATGGAGAGGCTGAATGG - Intronic
1095937085 12:47696551-47696573 GAAGAGGTGGAAAAGGTGGAAGG - Intronic
1095986036 12:48000438-48000460 CAGGTGATGGAGTGGGTGGAGGG + Intronic
1096016365 12:48279516-48279538 AAAGAGAGGCAGAGGGAGGATGG - Intergenic
1096039581 12:48501481-48501503 CATGAGAGGGAGACCGTGGAAGG + Intergenic
1096078635 12:48819503-48819525 GCAGAGATGGAGGGGGTGGAAGG - Intronic
1096454000 12:51770367-51770389 TCAGAAATGGAGAGGGTGGCAGG - Intronic
1096721476 12:53526259-53526281 GAAGAGGTGGAGAAGTTGGAAGG - Intronic
1096743287 12:53709990-53710012 CAAGAGAGGGAGAGGGAGAGGGG + Intronic
1097313633 12:58149199-58149221 CAAGAAAGAGAGAGGGAGGAAGG - Intergenic
1097369172 12:58755402-58755424 AGAGAGATGGAGAGGGAGAAAGG + Intronic
1097452943 12:59757674-59757696 GAAGAGGTGGAGGAGGTGGAAGG - Intronic
1098008993 12:66030598-66030620 GAAGAGATGGAGAGGAAGGAAGG - Intergenic
1098075993 12:66732148-66732170 GAAGAGGTAGAGAAGGTGGAAGG - Intronic
1098141062 12:67450670-67450692 CAAGAGAGAGAGAGGGTGCGGGG - Intergenic
1098146691 12:67504608-67504630 CAAGAGACAGAGAGAGTGGCAGG - Intergenic
1098213054 12:68186342-68186364 AAAGTGAAGGAGAGGGTGGAGGG + Intergenic
1098287253 12:68920065-68920087 CAAGAGAAAGAGGGGGTGGGAGG - Intronic
1098299874 12:69043192-69043214 CAGCAGGTGGAGAGGGTGGGAGG + Intergenic
1098521008 12:71435628-71435650 CAGGAGAGAGAGAGGGTGAATGG + Intronic
1098596713 12:72280624-72280646 TGGGAGATGGAGAGGGTTGAGGG + Intronic
1098986063 12:77013673-77013695 GAAGAAGTGGAGAAGGTGGAAGG - Intergenic
1099786416 12:87269665-87269687 CAAGAGAGGGAGAGAGTGTGAGG + Intergenic
1100737045 12:97546950-97546972 CAGGAGCTGGAGAGGGTGAGAGG - Intergenic
1100874291 12:98945976-98945998 AAGGGGATGGAGAAGGTGGATGG - Intronic
1101241983 12:102848176-102848198 CAAGAGATGGTAGGGGTTGAGGG + Intronic
1101272389 12:103161417-103161439 CAAGAGAGGGAGATGGTAGGTGG - Intronic
1101279484 12:103237802-103237824 CAAGAGAGCTAAAGGGTGGAAGG + Intronic
1101289340 12:103351935-103351957 AAAGAGAGGAAGAGGGTGGAGGG - Intronic
1101621725 12:106395401-106395423 CAAGAGAGCGTGAGGGAGGAGGG + Intronic
1101691886 12:107090523-107090545 CAAGAGATGCAAATGGTGCAAGG - Intronic
1101729203 12:107412790-107412812 CACTAGATGGGTAGGGTGGAGGG - Intronic
1101802014 12:108030699-108030721 CAAGAGATGGAGATGGGACAGGG + Intergenic
1102558048 12:113741919-113741941 AAAGAGATGGAGAGAGAGAAGGG + Intergenic
1102598734 12:114012856-114012878 GGAGAGAGGGAGAGGGAGGAGGG + Intergenic
1102673241 12:114637757-114637779 CAAGAGAAAGAGAGGAAGGAAGG + Intergenic
1102749535 12:115280399-115280421 AGAGAGATTGAGAGTGTGGAAGG + Intergenic
1102908790 12:116696929-116696951 CAAGAAATGTAGGGGCTGGAAGG + Intergenic
1103136174 12:118509811-118509833 CAAGAGCTGGTGGGGGAGGAAGG - Intergenic
1103507417 12:121451114-121451136 GAAGAGATGGAGGAGGTAGAAGG - Intronic
1103516079 12:121509352-121509374 TAAGAGCTGCAGAGGGTGGGTGG - Intronic
1103701236 12:122849722-122849744 CTAGAGACAGAGAGGGTGGTTGG + Intronic
1104069567 12:125332494-125332516 GAAGAAATGCAGTGGGTGGAGGG - Intronic
1104461725 12:128962025-128962047 CAAGTGCTGGGAAGGGTGGAGGG - Intronic
1104664577 12:130638652-130638674 CAACAGATGGGGAGGGGGAAAGG - Intronic
1105635820 13:22214412-22214434 CTAGAGAGGGAGAGGCTGGAGGG - Intergenic
1105644890 13:22306531-22306553 CAACAGATGTAGAGGGAAGATGG - Intergenic
1105985401 13:25561278-25561300 CAAGAGATGCAGAGGGAACAGGG - Intronic
1106220009 13:27738629-27738651 AAAGAGGTGGAGGAGGTGGAAGG - Intergenic
1106658332 13:31771479-31771501 CTATGGATGGAGAGGGGGGATGG - Intronic
1107112372 13:36711874-36711896 CAAGAGAAGGAGAAGGTTGCGGG - Intergenic
1107135934 13:36944127-36944149 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1107497874 13:40946599-40946621 GAAGAGATGGAGGAAGTGGAAGG - Intronic
1107562514 13:41571306-41571328 CGGGAGAGGGAGAGGGAGGAGGG - Intronic
1107702455 13:43061643-43061665 CAAGAGAGGGAGAGTGTGGTGGG + Intronic
1108070460 13:46623852-46623874 ACAGAGATGGGGAGGGGGGAGGG - Intronic
1108083130 13:46757766-46757788 GAAGAGAGGGACAGGGAGGAAGG + Intergenic
1108128968 13:47276557-47276579 CAAGGCATGGAGAAGGAGGAAGG + Intergenic
1108253993 13:48593400-48593422 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1108447287 13:50522177-50522199 AAAGAGAGGGAGAGAGGGGAGGG + Intronic
1108588309 13:51890394-51890416 CAAGAGAGGGAGAAAGGGGAGGG - Intergenic
1108711354 13:53035602-53035624 AAAGAGATGGAGGGTGAGGATGG - Intronic
1108771111 13:53700974-53700996 CAGGAGATGGAGAGAGTGCAGGG - Intergenic
1108823152 13:54378522-54378544 CAAGAGAGGAAGAGGATAGAGGG - Intergenic
1108870924 13:54984972-54984994 AAAGAGATGGAGAGACTTGATGG + Intergenic
1109716166 13:66225359-66225381 CAAGGCAGAGAGAGGGTGGAGGG - Intergenic
1110158894 13:72352140-72352162 GCAGAGATGATGAGGGTGGATGG + Intergenic
1110637552 13:77783395-77783417 GAGGAGAAGGAGAGGGAGGAGGG + Intergenic
1111743022 13:92228140-92228162 TAAGAGATGGAGAAGATGGAAGG + Intronic
1111899105 13:94179327-94179349 TTTGAGATAGAGAGGGTGGATGG + Intronic
1112020773 13:95369380-95369402 CAGGAGAGGGAGAGTGTGCAGGG + Intergenic
1112184313 13:97113420-97113442 AAAGAGAGAGAGAGGGAGGAAGG - Intergenic
1112782156 13:102912903-102912925 AAGGAGGTAGAGAGGGTGGAAGG - Intergenic
1112839121 13:103553677-103553699 GAAGAGATGGAGGAGGTAGAAGG - Intergenic
1114260407 14:21032509-21032531 CAACAGATGAGGAAGGTGGAGGG - Intronic
1114322030 14:21555034-21555056 CAAGAGATGAAGAGTGAGGCTGG + Intergenic
1115253475 14:31373786-31373808 GAAGAGGTGGAGCAGGTGGAAGG - Intronic
1115465069 14:33706262-33706284 CAAGTGGTGGAGAGGGAGGATGG + Intronic
1116840949 14:49820641-49820663 CATGAGAGGGAGACCGTGGAAGG - Intronic
1117432582 14:55683326-55683348 AAAGAGATGAAGCAGGTGGAGGG - Intronic
1117450061 14:55841407-55841429 TAAGAGAGGGAGAGGGAAGAGGG - Intergenic
1117846863 14:59920480-59920502 CAAGAGAAGGAAAGGGAGGGTGG + Intronic
1118245287 14:64104350-64104372 CAAGAAAAGGAGATGGAGGAGGG - Intronic
1118366446 14:65101696-65101718 CAAGGGGTGGGGAGGGAGGAAGG - Intronic
1118470953 14:66074944-66074966 GAAGGGATGGGGAGGGAGGAAGG - Intergenic
1119113140 14:71994531-71994553 CAACATATGGACTGGGTGGAGGG - Intronic
1119117920 14:72044491-72044513 AAGGAGAGGGAGAGGGAGGAAGG - Intronic
1119709215 14:76809277-76809299 CTGGAGGTGGAGGGGGTGGAGGG - Exonic
1119712787 14:76835006-76835028 CAAGAGAAGTAGCAGGTGGAAGG - Intronic
1119957055 14:78809710-78809732 CAACCTAAGGAGAGGGTGGAGGG + Intronic
1119961395 14:78860848-78860870 GAAGATATGGAGGAGGTGGAAGG + Intronic
1120100413 14:80438505-80438527 CAAGAGAGAGAGAGAGTGGGTGG - Intergenic
1121432867 14:93899860-93899882 CTAGGGAGGGAGAGGGAGGAGGG + Intergenic
1121962042 14:98269898-98269920 TAAGCTATGGAGAGGGTAGAAGG + Intergenic
1122151522 14:99728552-99728574 CTGGAAATGGAGAGGGTGGAGGG - Intergenic
1122363917 14:101183267-101183289 CCAGAGATGCAGAGGAGGGAGGG - Intergenic
1122625187 14:103081769-103081791 AAAGAGATGGTGATGGTAGATGG + Intergenic
1123464510 15:20505651-20505673 GAAGAGATGGAGAGAGAGGGAGG + Intergenic
1123653603 15:22495390-22495412 GAAGAGATGGAGAGAGAGGGAGG - Intergenic
1124334895 15:28849358-28849380 GAAAAGATTGAGAGGTTGGATGG - Intergenic
1124879511 15:33628299-33628321 CAAGAAAGGAAGAGGGAGGAGGG + Intronic
1125202015 15:37108346-37108368 CCAGAGATGGGGTGGGTGTAGGG - Intergenic
1125278413 15:38017937-38017959 CAAGAGAGAGAGAGAGTGAAGGG - Intergenic
1125510161 15:40288464-40288486 CTAGAGATGGAGGGGGAGGTAGG + Exonic
1125594566 15:40876070-40876092 GCAGAGGTGGAGAAGGTGGAAGG + Intergenic
1125979112 15:43983778-43983800 CCAGAGGTGGAGACGGTGGATGG - Intronic
1126814902 15:52445256-52445278 CAAGAGACAGAGAAGGTGGGCGG - Intronic
1127399624 15:58573078-58573100 GAAGGGATTGAGAGGGAGGAGGG - Intergenic
1127732045 15:61810726-61810748 CAAGGGATGGTGAGAGTGGTGGG - Intergenic
1128810250 15:70566196-70566218 CAATAAATGGAAAGGGAGGAAGG - Intergenic
1128954122 15:71921463-71921485 CGGGAGAAGGAGTGGGTGGAAGG - Intronic
1129704193 15:77785240-77785262 CAAGAGAGGGAGATGTGGGAGGG - Intronic
1129714798 15:77840818-77840840 GAAGAGATGGATAGAGGGGATGG - Intergenic
1129911476 15:79230954-79230976 CAAGAGAGAGAGAGAGGGGAGGG + Intergenic
1130084024 15:80762224-80762246 CTAGAGATGGAGAGTGGTGATGG - Intergenic
1130571321 15:85046704-85046726 CAAGGGATAGGGAGGGTAGAGGG + Intronic
1130894380 15:88158969-88158991 CAAGGGATAGAGAGGGAGAAGGG + Intronic
1131081387 15:89539185-89539207 AAAGAGAAGGAGAGGAAGGAAGG + Intergenic
1131867807 15:96730710-96730732 CCAGAGAAGCAGAGGGTAGAGGG + Intergenic
1132425298 15:101710811-101710833 CAAGAGAAGGAGAGGGGGGTGGG + Intronic
1132608625 16:803981-804003 CAAGGGATGGGGTGGGGGGAGGG + Intergenic
1132646738 16:1002690-1002712 CAAGAGCTGGACTGGGGGGACGG + Intergenic
1132661766 16:1064741-1064763 CAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1133392585 16:5422179-5422201 AGAGAGAGGGAGAGGGAGGAAGG + Intergenic
1133820528 16:9232287-9232309 AAAGGGAGGGAGAGGGAGGAGGG - Intergenic
1134872780 16:17666871-17666893 CAACAGAAGGAGAGGGGGAAAGG - Intergenic
1135194509 16:20383438-20383460 GAAGAGATGGGGAGGGAGGGCGG - Intronic
1135424440 16:22325349-22325371 CCGGACCTGGAGAGGGTGGAGGG + Intronic
1135694693 16:24575754-24575776 AAAGAGAGGGAGAGGGAGGAGGG + Intergenic
1135694706 16:24575793-24575815 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135694758 16:24575915-24575937 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135754325 16:25083799-25083821 CAGGAGAGGAAGAGGGGGGAAGG - Intergenic
1135920307 16:26643460-26643482 AAAGAGCAGCAGAGGGTGGAGGG - Intergenic
1135939558 16:26809613-26809635 AAAGAGAGGGGGAGGGAGGAAGG + Intergenic
1136139038 16:28276998-28277020 CAAGCGATGAAGAGGATAGAAGG + Intergenic
1136369200 16:29825497-29825519 CCATAGATGGCGAGGGTAGAAGG + Intronic
1136381561 16:29898448-29898470 CCAGAGAGAGAGAGGGTGGGGGG - Intronic
1136510834 16:30737464-30737486 CAAGATATGGACAGGGAGAATGG - Exonic
1136532114 16:30876697-30876719 AGAGAGAAGGGGAGGGTGGAGGG + Intronic
1136922799 16:34345888-34345910 CCAGAGCTGGGGAGGGAGGATGG - Intergenic
1136981774 16:35065918-35065940 CCAGAGCTGGGGAGGGAGGATGG + Intergenic
1137445749 16:48531116-48531138 GCAGAGATGGAGAGGGTGTCTGG + Intergenic
1137470861 16:48756861-48756883 GAAGAGGTGGAGAGGGGTGAGGG + Intergenic
1137655489 16:50154450-50154472 CAGGAGACGGAGGGTGTGGACGG - Intronic
1137710360 16:50562740-50562762 CAGGAGTTGGAGAGGGATGAGGG + Intronic
1137755608 16:50899712-50899734 CAAGACCTGGAGAAGGTGGGAGG - Intergenic
1137840625 16:51637474-51637496 CAAGAGAGGGAGAAGAAGGAGGG + Intergenic
1138166007 16:54802339-54802361 CAGTAGATGGAGGGTGTGGATGG + Intergenic
1138452995 16:57104921-57104943 CAAGCGAGGGGGAGGGTGGCAGG + Intronic
1138699493 16:58847020-58847042 CATGAGAGGGAGACCGTGGAGGG + Intergenic
1138758082 16:59513050-59513072 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1138923610 16:61564066-61564088 CAAGAGATTAAGAAGGAGGAAGG - Intergenic
1138927759 16:61612501-61612523 CAAGAGAGGGAAAGGGTGACTGG - Intergenic
1139446923 16:67003743-67003765 CAAGGAATGGAGAGGGTAAAGGG + Intronic
1139459641 16:67111282-67111304 CTGGAAATGGAGAGGGTGAAGGG - Intronic
1140697762 16:77551817-77551839 GAAGAGAGGGAGAGGGTGGGAGG + Intergenic
1140724440 16:77799333-77799355 AAAGAGATGGAGAAAGTGGGAGG - Intronic
1141910419 16:87054797-87054819 AAACGGATGCAGAGGGTGGAGGG + Intergenic
1141988065 16:87592948-87592970 GAAGAGAGGGAGAGGAAGGAAGG - Intergenic
1142160083 16:88552829-88552851 CAGGAGCTGGAGAGGCAGGAAGG + Intergenic
1142254319 16:89006684-89006706 GAAGAGATGGAGAGGGAGGGAGG - Intergenic
1142254393 16:89006865-89006887 GAAGAGATGGAGGGGGAGGGAGG - Intergenic
1142445477 16:90133390-90133412 CAGGTGATGGAGAGGGTGGGAGG - Intergenic
1142462035 17:102080-102102 CAGGTGATGGAGAGGGTGGGAGG + Intergenic
1142495359 17:303535-303557 AAAGAGATGGGGAGGGAGGGAGG + Intronic
1142495370 17:303604-303626 AAAGAGATGGGGAGGGAGGGAGG + Intronic
1142495381 17:303673-303695 AAAGAGATGGGGAGGGAGGGAGG + Intronic
1142495404 17:303811-303833 AAAGAGATGGGGAGGGAGGGAGG + Intronic
1142495415 17:303880-303902 AAAGAGATGGGGAGGGAGGGAGG + Intronic
1142495426 17:303949-303971 AAAGAGATGGGGAGGGAGGGAGG + Intronic
1142495437 17:304018-304040 AAAGAGATGGGGAGGGAGGGAGG + Intronic
1142495448 17:304087-304109 AAAGAGATGGGGAGGGAGGGAGG + Intronic
1143246300 17:5488307-5488329 GAACAGAAAGAGAGGGTGGAGGG + Exonic
1143377253 17:6474096-6474118 CAGGAGAAGGAGAGGGTGGGAGG + Intronic
1143481201 17:7228169-7228191 CTAGAGAAGGTGAGGGTGGAAGG + Intronic
1143592796 17:7895585-7895607 TAAGAGAGGGAGAGGATGGCAGG - Intronic
1143594808 17:7907695-7907717 CAAGAGAGGTAATGGGTGGAAGG + Exonic
1143595547 17:7911665-7911687 CAAGGGGTGGGGAAGGTGGAGGG - Exonic
1143711225 17:8736567-8736589 CACGAGATGGAGAAGGTGCTCGG - Intronic
1143963116 17:10736995-10737017 CATGAACTGGAGAGGGTGGAAGG + Intergenic
1144044135 17:11439716-11439738 AAAGGGAAGAAGAGGGTGGAAGG - Intronic
1144288469 17:13802711-13802733 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1144436774 17:15249531-15249553 CAAAAACTAGAGAGGGTGGAAGG + Intronic
1144772936 17:17769858-17769880 GAAGAGATGGGTCGGGTGGAGGG + Intronic
1144837814 17:18166411-18166433 TCAGAGATGGAGCAGGTGGACGG + Exonic
1146188948 17:30748073-30748095 CAAGAGCTGGAAAGGATGTAAGG - Intergenic
1146333837 17:31952392-31952414 CAAGAGCTGGAAAGGATGTAAGG - Intronic
1146526328 17:33570010-33570032 CAAGAGGTGGAGAGGAGTGATGG - Intronic
1146935923 17:36812762-36812784 GAAGAGATGGGGTGGCTGGAAGG + Intergenic
1147042789 17:37731177-37731199 CCAGAGATGGAGGAGGTGGCCGG + Intronic
1147126739 17:38375279-38375301 GAAGAGGTAGAGAAGGTGGAAGG - Intronic
1147218943 17:38917012-38917034 CTAGAGTGGGAGAGGGTGGGAGG + Intronic
1147245586 17:39118131-39118153 GAAGAGATTGAGAGGAAGGAAGG - Intronic
1147744563 17:42687376-42687398 CCAGAGTCGGAGAGGGTTGAGGG - Intronic
1147871781 17:43592594-43592616 CTAGAGATGGGGAGAGTGGCTGG - Intergenic
1147951121 17:44108613-44108635 CAAGAGATGGGGAGAGGGGGTGG + Intronic
1148130303 17:45258163-45258185 CTAGAGATGTAGTGGCTGGAGGG + Intronic
1148448731 17:47759163-47759185 GAAGAGTTGGAGGAGGTGGAAGG + Intergenic
1148580189 17:48738344-48738366 CAGGTTATTGAGAGGGTGGAGGG - Intergenic
1148619335 17:49022601-49022623 CAGGAGAGGGAGGGGGAGGAGGG - Intronic
1149638621 17:58189455-58189477 CCAGAGCTGGAGAGGGTGGGTGG + Intergenic
1149786674 17:59441297-59441319 CAGGAGATGGAGTGGGTGGAAGG + Intergenic
1149926358 17:60705958-60705980 GAGGAGATGGAGGAGGTGGAAGG - Intronic
1150000694 17:61437134-61437156 AAGGAGAGGGAGAGGGAGGAAGG - Intergenic
1150078309 17:62213262-62213284 AAAGAGAGAGAGAGGGAGGAAGG - Intergenic
1150152244 17:62819590-62819612 GAAGAGAAGGAGAGGAAGGATGG - Intergenic
1151116592 17:71742554-71742576 CTAGAAAGGGAGAGGGTGGGAGG + Intergenic
1151797038 17:76353437-76353459 CAGGAGGTGGGGCGGGTGGAGGG + Intronic
1151912049 17:77089941-77089963 CAGGAGGTGGAGAGGTTGCAGGG + Intronic
1151968881 17:77447057-77447079 CAAGGGCTGGAGAGGGCGAATGG - Intronic
1151979940 17:77502795-77502817 CAGGACTTGGAGAGGGTGGTCGG - Intergenic
1152033765 17:77859268-77859290 GAAGAGAGGGAGAGGGAGGCAGG + Intergenic
1152074539 17:78150747-78150769 CATTAGATGTAGAGGATGGAGGG + Intronic
1152214926 17:79026613-79026635 CAAGAGGAGGAGAGGGAGGCGGG - Intronic
1152275692 17:79355470-79355492 CAGGACCTGGAGAGGCTGGAGGG - Intronic
1152337063 17:79704792-79704814 CAAGAGGGCGAGAGGGAGGAGGG + Intergenic
1152592891 17:81222475-81222497 AGGGAGGTGGAGAGGGTGGAGGG + Intronic
1153533941 18:6080066-6080088 TAAGAGAAGGAGAGGGTGCTTGG - Intronic
1153987778 18:10368551-10368573 GAGGAGAGGGAGAGGGAGGAAGG + Intergenic
1154494193 18:14944012-14944034 CAAGACAAGGAGAGGGAGGGAGG + Intergenic
1155168854 18:23252202-23252224 CAGGAGCTGGAGGGAGTGGATGG + Intronic
1155225514 18:23726122-23726144 AAAGAGATGGGGAGGGTGAGTGG + Intronic
1155524492 18:26702710-26702732 AAAGAGAGAGAGAGGGAGGAAGG - Intergenic
1155928678 18:31684655-31684677 CAAGAGGTGGAGGGGGGAGAGGG + Exonic
1156351542 18:36306223-36306245 CAAGTGGTGGAGAGTGTGGAGGG + Intronic
1157219770 18:45820099-45820121 CATGTGATGGATAGGGTAGAGGG + Intergenic
1157293704 18:46427144-46427166 CTGGGGATGGAGATGGTGGAGGG + Intronic
1157393908 18:47326053-47326075 AGAGAGATGGAGAGGGAGCAGGG + Intergenic
1157794423 18:50560677-50560699 CGAGAAAGGGAGAGGCTGGAGGG - Intronic
1158135295 18:54201345-54201367 GAAGAGATGGAGGTGGTGGTTGG + Intronic
1158536888 18:58316259-58316281 AAAGAGAGGGAGCTGGTGGATGG - Intronic
1159021320 18:63145383-63145405 CAAGAGATCCAGGGGGTGGGGGG + Intronic
1159096301 18:63906274-63906296 CAAGAGAGAGAGAGGGTTGGGGG - Intronic
1159507346 18:69354510-69354532 AAAGAGCTGGAGAGGGGGAAGGG + Intergenic
1159634665 18:70790091-70790113 CATGAGAGGGAGCTGGTGGAAGG - Intergenic
1159651846 18:70987099-70987121 CAAGGGAGGGAGCTGGTGGAAGG + Intergenic
1159732850 18:72053322-72053344 CAAGGGAGGGTGAGGGTGGTGGG + Intergenic
1159945129 18:74438988-74439010 CCAGGAATGTAGAGGGTGGAAGG - Intronic
1160029345 18:75244957-75244979 CAAGAGAGAGAGATGGGGGAAGG - Intronic
1160372272 18:78383709-78383731 CAGGAGTTGGAGAGGCTGCAAGG - Intergenic
1160486628 18:79299298-79299320 GAAGGGCTGGAGAGGGAGGAGGG - Intronic
1160625670 18:80202941-80202963 CAAGAGACGGGGTGGGGGGAGGG + Intronic
1160651738 19:234448-234470 CAGGTGATGGAGAGGGTGGGAGG + Intergenic
1161100545 19:2419043-2419065 GAAGGGAAGGAGAGGGTGGGAGG - Intronic
1161197554 19:2995370-2995392 CAGGAGTTGGAGAGGCTGCAGGG - Intergenic
1161319291 19:3633576-3633598 CAAGAGAGGCAGAGGGAGGAAGG + Intronic
1161636216 19:5390892-5390914 GGGGAGATGGAGAGGGGGGAGGG - Intergenic
1161684837 19:5697583-5697605 GAAGAGAGGGAGAGAGAGGAGGG + Intronic
1161895034 19:7073886-7073908 ACAGAGCTGTAGAGGGTGGACGG - Intronic
1162180755 19:8867237-8867259 CAAGAGGATGAGTGGGTGGATGG + Intronic
1162308025 19:9887472-9887494 TAAGAGAAAGAGAGGGTGGGCGG - Intronic
1162578477 19:11513307-11513329 TCAGAGATGGAGGGGGAGGAGGG + Intronic
1162861301 19:13507316-13507338 CTAGAGAAGGAGGAGGTGGAGGG - Intronic
1163164014 19:15483042-15483064 GAAGAGGTGGAGGAGGTGGAAGG - Intronic
1163373566 19:16915996-16916018 CAAGAGAGAGAGAGAGAGGAAGG - Intronic
1163715600 19:18870482-18870504 GCAGAGTTGGAGGGGGTGGAGGG + Exonic
1164402634 19:27912129-27912151 CTAGAGATGGGGAGGCAGGAAGG + Intergenic
1164507844 19:28874175-28874197 GAAGAGATGGAGGGGATGGCAGG + Intergenic
1164542063 19:29128670-29128692 AAAGACATGGAGGGGGAGGATGG + Intergenic
1164654357 19:29910054-29910076 CAGGAGAGGGAGAGGAGGGAGGG - Intergenic
1164654382 19:29910134-29910156 CAGGAGAGGGAGAGGAGGGAGGG - Intergenic
1164654428 19:29910274-29910296 CAGGAGAGGGAGAGGAGGGAGGG - Intergenic
1165147253 19:33738931-33738953 CTAGAGAGGGAGATGGTGGGTGG + Intronic
1165429984 19:35767023-35767045 ACAGAGAGAGAGAGGGTGGAGGG - Intronic
1165433630 19:35785383-35785405 CAGGAGAGGGAGAGGTAGGAGGG - Intronic
1165436417 19:35797676-35797698 GAAGAGAAGGACAGGGTGGGAGG + Intergenic
1165611853 19:37161591-37161613 GAAGAGGAGGAGAAGGTGGAAGG - Intronic
1165903405 19:39179148-39179170 CAGGGGCTGGAGAGGGTGGGGGG - Exonic
1166106524 19:40600591-40600613 CAAGAGCTGGAGCGGGAGGAGGG - Intronic
1166123620 19:40700562-40700584 CAAGAGATGGGCAGGAGGGAGGG - Intronic
1166301691 19:41914914-41914936 ACAGAGACGGAGATGGTGGAGGG - Intronic
1166548572 19:43649632-43649654 AAAGAGAGAGAGAGGGAGGAAGG + Intronic
1167163128 19:47780442-47780464 CAAGAGACAGAGAAGGGGGAGGG - Intronic
1167353664 19:48991220-48991242 CCACAGACGGAGAGGGTGCAGGG - Intronic
1168061123 19:53892834-53892856 AAAGAGAGGGAGAGGGAGAAAGG - Intronic
1168307828 19:55445087-55445109 AAAGGGATGGAGGGGGTGGATGG + Intergenic
1168308489 19:55449600-55449622 CCAGCAATGGAGAGTGTGGAAGG + Intergenic
1168464942 19:56594844-56594866 GAAGAGATGGAGAAGGAGGAGGG - Intergenic
925644709 2:6023940-6023962 CACCAGAGGGAGAAGGTGGAAGG + Intergenic
925651437 2:6093738-6093760 GAAGAGATGGAGGAGGTGAAAGG + Intergenic
925837504 2:7960227-7960249 CAAGGGATGGGGATGGTCGAGGG - Intergenic
926068042 2:9860035-9860057 CAAGAGAGAGAGAGTGTGCAGGG + Intronic
926096930 2:10087448-10087470 CAAGAGAAGGAGAATTTGGATGG - Intergenic
926548015 2:14266196-14266218 CAAGAAAGGGAGCAGGTGGACGG + Intergenic
926638093 2:15205774-15205796 CAGGAGAGAGAGGGGGTGGAAGG - Intronic
926697346 2:15780107-15780129 TGAGAGTTGGTGAGGGTGGAGGG + Intergenic
926920730 2:17937390-17937412 GAAGGGATGGAGAGTGGGGAAGG - Intronic
926989851 2:18666745-18666767 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
927352491 2:22133754-22133776 CAAATGATAGAGAGGGAGGAGGG - Intergenic
927461840 2:23306073-23306095 GGAGAGATGGAGAAGATGGAAGG + Intergenic
927532273 2:23818200-23818222 GAAGAGAGGGAGAGGGAGGGAGG + Intronic
927747501 2:25634630-25634652 GAAAAGATTGAGAGGTTGGATGG + Intronic
927803561 2:26123904-26123926 GAAGAGGTAGAGAAGGTGGAAGG - Intronic
928358076 2:30638901-30638923 CAAGAAATGGAGAGGACGTAGGG - Intronic
928850635 2:35741087-35741109 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
930000962 2:46861228-46861250 ACAGAGATGGAGAGGGAGAAGGG - Intergenic
930423814 2:51187982-51188004 TAGGAAATGGAGAGGGTGGAAGG - Intergenic
931023804 2:58084375-58084397 AGAGAGGTGGAGAGGGTGGGAGG - Intronic
931244287 2:60479607-60479629 CAGGCGGTGGAGAGTGTGGACGG + Intronic
932738981 2:74277211-74277233 CCAGAGATGGAGATGCTGGGTGG + Intronic
933435784 2:82247952-82247974 TGAGAGATGGAGAGAGTGAAGGG + Intergenic
933990244 2:87628651-87628673 CAAGGGAGACAGAGGGTGGAGGG + Intergenic
934077973 2:88443801-88443823 CGGGGGATGGAGAGGGTGGTGGG + Intergenic
934095981 2:88604397-88604419 CAAGAGATGGATAGAGAGGAGGG - Intronic
935063267 2:99626468-99626490 GAAGAGAAGGAGAGGGAGGGAGG - Intronic
935131311 2:100263148-100263170 GAAGAGAAGGAGAGGATGGAAGG - Intergenic
935354265 2:102183938-102183960 GAAGTGATGGAGAGGGTGTTGGG - Intergenic
935358447 2:102226659-102226681 AAAGAGAGAGAGAGGGAGGAAGG + Intronic
935803394 2:106722675-106722697 GAAGAGATGGAGGAGATGGAAGG + Intergenic
935874785 2:107494713-107494735 GAAGAGAGGGAGTGGGTAGATGG + Intergenic
936052149 2:109232608-109232630 GAAGGGATGGACAGGGTAGAAGG - Intronic
936303602 2:111322173-111322195 CAAGGGAGACAGAGGGTGGAGGG - Intergenic
937264464 2:120607225-120607247 CAAGAGATGGAGGGCGTGGCAGG + Intergenic
937683565 2:124670172-124670194 AAAGAGAAAGAGAGGGAGGAAGG - Intronic
937854008 2:126659862-126659884 CAGGAGGTGGAGGAGGTGGAGGG - Intronic
937903170 2:127038145-127038167 CATGAGGAGGAGAGTGTGGAGGG - Intergenic
937947318 2:127352703-127352725 AAAGAGAGGGAGAGGGAGGGAGG - Intronic
938707844 2:133948978-133949000 CAAGAGTGGGAGATGGTGCAAGG - Intergenic
939437497 2:142197537-142197559 CAATTGATTGAGAGGGTGCATGG + Intergenic
939659308 2:144868587-144868609 GAAGAGAGGGAGTGAGTGGAGGG - Intergenic
940520105 2:154734702-154734724 GAGGAGATGGAGAGAGTGAAAGG + Intronic
940829710 2:158454242-158454264 CAATAGATAGAGATGGTGGTAGG + Intronic
941087396 2:161133843-161133865 AAAGAGAAGGAGAAGGTGAAAGG - Intergenic
941092207 2:161190783-161190805 CCAGAGGTTGAGAGGGAGGAAGG + Intronic
941475042 2:165940654-165940676 AAAGAGATGGGGAGTGTTGAGGG - Intronic
941489699 2:166127613-166127635 GAAGAGGAGGAGAGGGAGGAGGG + Intronic
941754613 2:169171639-169171661 CCAGAGAAGTAGAGGGAGGAAGG - Intronic
942305005 2:174598776-174598798 ATAGAGATAAAGAGGGTGGAAGG + Intronic
942526635 2:176860182-176860204 CAAGAGGTTGAGAGTGGGGAAGG + Intergenic
942968347 2:181925408-181925430 CATGCTATGGAGAGGTTGGAAGG - Intronic
943237517 2:185341130-185341152 CAAGAGAGGGATCTGGTGGAAGG - Intergenic
943840352 2:192573116-192573138 AAAGAGATGGAGAGATTGAAAGG + Intergenic
944663957 2:201943905-201943927 GCAGAGATGGAGGAGGTGGAAGG + Intergenic
945119429 2:206443247-206443269 CAAAAGATGGGGGCGGTGGAGGG - Intergenic
945177252 2:207055121-207055143 CAAGAGGGGGAGAGGGAGCATGG - Intergenic
946368709 2:219267018-219267040 CAGCAGATGGGCAGGGTGGAGGG - Intronic
946373431 2:219294489-219294511 GAAGAGACGGAGAGGGATGAAGG + Intronic
946524676 2:220505546-220505568 CAAGAGAGGGAGAGAGAGGCAGG + Intergenic
947537309 2:230948299-230948321 CAGGAGATGGGGAGGGAGGAAGG - Intronic
947747395 2:232515800-232515822 CAAGAGAGGCGGAGGCTGGAGGG - Intergenic
947762593 2:232614321-232614343 TAAGAGATGGAGGAGGTGGGAGG - Intronic
948279921 2:236739129-236739151 TAAGTGATGGATAGGATGGATGG + Intergenic
948474649 2:238209368-238209390 GAAGAGATATAGAGGGTTGAAGG + Intergenic
948553605 2:238792268-238792290 TGAGAGAGGGAGAGGGAGGAAGG - Intergenic
948593285 2:239064491-239064513 CAACAGAAGGGGAGGGAGGAAGG + Intronic
948899051 2:240946900-240946922 CATGAGGTGGAGAGTGTGGGCGG + Intronic
1168826785 20:819398-819420 AAAGAGACAGAGAGGGAGGAAGG - Intergenic
1169210950 20:3766093-3766115 GAAGAGGTAGGGAGGGTGGAAGG - Intronic
1169492969 20:6086732-6086754 CAGGAGAGGGAGAGAGTGAAGGG - Intronic
1170900573 20:20458625-20458647 AAAGAGAAGGAGAGGGAGCAAGG + Intronic
1171178985 20:23077589-23077611 GAAGGGAGGGAGAGGGAGGAGGG - Intergenic
1171178993 20:23077607-23077629 GAAGGGAGGGAGAGGGAGGAAGG - Intergenic
1171181941 20:23097530-23097552 CAAGTGATGGGCAGGTTGGAGGG + Intergenic
1171406349 20:24914745-24914767 AAAGACATGAAGAGGGTAGAGGG + Intergenic
1171418120 20:24997412-24997434 GAAGAGGTGGAGCAGGTGGAAGG - Intergenic
1171432858 20:25095805-25095827 AAAGAGAGAGAGAGGGTGAAGGG + Intergenic
1172770332 20:37378835-37378857 CTGGAGATAGACAGGGTGGAGGG + Intronic
1172907465 20:38379506-38379528 GAAAAGATTGAGAGGTTGGATGG + Intergenic
1172991611 20:39040907-39040929 CACGAGAAGGACAGGGTGGCAGG + Intergenic
1173002014 20:39111560-39111582 GAAGAGGAGGAGAGGGAGGAGGG + Intergenic
1173538996 20:43837659-43837681 AAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1173920171 20:46738475-46738497 CAAGAGATGGGGAGGAAGGGAGG + Intergenic
1173969967 20:47145199-47145221 CAAGTGATGGGGATGGAGGAGGG + Intronic
1174713969 20:52737029-52737051 CAAGAAAGGGAGAAGCTGGAGGG + Intergenic
1174761573 20:53211883-53211905 CCAAAGAGGGAGAGGGTGGGAGG - Intronic
1175076457 20:56378865-56378887 CCAGAGATGGAAGGGTTGGAAGG + Intronic
1176874898 21:14117751-14117773 CAAAAGTTGCAGAGGCTGGAGGG + Intronic
1176975116 21:15312245-15312267 CAGGAGAGAGAGAGCGTGGAGGG - Intergenic
1177928341 21:27248142-27248164 GAAGAGGTGGAGGAGGTGGAAGG - Intergenic
1178224666 21:30701382-30701404 CTAGAGATGGAGAGTGGTGATGG - Intergenic
1178624114 21:34201551-34201573 CAAGAAATGCAGAAGGTGGCAGG - Intergenic
1178660740 21:34505506-34505528 AAAGAGAGGCAGAGGCTGGAGGG + Intergenic
1178794149 21:35728106-35728128 GCAGAGATGGAGGAGGTGGAAGG - Intronic
1179345895 21:40556983-40557005 GGAGAGGTGGAGAAGGTGGAAGG + Intronic
1179477858 21:41659465-41659487 GAAGAGAGGGTGAGGGTGAACGG + Intergenic
1180226758 21:46398056-46398078 CAGGAGATTCAGAGGCTGGAGGG + Exonic
1182130001 22:27843832-27843854 GCAGAGATGGAGAGGGTGGCTGG + Intergenic
1182132529 22:27867239-27867261 CAGGAGATGGAGGAGGTGGGGGG + Intronic
1183493061 22:38127015-38127037 GAAGACATGGACAGAGTGGATGG - Intronic
1183509577 22:38227029-38227051 GAAGGGATGGAGGGGATGGAAGG + Intronic
1183615707 22:38944075-38944097 GAGGAGAAGGAGAGGGAGGAAGG - Intergenic
1183982109 22:41547211-41547233 CAAGAGAGAGAGTGGGAGGAGGG - Intergenic
1184027706 22:41870254-41870276 GCAGAGATGGGTAGGGTGGATGG - Intronic
1184582512 22:45426998-45427020 CCAGAGATGGGGAAGGTGGTGGG + Intronic
1184897686 22:47421198-47421220 CAGGAGATGGAAAGTATGGAAGG - Intergenic
1184916887 22:47575427-47575449 CAAGGGAAGGACAGGGAGGAGGG - Intergenic
1185190470 22:49433130-49433152 CCAGACAGGGAGAGGGTGGATGG - Intronic
1185273316 22:49938433-49938455 CCAGACATGGAGAAGGCGGATGG + Intergenic
949743044 3:7258434-7258456 CAAGAGAGGAAGAGAGTGGTAGG + Intronic
950104173 3:10377821-10377843 CAGCAGCTGGAGAGGGTGCAGGG - Intronic
950109385 3:10408779-10408801 CAGGTGGTGGAGGGGGTGGAGGG - Intronic
950199730 3:11034514-11034536 CACGCCCTGGAGAGGGTGGAGGG - Exonic
950304877 3:11909940-11909962 CGAGGGATGGAGGGGGTGGTGGG + Intergenic
950887449 3:16374112-16374134 CATGAGATGGTGAAGGTGAAAGG - Intronic
950917151 3:16657528-16657550 GAAAAGATGGAGGTGGTGGAAGG - Intronic
950976981 3:17257005-17257027 GAAGAGAAGGAGAGAGTGGAAGG + Intronic
951585404 3:24210235-24210257 GAAAAGATGGGGAGGGTGGGAGG + Intronic
952484217 3:33793278-33793300 CAGAATAAGGAGAGGGTGGAGGG - Intergenic
952498700 3:33938836-33938858 CAGGAGATGGAGAGGAAGGGTGG + Intergenic
952732125 3:36649599-36649621 GAAGAGATGAAGAGGGAGGATGG - Intergenic
953037621 3:39227069-39227091 AAAGAGAGGGAGAGGAGGGAGGG - Intergenic
953552443 3:43914057-43914079 CAAGAGACAGAGAGAGTGAAGGG - Intergenic
953700958 3:45195407-45195429 AAAGAGAAGGAAAGGGAGGAAGG - Intergenic
953778773 3:45846778-45846800 AAAGAGTTGGAGGAGGTGGAAGG + Intronic
953855565 3:46497168-46497190 CAAGAGGAGGAGAGGAAGGAAGG - Intergenic
954381089 3:50219610-50219632 CAAGAGATGGAGAGAGATGAGGG - Intronic
954992749 3:54855191-54855213 CAGGAAATGGAGAGAGGGGAGGG + Intronic
954996167 3:54883833-54883855 CAAGAGATAAGGAGGGTTGAAGG - Intronic
955201856 3:56858789-56858811 CAAGAGATGGAGAGGGTGGAGGG + Intronic
955382559 3:58451519-58451541 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
955445271 3:59003234-59003256 CAACAGATAGAATGGGTGGATGG + Intronic
955621622 3:60870478-60870500 AAAGAGATGCAGGAGGTGGAAGG + Intronic
955877562 3:63508797-63508819 TAAGGGATGAAGAGGGTGGGTGG - Intronic
956515071 3:70037506-70037528 CAAGAGATGGAGAGAGAAAAAGG + Intergenic
956565067 3:70626981-70627003 CAAGAAAGAGAGAGGGTGCAGGG - Intergenic
956715972 3:72080409-72080431 GAAGAGATGGGGAGGGAGGAAGG - Intergenic
957167070 3:76688818-76688840 CAAGAGAGGGAGAGATTGAAAGG - Intronic
957265543 3:77959859-77959881 CAAGAGAGTGAGTGGGTGAAGGG + Intergenic
957305343 3:78450831-78450853 CAAGAGAGGGAGAAGGTGTCAGG + Intergenic
957511041 3:81187545-81187567 CAAGAGAGGGAGGAGGTGGAAGG - Intergenic
958601869 3:96305013-96305035 GAAGAGATGGATATGTTGGAAGG + Intergenic
959467976 3:106713599-106713621 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
959971584 3:112416032-112416054 ATAGAGATAGAGAGGGTAGAAGG - Intergenic
960187421 3:114660865-114660887 AAATAGATGGGGCGGGTGGATGG + Intronic
960525438 3:118704837-118704859 GAAGAGGTGGGGAGGGGGGAGGG - Intergenic
961168304 3:124778798-124778820 GTAGAGATGGAGTGGGAGGAAGG + Intronic
961478384 3:127163325-127163347 CAGGCTTTGGAGAGGGTGGAAGG + Intergenic
961659270 3:128459777-128459799 CGAGGGATGGAGAGGCTGGGAGG - Intergenic
961788553 3:129362120-129362142 GAAAAGATTGAGAGGTTGGATGG - Intergenic
962155118 3:132938271-132938293 CCACTGATTGAGAGGGTGGATGG + Intergenic
962475703 3:135753233-135753255 CAAGAGCAGGAGAGGCAGGACGG + Intergenic
962751824 3:138439311-138439333 CAAGGGGTGGAGCGAGTGGAAGG + Intronic
962752516 3:138444266-138444288 CCTCAGATGGGGAGGGTGGAGGG + Intronic
963461598 3:145620909-145620931 CTAGGGATGGAGAGGAGGGAGGG + Intergenic
963741497 3:149086300-149086322 CAAGAGGTGAAGGGGGCGGAGGG - Exonic
964033987 3:152173171-152173193 GAAGAGGTGGAGAAGGTGGAAGG - Intergenic
965147993 3:164931053-164931075 CAGGGGATGGAGAGTGGGGATGG + Intergenic
965594875 3:170400712-170400734 AAAGAGAGGGAGAGGGAGGGAGG - Intergenic
965604640 3:170485978-170486000 CAAGAGCTTGTGAGGATGGAGGG + Intronic
966269275 3:178085064-178085086 CAAGAGAGGAGGAGGGGGGAGGG + Intergenic
966597795 3:181741375-181741397 AAAAAGGTGGAGAGGGGGGAAGG - Intergenic
966912867 3:184569122-184569144 GAAGTGAGGGAGAGGGAGGAGGG + Intronic
967251688 3:187546619-187546641 CATGAGAGGGAGAAGGTGTAGGG - Intergenic
967737872 3:192972683-192972705 CAATAGATGAGGAGGGTGAAGGG + Intergenic
967821455 3:193842882-193842904 CAAGAAAAGGAGGGGGTGGGTGG - Intergenic
967848608 3:194064681-194064703 GAAGAGATGGAGAAAGAGGAAGG + Intergenic
967993717 3:195151064-195151086 TAAGAGAGGGAGGGGGTGGGAGG - Intronic
968188831 3:196652855-196652877 CAAGAGGTGGCCAGGGAGGAAGG + Intronic
968366093 3:198185520-198185542 CAGGTGATGGAGAGGGTGGGAGG - Intergenic
969030122 4:4205146-4205168 CAGGGGATGGTGAGGATGGAAGG - Intronic
969051528 4:4376701-4376723 CAAGAGAGGCAGAGACTGGAGGG - Intronic
969402420 4:6964345-6964367 CAGGAGCTGCAGAGGGTGTAAGG - Intronic
969621035 4:8279000-8279022 GAAGGGATGGAGGGGGAGGAGGG - Intronic
969649702 4:8458287-8458309 GAAGACATGGAGGAGGTGGAAGG - Intronic
969651256 4:8469604-8469626 CTGGAGATGGAGAGCGGGGATGG + Intronic
969672885 4:8599324-8599346 CATGAGATGGAGCTGGCGGAGGG + Intronic
969963345 4:10969541-10969563 AAAGAGAAGGAGAGAGAGGAAGG - Intergenic
970064859 4:12081680-12081702 CAAGACATGGAGAAGGGGGATGG + Intergenic
970237885 4:13976907-13976929 CAAGATATGGGGAGGGAGGGAGG - Intergenic
970807134 4:20050183-20050205 GAAGAGGTGGAGAAAGTGGAAGG - Intergenic
970828472 4:20307081-20307103 AAAGAAATAGAGCGGGTGGAGGG - Intronic
971034173 4:22675142-22675164 AAAGAGAAAGAGAGGGAGGAAGG - Intergenic
971058483 4:22940325-22940347 CAAGAGATGGGGTGAGTCGAGGG - Intergenic
971433664 4:26595642-26595664 GAAGAGAAAGAGAGGGTGGGTGG - Intronic
972161915 4:36237554-36237576 CAAGAGATGGAGGAGGTGCCAGG - Intronic
972293615 4:37715321-37715343 CTAGAGCTGGGGAGGATGGATGG - Intergenic
972413278 4:38814505-38814527 CAAGAGAGAGAGAGAGAGGAAGG + Intronic
972446615 4:39150415-39150437 CAGGGGATGGAGAGGGAGGAAGG + Intergenic
973318713 4:48788062-48788084 AAAGTGAAGGAGAGGGAGGAAGG + Intergenic
973690754 4:53428113-53428135 GAAGAAATGGAGGAGGTGGAAGG - Exonic
973884547 4:55307157-55307179 CAAGAGAGAGAGAGGGTGGTGGG - Intergenic
975300090 4:72779990-72780012 CAAGAGAGAGAGAGTGGGGAGGG - Intergenic
975794890 4:77996799-77996821 CAAGGGATGGAGAAGGAGTACGG + Intergenic
976289687 4:83404816-83404838 GAAGAGATGGTGAGTATGGACGG + Intergenic
976426834 4:84913849-84913871 GAAGAGGTGGAGGAGGTGGAAGG - Intronic
977233293 4:94477765-94477787 AAAGAGGTGGAGGAGGTGGAAGG - Intronic
977542535 4:98334932-98334954 AAAGAGATGGGGAAGGTAGAAGG + Intronic
977557163 4:98497915-98497937 GAAGAGATGAAGAGGCTGGTTGG + Intronic
977694434 4:99950404-99950426 CAAGCGAAGAAAAGGGTGGAGGG + Intergenic
978404351 4:108363684-108363706 CAAGAGAAGGAGAGGGTTAGGGG + Intergenic
978503878 4:109435981-109436003 CAAGAGGTGCAGAGGGTGCTGGG + Intronic
978727374 4:111984890-111984912 CAAGAGATGGAGTGGGGGTGGGG + Intergenic
979038143 4:115751866-115751888 GAAGAGGTGGAGAAGGTGGAAGG + Intergenic
979333826 4:119445334-119445356 CAGGTGATGGAGAGGGTGGGAGG + Intergenic
979495909 4:121381595-121381617 CAGGAGTTAGAGATGGTGGAGGG - Intergenic
979740809 4:124148298-124148320 GAAGAGAAAGAGAGGGAGGAAGG - Intergenic
980500002 4:133637428-133637450 CAAGAGAAAGAGAGGAAGGAAGG + Intergenic
980784320 4:137532632-137532654 AAAGAGACGGAGAAGGAGGAAGG + Intergenic
982114279 4:152084382-152084404 GAAGAAGTGGAGAAGGTGGAAGG + Intergenic
982265523 4:153535095-153535117 CAAGAGATGGAGAGACATGATGG + Intronic
982302567 4:153894764-153894786 CAAGGGATGGACATGGTGGGAGG - Intergenic
982326885 4:154137335-154137357 CAGGTGGTGGAGAGGGTTGAAGG - Intergenic
983010177 4:162537335-162537357 CCAGAGATGGAGTAGGAGGAGGG + Intergenic
983248808 4:165321231-165321253 GAAGAGGTGGAGGAGGTGGAAGG - Intronic
983279127 4:165658480-165658502 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
983978175 4:173962643-173962665 GAAGAGGTGGAGGAGGTGGAAGG - Intergenic
984019713 4:174470298-174470320 GAAGAGATGGAGGAGGTGGAAGG + Intergenic
984182699 4:176504370-176504392 AATTAGATGGAGAGGGTGGGAGG - Intergenic
984375754 4:178926693-178926715 GAATAGGTGGAGAAGGTGGAAGG + Intergenic
984705797 4:182846236-182846258 AATGAGGTGGAGAGGGTGGCGGG - Intergenic
984718912 4:182952281-182952303 CAATAGAGGGAGAGCGTGGCAGG - Intergenic
985679129 5:1246818-1246840 GAACAGAGGGAGAGGGAGGAGGG - Intergenic
985828699 5:2212671-2212693 GAGGAGGTGGAGAGGCTGGAGGG + Intergenic
985997879 5:3606709-3606731 CAGGAGGTGGCGGGGGTGGAGGG + Intergenic
986371152 5:7081489-7081511 CAAGACAGGGAGTGGGTGGAAGG + Intergenic
986594539 5:9407704-9407726 TAAGAGATGGGGAGGGTAGCTGG - Intronic
986784793 5:11104457-11104479 CAAGAGTGGCAGACGGTGGATGG - Intronic
987603868 5:20107906-20107928 CAAGAAAGGGGGAGGGGGGAGGG - Intronic
987871489 5:23624216-23624238 AAAGAGAGGGACAGGGAGGATGG + Intergenic
989254607 5:39352633-39352655 AAAGAGATGAAGAGAATGGATGG - Intronic
989479056 5:41907077-41907099 CAGGAGATGGTGAAGGCGGAGGG + Intronic
989545342 5:42665981-42666003 CATGAGAGGGAGCTGGTGGAAGG - Intronic
990079757 5:51898923-51898945 GAAGAGGTGGAGAAGGTGGAAGG + Intergenic
990170863 5:53048183-53048205 GAAGTGATGGAGAAGGTGGCAGG - Intronic
990240344 5:53810704-53810726 CAAGGGCTGGAGAAGATGGATGG + Intergenic
990553084 5:56903810-56903832 GTGGAGATGGAGAGGGTGGATGG - Intergenic
990897928 5:60718826-60718848 AAAGAGTTGGAGAAGGTGGAAGG - Intergenic
991514312 5:67416803-67416825 CAAGGGATGGAGCAGGGGGAAGG + Intergenic
992801961 5:80301908-80301930 GAAAAGATTGAGAGGTTGGATGG + Intergenic
992866827 5:80965235-80965257 TGGGAGATGGAGAGTGTGGATGG + Intronic
992887626 5:81174464-81174486 GCAGAGGTGGAGAGGCTGGAGGG + Intronic
993005569 5:82425133-82425155 CAAGAGAGAGAGAGGGAGGGAGG + Intergenic
993125423 5:83829513-83829535 CAAGGGATGGAGTAGGTGGTAGG + Intergenic
996413101 5:123180339-123180361 TAAGAGAAAGAGAGGGTGGAGGG - Intronic
996780538 5:127181930-127181952 TAGGAGATGTGGAGGGTGGAAGG - Intergenic
996833826 5:127769207-127769229 CAAGTGATGGATTGGGTGAATGG + Intergenic
997183262 5:131855522-131855544 CAAAAGAGAGAGAGGGAGGAAGG + Intronic
997521625 5:134527201-134527223 GAAGGGAGGGAGAGGGAGGAAGG - Intronic
997526936 5:134559676-134559698 GAAGTGAAGGAGGGGGTGGAAGG + Intronic
997645143 5:135477029-135477051 CAAGAGAAGGAGAGAGGGGAGGG - Intergenic
997655153 5:135548924-135548946 AAAGAGATGATGAGGGTGGGAGG + Intergenic
997723306 5:136098199-136098221 CAAGAGAGAAAGAGGGGGGATGG + Intergenic
998052217 5:139045418-139045440 CAAGAGTTGGAGAAGGAGTAAGG - Intronic
998471982 5:142390515-142390537 GGAGAGAGGGAGAGGGTGGAGGG + Intergenic
999568836 5:152895782-152895804 CAAGTGTTGGAGAGGGTGCTTGG - Intergenic
999632717 5:153587256-153587278 CAAGAGTGAGAGAGGGTGGTGGG - Intronic
999652443 5:153780780-153780802 GAAGAGATGGTGAGTGTGGAGGG - Intronic
999773867 5:154795472-154795494 CAAGAGAGGGAGAGAAAGGAAGG - Intronic
999802813 5:155053553-155053575 CAAGAGGAGAAGAGGATGGAGGG + Intergenic
1000245097 5:159442504-159442526 CCAGGGATGTAGAGGGTGGAAGG - Intergenic
1000752465 5:165113889-165113911 GAAGAGTTGGAGGAGGTGGAAGG - Intergenic
1000918135 5:167106747-167106769 ATAGAGGTGAAGAGGGTGGAGGG + Intergenic
1000957694 5:167562024-167562046 AAAGAGATGGTGAGCGTGGAGGG + Intronic
1001333256 5:170777261-170777283 CAAGGGTTGGAGAGAGTGGGTGG + Intronic
1001511273 5:172324284-172324306 CAAGAGAGAGAGTGGGTGGGAGG - Intergenic
1001646099 5:173283443-173283465 TAAGAGAGGGAGAGAGGGGAAGG + Intergenic
1001663542 5:173413989-173414011 AAAGAGGTGGAGGAGGTGGAAGG - Intergenic
1002176842 5:177405435-177405457 TGAGAGATGGACATGGTGGAAGG + Intronic
1002197468 5:177509223-177509245 CAGGAGTGGGAGAGGGTCGAAGG - Intronic
1002360630 5:178667875-178667897 CCAGAGAGGGAGCTGGTGGAAGG + Intergenic
1002548981 5:179973086-179973108 TAAGAGAGGGATGGGGTGGATGG - Intronic
1002725319 5:181290745-181290767 CAGGTGATGGAGAGGGTGGGAGG - Intergenic
1003232516 6:4267501-4267523 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1003765736 6:9234398-9234420 GAAGAGGTGGAGGAGGTGGAAGG - Intergenic
1003924098 6:10860673-10860695 CAAGAGAGGGAGTTGGGGGAAGG + Intronic
1004226532 6:13789811-13789833 AAAGAGATGGAGAAGAGGGAGGG + Exonic
1004722023 6:18276030-18276052 GAAGAGGTGAAGAGGGAGGAGGG - Intergenic
1005162789 6:22883809-22883831 CAAGTGATGGAAAGGGAGGGTGG - Intergenic
1005354532 6:24969705-24969727 CAAGTGAAGGGGAGAGTGGAGGG - Intronic
1005447766 6:25942234-25942256 CAAGAGAAGGAGGGGGTCCAGGG - Intergenic
1005691849 6:28314169-28314191 CAAGAGTTGGAGAGGGGAGCTGG + Intergenic
1005954322 6:30653021-30653043 CATGAGATGGAAAGGAAGGAAGG - Exonic
1006290827 6:33135235-33135257 AAAGAGAGAGAGAGAGTGGAAGG - Intergenic
1006860425 6:37168961-37168983 CAAGGGAGGCAGAGGGTGGGGGG + Intergenic
1006865120 6:37203237-37203259 CAGAAGTTGGAGAAGGTGGATGG + Intergenic
1006921124 6:37627857-37627879 CAAAAGAAGGAGAGGGTGAAAGG + Intergenic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007279129 6:40697412-40697434 CACCAGACGGAGAGGGTGTAGGG + Intergenic
1007322307 6:41036426-41036448 CAACAAATTGAGAAGGTGGAAGG + Intronic
1007377310 6:41465710-41465732 GAAGAGTTGGAGACAGTGGATGG - Intergenic
1007404076 6:41623555-41623577 AAAGAGCTGGAGAGGGAGGGAGG - Intergenic
1007454151 6:41963207-41963229 CAAGAGGTGGAGATTGGGGAAGG - Intronic
1007665640 6:43511333-43511355 AAAGAGGTGGTGGGGGTGGATGG + Intronic
1007732837 6:43959812-43959834 GAAGAGGTGGAGGAGGTGGAAGG - Intergenic
1008318403 6:50075942-50075964 GAAGAGATAGAGAGGGTAGGGGG + Intergenic
1008890922 6:56488830-56488852 AAAGAGCTGGGGAGGGTGGGAGG + Intronic
1010401865 6:75455107-75455129 CAAGAGATTGGGGGGGTGGGGGG + Intronic
1010760608 6:79718292-79718314 CAAGTGATTGAGTGGCTGGAGGG + Intergenic
1010879696 6:81152470-81152492 CAAGAGATAGACTAGGTGGAGGG - Intergenic
1011927944 6:92671839-92671861 GAATAGCTGGAAAGGGTGGATGG + Intergenic
1012331835 6:98000606-98000628 CAAGATTTGGAGAGGGTTGTGGG - Intergenic
1012669060 6:102017260-102017282 CAGGAGATGGAGAGAGTGAAGGG + Intronic
1012969056 6:105707042-105707064 AAAGAGGTGGAGGAGGTGGAAGG - Intergenic
1013067553 6:106698492-106698514 CAAGAGATGGAGATTGTAGGGGG - Intergenic
1013398890 6:109771922-109771944 GAATAGCTGGAAAGGGTGGATGG - Intronic
1013715947 6:112961754-112961776 CAAGAGAGGGAGATAGTGAAGGG - Intergenic
1013755275 6:113454394-113454416 CAAGATAGAGAGAGGGTTGATGG + Intergenic
1014166966 6:118236214-118236236 AAAGAGAAGGAGAGGGAAGAAGG - Intronic
1015027495 6:128554069-128554091 GAAGAGAGGGAGAAGGAGGATGG - Intergenic
1015527484 6:134187428-134187450 CCAGAAATGGAAGGGGTGGAAGG - Intronic
1015680258 6:135799595-135799617 CAAGAGAGAGAGAGAGAGGAGGG - Intergenic
1015814244 6:137191690-137191712 CCAGAGATGGTGAAGGGGGAAGG + Intergenic
1016225125 6:141725390-141725412 AAAGAAAAGGAGATGGTGGAAGG - Intergenic
1016245912 6:141980599-141980621 GAAGAGAAGGAAAGGGAGGATGG + Intergenic
1016446933 6:144143427-144143449 AAAGATATGGACAGGGTGGAGGG + Intergenic
1017711095 6:157168803-157168825 CAAAAGATCGTGAGGATGGACGG - Intronic
1018281732 6:162193490-162193512 TAAGAGAAGAAGAGGATGGAGGG - Intronic
1018751114 6:166807474-166807496 GAAGAGATGGAGAGGGAGCAGGG - Intronic
1019096540 6:169585818-169585840 GAAGAGGTGGAGGAGGTGGAAGG + Intronic
1019737176 7:2656347-2656369 CCAGAGACAGGGAGGGTGGAGGG - Intronic
1020011358 7:4807556-4807578 AGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020011369 7:4807594-4807616 AGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020011392 7:4807668-4807690 GGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020011500 7:4808039-4808061 GGAGAGAAGGAGAGGGAGGAAGG - Intronic
1020224538 7:6269752-6269774 CAAGATAAGGAGAGAGAGGATGG - Intronic
1020915458 7:14186869-14186891 GAAGAGTTGGAGAGGGGCGAGGG + Intronic
1021110773 7:16692345-16692367 CAAGAGATGGGGAGATTGAAAGG + Intronic
1021295765 7:18904553-18904575 AAAGAAATGGGGAGGGTAGAGGG - Intronic
1021521066 7:21539514-21539536 CAAGAGAAGGAAAAGGTGAATGG + Intergenic
1022101451 7:27171770-27171792 CAGGAGATGGCGAGTGTGGGAGG + Exonic
1022466102 7:30654049-30654071 CAGGAGGTAGAGAAGGTGGAGGG - Intronic
1022536107 7:31099594-31099616 GAGGAGAGGGAGAGGGTAGAGGG + Intronic
1022640569 7:32178625-32178647 GATGAGATGGAGTGGGTTGAAGG - Intronic
1023095347 7:36654607-36654629 GCAGGGATGGAGAGGATGGATGG - Intronic
1023654060 7:42402433-42402455 AAAGTGATGGTGAGGGTGGAGGG - Intergenic
1023913979 7:44574791-44574813 GAAGAGAAGGGGAGGGGGGAGGG - Intronic
1024070225 7:45778358-45778380 CAGGTGATGGAGAGGGTGGGAGG - Intergenic
1024084927 7:45884989-45885011 CTTGAGATGGAGAAGCTGGAAGG + Intergenic
1024232893 7:47376212-47376234 CAAGAGATGGAAAGGGTGGTGGG + Intronic
1024325982 7:48109556-48109578 CTAGAGCTTGAGAAGGTGGAAGG - Intergenic
1025099208 7:56121586-56121608 CAGGTGATGGAGAGGGTGGGAGG + Intergenic
1026285557 7:68959768-68959790 AAAGAGAGAGAGAGGATGGAAGG + Intergenic
1026690543 7:72546762-72546784 CAAGAGAGTGAAAAGGTGGAGGG + Intergenic
1026740387 7:72975409-72975431 CCACAGATGGAGAGGGATGATGG + Intergenic
1026797689 7:73376895-73376917 CCACAGATGGAGAGGGATGATGG + Intergenic
1027103344 7:75389661-75389683 CCACAGATGGAGAGGGATGATGG - Intergenic
1027544024 7:79503789-79503811 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1028307704 7:89286923-89286945 AAAGAAGTGGAGAAGGTGGAAGG - Intronic
1028311182 7:89338522-89338544 AAAGAGAAAGAAAGGGTGGAGGG + Intergenic
1028536696 7:91896130-91896152 CAAGTGATGGAGAAGGTGGGAGG + Intergenic
1029142832 7:98423899-98423921 AAAGGGACGGAAAGGGTGGAGGG + Intergenic
1029599123 7:101553571-101553593 CAAGAGAGTGAGAAGGTGGCTGG + Intronic
1029673203 7:102048214-102048236 CAGGACCAGGAGAGGGTGGAGGG - Intronic
1030131307 7:106203756-106203778 TAAGAGGTGGAGAAGGTGGGAGG + Intergenic
1030189255 7:106794375-106794397 GGAGAGAAGGGGAGGGTGGAAGG + Intergenic
1030767742 7:113432467-113432489 AGAGAGATGCAGAAGGTGGAGGG - Intergenic
1031145074 7:117988693-117988715 TAATAGTTGGAGAGGGTGGAGGG + Intergenic
1031209787 7:118808363-118808385 AAAGAGATGGAGGAGGTGGAAGG + Intergenic
1031716828 7:125118578-125118600 CAAGAGAGAGAGAGAGTGGTGGG - Intergenic
1032047627 7:128622650-128622672 CAGGTGATGGAGAGGGTGGGAGG - Intergenic
1032352208 7:131175119-131175141 GGATAGATGGATAGGGTGGATGG + Intronic
1032353201 7:131185053-131185075 CGAGAGGAGGAGAGGGTGGTGGG + Intronic
1032529329 7:132607314-132607336 CAGGAGGGGGAGAAGGTGGAAGG - Intronic
1032732879 7:134661533-134661555 TAAGACATGGAGAGGGTGCTTGG + Exonic
1033845243 7:145424037-145424059 CAAGAGGTGGTGGGGGTGGGGGG - Intergenic
1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG + Intergenic
1034985973 7:155515570-155515592 CGAGAGGTGTGGAGGGTGGAGGG + Intronic
1035038015 7:155908069-155908091 AGAGAGAGGGAGAGGGAGGAGGG + Intergenic
1035692804 8:1571192-1571214 GATGAGATGGAGAGGGGAGAGGG + Intronic
1035692879 8:1571562-1571584 GATGAGATGGAGAGGGGAGAGGG + Intronic
1035764050 8:2091556-2091578 CACGACAGAGAGAGGGTGGAGGG - Intronic
1036037269 8:5032575-5032597 GAAGGAAGGGAGAGGGTGGAGGG + Intergenic
1036594954 8:10203173-10203195 CATGAATTGGAGAAGGTGGAGGG - Intronic
1037057147 8:14456892-14456914 CAAGAGAGAGAGAGTGTGGTTGG - Intronic
1037095093 8:14976549-14976571 CTAGAGATAGACAGGGTGTAAGG - Intronic
1037176254 8:15949841-15949863 TAAGCAATGGACAGGGTGGAGGG - Intergenic
1037274194 8:17159844-17159866 TAAGAGAAGGAAAGGATGGAGGG - Intronic
1037529041 8:19756733-19756755 GCTGGGATGGAGAGGGTGGAGGG - Intronic
1037808945 8:22074756-22074778 CAAGAGATGGGGAGCGGGGCAGG + Intronic
1038411985 8:27366256-27366278 GAAGAGATGGAAGGGGTGGGAGG - Intronic
1038610974 8:29059982-29060004 CAAGAGCTGGAGAGAGAAGATGG - Intronic
1039459246 8:37729517-37729539 CAAGAGAGAGGGAGGGAGGAAGG + Intergenic
1039656608 8:39415650-39415672 GGAGAGTTGGGGAGGGTGGAGGG + Intergenic
1039986530 8:42452453-42452475 GAAGAGATGGAGAAGGAGGAAGG + Intronic
1041273208 8:56129956-56129978 CAGGAGATGGAGAAGAAGGAAGG + Intergenic
1041309209 8:56497064-56497086 CAAGGGATGGGGGGTGTGGATGG + Intergenic
1041322132 8:56624222-56624244 CAAGTCACTGAGAGGGTGGATGG - Intergenic
1042214666 8:66418218-66418240 CAGGAGAGGAAAAGGGTGGAAGG + Intergenic
1042217104 8:66438032-66438054 CCAGAGATGGAGTGAGTTGAGGG + Intronic
1042514473 8:69644982-69645004 CAAGAGATGGAGCAGGGGCAGGG + Intronic
1042592741 8:70413283-70413305 CTAGAGATGGATAGTGTTGAGGG - Intergenic
1042654617 8:71082507-71082529 CAAGTGAGAGAGAGAGTGGAGGG + Intergenic
1043464835 8:80494485-80494507 AAACAGATGTAAAGGGTGGAGGG - Intronic
1043675872 8:82952990-82953012 CAAGAGAGGGAGAGTGAGGAGGG - Intergenic
1044047148 8:87450297-87450319 CAAAAGCTGGGAAGGGTGGAGGG + Intronic
1044609937 8:94081200-94081222 CATTAGATGTAGGGGGTGGAGGG - Intergenic
1044762031 8:95530064-95530086 GAAGAAGTGGAGAAGGTGGAAGG + Intergenic
1044801948 8:95966151-95966173 TAAGAGAGGGAGAAGGAGGAAGG + Intergenic
1045010847 8:97957201-97957223 CACCAGGTGGAGAAGGTGGAAGG + Intronic
1045364195 8:101460708-101460730 CTAGAGGTGGAGAGGGTGGGGGG - Intergenic
1045832154 8:106475467-106475489 GAAGAGGTGGAGGAGGTGGAAGG + Intronic
1046495507 8:115009393-115009415 CAAGAGAAAGAGAGAGTGAAAGG + Intergenic
1046890516 8:119416588-119416610 CAGGAGATGGAGAAGCAGGAAGG - Exonic
1047036339 8:120942851-120942873 CAAGAATTGGAGAGGGGGGCTGG - Intergenic
1047145250 8:122191423-122191445 CAAGAGAAGGAGATGATGGAAGG - Intergenic
1047414678 8:124654374-124654396 ACAGAGGTGGAGAGAGTGGATGG - Intronic
1047416204 8:124666697-124666719 CATGGGATAGGGAGGGTGGAGGG + Intronic
1047605313 8:126468535-126468557 CAAGGTATGGTGGGGGTGGATGG + Intergenic
1047753136 8:127897585-127897607 GAAGAGAGGGAGAGGAAGGAAGG + Intergenic
1048107864 8:131430974-131430996 CAAGAGACAGTGAGGTTGGAGGG - Intergenic
1048651583 8:136484315-136484337 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1048824752 8:138413229-138413251 CAAGGGAGGGAATGGGTGGAAGG - Intronic
1048975095 8:139667017-139667039 TGAGAGCTGGACAGGGTGGACGG - Intronic
1049100646 8:140576617-140576639 CAAGAGCTGGTGAAGGCGGAGGG + Intronic
1049311757 8:141937310-141937332 AAAGAGGAGGAGAGGGAGGAGGG - Intergenic
1049350591 8:142162443-142162465 AAAGAGATGAAGATGGGGGATGG + Intergenic
1049350724 8:142163161-142163183 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350754 8:142163332-142163354 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350784 8:142163468-142163490 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350828 8:142163722-142163744 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350857 8:142163893-142163915 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350898 8:142164081-142164103 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350932 8:142164257-142164279 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049397707 8:142409282-142409304 AAAGAGAAGGAGAGAGGGGAAGG + Intergenic
1049416762 8:142498948-142498970 CAAGAGAGGGAGAGAGAGGCTGG - Intronic
1049500123 8:142958358-142958380 GAAGAAGTGGAGAGGCTGGATGG + Intergenic
1050123261 9:2330328-2330350 GGTGAGATGGAGGGGGTGGAGGG - Intergenic
1050307020 9:4315046-4315068 GAAGAGCAGGAGAGAGTGGAAGG - Intronic
1051167478 9:14279703-14279725 CCAGAGATGAAGAGTGTGAAAGG - Intronic
1052026832 9:23582784-23582806 CAAGATATGGAAGGGGTAGAGGG + Intergenic
1052205255 9:25831143-25831165 CAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1053183739 9:35996724-35996746 CAAGACATGGAGAGAGAAGAGGG + Intergenic
1053219101 9:36296671-36296693 GAAGGGAAGCAGAGGGTGGAAGG + Intronic
1053240201 9:36488417-36488439 CAAAAGATGGGGAGGGTGTGAGG + Intergenic
1053527184 9:38842063-38842085 AGAGACACGGAGAGGGTGGAAGG + Intergenic
1054199407 9:62066494-62066516 AGAGACACGGAGAGGGTGGAAGG + Intergenic
1054638948 9:67521863-67521885 AGAGACACGGAGAGGGTGGAAGG - Intergenic
1055527609 9:77151118-77151140 AAAGAGAAGAAGAGGGTAGATGG + Intergenic
1056024213 9:82475732-82475754 GAAAAGATGGAGGAGGTGGAAGG + Intergenic
1056121988 9:83497688-83497710 AAAGAGAAGCAGAGAGTGGAAGG - Intronic
1056283382 9:85063923-85063945 CATGAGGTGGAAAGAGTGGAGGG + Intergenic
1057262032 9:93590403-93590425 CAGGAGTGGGAGAGAGTGGAAGG - Intronic
1058580200 9:106447540-106447562 AAAGAGGTGGAGAAGGTGGAAGG - Intergenic
1058732324 9:107862163-107862185 CTAGAGATTGGGAGGGAGGAGGG - Intergenic
1059096141 9:111416844-111416866 CAAGGCCTGGAGGGGGTGGATGG + Intronic
1059633714 9:116153115-116153137 AAAGAGAGGGAGAGGGAGGGAGG + Intergenic
1060247397 9:121957897-121957919 GAAGAGAAGGAGGGGCTGGAAGG + Intronic
1061168931 9:128940833-128940855 AAAGAGAAGGAGGGGCTGGATGG + Intronic
1061214696 9:129214807-129214829 CCAGAGATGGACAGGATGGCAGG - Intergenic
1061911047 9:133724511-133724533 CAAGACTTGGTGAGGATGGAGGG + Intronic
1062133342 9:134912172-134912194 CAACAGCTGGAGATGGGGGAAGG + Intronic
1062275138 9:135726952-135726974 AAAGAGAGGGAGAGGGAGAATGG - Intronic
1062275150 9:135727010-135727032 AAAGAGAGGGAGAGGGAGAATGG - Intronic
1062369760 9:136231887-136231909 GAGGGGGTGGAGAGGGTGGAGGG - Intronic
1062369773 9:136231914-136231936 GAGGAGGCGGAGAGGGTGGAGGG - Intronic
1062568493 9:137173727-137173749 CCAGAGCTGGAGAGGTGGGAGGG + Intergenic
1062568513 9:137173810-137173832 CCAGAGCTGGAGAGGTGGGAGGG + Intergenic
1062750462 9:138248387-138248409 CAGGTGATGGAGAGGGTGGGAGG - Intergenic
1203654449 Un_KI270752v1:9595-9617 AAAGAGAGAGAGAGGGAGGAAGG - Intergenic
1185575491 X:1169031-1169053 AAAGAGAAGGAGGAGGTGGAGGG + Intergenic
1185756304 X:2655724-2655746 CAAGAGATAGAGAAGGTGAGAGG + Intergenic
1185888210 X:3801843-3801865 CAGGAGCTGGAGAGGCAGGAAGG + Intergenic
1186239894 X:7554999-7555021 GAAGAGAAAGAGAGGTTGGAAGG + Intergenic
1186924924 X:14323033-14323055 CCAGAGATGGAGAAGGTTGCAGG + Intergenic
1187102408 X:16207618-16207640 GAAGAGGTGGAGAAGGTGAAAGG + Intergenic
1187247247 X:17563784-17563806 TATGTGATGGAGTGGGTGGACGG + Intronic
1187254748 X:17632145-17632167 AAAGAGAAGGAGAATGTGGAAGG + Intronic
1187342784 X:18436279-18436301 GAAGAGGTAGAGAAGGTGGAAGG + Intronic
1187709716 X:22040991-22041013 CAAGAGATGGAGAGGGAGAATGG + Intronic
1188138253 X:26516356-26516378 GAAGAGGTAGAGAAGGTGGAAGG - Intergenic
1188869025 X:35351274-35351296 CCAGAGTTGGAGAGGCAGGAAGG + Intergenic
1188880975 X:35491764-35491786 AAAGAGAGGGAGAGGAGGGAAGG - Intergenic
1188914954 X:35898963-35898985 CAAGAAAAGGAGAGGTTTGAAGG + Intergenic
1189650985 X:43189246-43189268 CAAGAGAGGGACATGGTGGGAGG - Intergenic
1189904750 X:45746482-45746504 CAAGAGATGAAAAAGCTGGATGG + Intergenic
1189926188 X:45958067-45958089 TAAGAGAGGGAGAGAGTTGAAGG + Intergenic
1190100450 X:47518728-47518750 CAAGAAATGGAGATGGGGAAGGG - Intergenic
1190220790 X:48511221-48511243 AAAGAGAGGGAGTGGGAGGAAGG - Intronic
1190323285 X:49190998-49191020 CAATAGATGGTGAGGGTAAATGG - Intronic
1190430750 X:50375889-50375911 AAACTGATGGAGAGAGTGGACGG - Intronic
1190540367 X:51471289-51471311 AAAGAGCCTGAGAGGGTGGAAGG - Intergenic
1190759951 X:53430825-53430847 CAAGGGAGGGAGAGGAGGGATGG + Intronic
1190795029 X:53732998-53733020 GAAGAGTTGGAGGAGGTGGAAGG - Intergenic
1190952662 X:55161647-55161669 CAAGAAATGGACATCGTGGAGGG - Intronic
1192079925 X:68037884-68037906 CAAGAGAGAGAGAGGAGGGAGGG + Intergenic
1192084648 X:68084317-68084339 AAAGAGGTGGGGAGGGGGGAGGG + Intronic
1192432714 X:71123291-71123313 CGAGAGATGGAGGTGGTGGAGGG + Intronic
1192582713 X:72298422-72298444 CTAGAGAAGGAGAGGGAGTAAGG - Intronic
1193066523 X:77265791-77265813 CAGGAGAAGGAGAAGGTGAAGGG - Intergenic
1193900103 X:87166548-87166570 CAGGAGATGGTGGGGGTGGGGGG + Intergenic
1194149926 X:90311012-90311034 CAAGAGAGAGAGAGAGTGAAGGG + Intergenic
1194372890 X:93096211-93096233 CAAGAGATAGAGAGAGAGGAGGG + Intergenic
1194737196 X:97526599-97526621 TTAGAGATGGAGAAGGTAGAAGG - Intronic
1195069774 X:101267643-101267665 TATGAGATGGAGCGGGTGGTGGG - Intergenic
1195859231 X:109363494-109363516 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1196230827 X:113219060-113219082 GAAGAGATGGAGGAGGTGGAAGG - Intergenic
1196318588 X:114260742-114260764 CAGAAGATGGAGAGAGTGGATGG - Intergenic
1196334285 X:114512840-114512862 CAAAAAATGGAGAAGGTAGAGGG + Intergenic
1196987936 X:121295322-121295344 CAAGAGATGGCAAGAGTGGGAGG - Intergenic
1197160331 X:123315812-123315834 CAAGAAATGGAAAGAGTGGTTGG + Intronic
1197321089 X:125032049-125032071 CAAGAGATTGAGATGGTGGGAGG + Intergenic
1197417835 X:126196942-126196964 CAGGAGCAGGAGAGAGTGGAGGG - Intergenic
1198116491 X:133549740-133549762 AAAGAGAGAGAGAGGGAGGATGG - Intronic
1198570087 X:137945636-137945658 AAAGAGATGAATAGGGTTGATGG + Intergenic
1198868651 X:141152886-141152908 AAAGATATGGGGAGAGTGGATGG + Intergenic
1199433904 X:147791310-147791332 CAAGAGATGGAGAGACTGAAGGG - Intergenic
1199938863 X:152604541-152604563 AGAGAGATGGTGAGGGAGGAAGG + Intergenic
1200496352 Y:3888095-3888117 CAAGAGAGAGAGAGAGTGAAGGG + Intergenic
1200680928 Y:6210251-6210273 CAAGAGATAGAGAGAGAGGAGGG + Intergenic
1201146255 Y:11066994-11067016 GAACAGAGGGAGAGGGAGGAAGG + Intergenic
1201146336 Y:11067237-11067259 GAAGAGAGGGAGAGAGAGGAAGG + Intergenic
1201146552 Y:11067931-11067953 GAACAGAGGGAGAGGGAGGAAGG + Intergenic
1201531014 Y:14989778-14989800 CCATAGATGGAGATGGTAGAGGG - Intergenic
1201550330 Y:15211557-15211579 CAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1201906782 Y:19093557-19093579 CAGGAGCTGGAGATGGAGGAGGG - Intergenic