ID: 955204917

View in Genome Browser
Species Human (GRCh38)
Location 3:56887255-56887277
Sequence CACAATTAGCAACATGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955204915_955204917 -6 Left 955204915 3:56887238-56887260 CCAGAGAATGCTGTGATCACAAT 0: 2
1: 0
2: 0
3: 13
4: 141
Right 955204917 3:56887255-56887277 CACAATTAGCAACATGTGCTGGG 0: 1
1: 0
2: 1
3: 6
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955204917 Original CRISPR CACAATTAGCAACATGTGCT GGG Intronic
904893674 1:33798408-33798430 CACCATCAGCACCATGTCCTGGG - Intronic
905947283 1:41914165-41914187 CACAGTTGGAAATATGTGCTTGG - Intronic
909932388 1:81511853-81511875 AACAATTTGAAAAATGTGCTTGG - Intronic
910821357 1:91352113-91352135 CACAATTAGCATTTAGTGCTAGG + Intronic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
916463993 1:165054961-165054983 CACAGTTTGCAACATGAGCATGG - Intergenic
920580271 1:207100165-207100187 CAGAATTAGCAACATATTATTGG + Intergenic
923907711 1:238403817-238403839 CACAATTAGAATTATTTGCTGGG - Intergenic
1066657743 10:37711463-37711485 CAAAAGCAGCCACATGTGCTTGG + Intergenic
1069018618 10:63461044-63461066 CACAATTAACAACATTTACTGGG + Intronic
1072707939 10:97695586-97695608 CAAAATTATCAAGATCTGCTAGG + Intergenic
1072990990 10:100193583-100193605 CACCATTAGTAACCTGTCCTTGG + Intronic
1073561668 10:104502333-104502355 CTCAATGAGCAGCAAGTGCTTGG - Intergenic
1086491666 11:87362387-87362409 AACATTTAGCAGCATGTGGTTGG + Intergenic
1086859035 11:91902446-91902468 CACACCTAGCAACAAGTGCAAGG - Intergenic
1087584238 11:100098008-100098030 CAGAATTACCAAGATGAGCTAGG + Intronic
1087913731 11:103783121-103783143 CACAATTCCCAAGAAGTGCTGGG - Intergenic
1089873031 11:121693733-121693755 CACAATTAGCCTGATGTGGTGGG + Intergenic
1091109041 11:132948301-132948323 CACAATAAAGACCATGTGCTAGG - Intronic
1092618142 12:10234307-10234329 GACAGTTTGCAACATGTGCTTGG - Intergenic
1096325200 12:50654167-50654189 CAAAATTAGCAGAAGGTGCTGGG - Intronic
1098026057 12:66202637-66202659 CACAAATACAAAAATGTGCTGGG + Intronic
1101339104 12:103825648-103825670 CCCAATTAGCTACCTGTGCCTGG - Intronic
1110072147 13:71190745-71190767 CACAGTGAGCAACATGTCTTGGG + Intergenic
1112565608 13:100549187-100549209 CAAAATTAGCCAGATGTGGTGGG + Intronic
1114441196 14:22749468-22749490 CACACTTCGAAACATGGGCTGGG + Intergenic
1117655004 14:57946358-57946380 CCCAATTAACAAAAAGTGCTGGG - Intronic
1120761611 14:88290475-88290497 TGCAATTAGTAACATGTTCTGGG + Intronic
1121228223 14:92337214-92337236 CCCAATTAGCAGGCTGTGCTTGG + Intronic
1122604143 14:102937384-102937406 CAGAACCAGCAACATGTGCAAGG + Intronic
1124424541 15:29552965-29552987 TAAAAGTAGCACCATGTGCTTGG + Intronic
1124868831 15:33520707-33520729 CATAATAAGAAACATGTGTTAGG + Intronic
1128897622 15:71390110-71390132 CAGAATGAGCAACATATTCTGGG + Intronic
1131706947 15:95006940-95006962 AACAATTAGCTACCTGTGATTGG - Intergenic
1132361695 15:101221339-101221361 AACAATTAGCCAGGTGTGCTGGG + Intronic
1136620197 16:31423521-31423543 CAGAATGAGCAACATGTCCCTGG - Intronic
1143370150 17:6434510-6434532 AAAAATTAGCCAGATGTGCTGGG - Intronic
1146960863 17:36976895-36976917 AACAATTAACAACTTTTGCTAGG - Intronic
1147661402 17:42118989-42119011 AACAATTAGTAACATCTACTGGG + Intronic
1148096165 17:45053713-45053735 AAAAATTAGCCAGATGTGCTGGG - Intronic
1149419302 17:56493210-56493232 TACAATTTGTAAAATGTGCTAGG + Intronic
1151372606 17:73657940-73657962 TTCATTTGGCAACATGTGCTGGG - Intergenic
1156564308 18:38167061-38167083 CACACTTAGCACCCTGTTCTTGG + Intergenic
1157643358 18:49241351-49241373 CACTATTAGCTACATGACCTTGG + Intronic
1163114768 19:15182043-15182065 CACAATTAGCAGCGTTTGCTTGG - Intronic
1164127158 19:22328991-22329013 CACAATGATCCACATGGGCTGGG - Intergenic
1164823035 19:31264779-31264801 CACATTTTGCAACCTGTGCCAGG + Intergenic
1166732680 19:45067801-45067823 CACAATTAGAACCTTGTCCTGGG + Intronic
1167692103 19:50991984-50992006 GACACTTAGCAACAGGTGCCAGG - Intergenic
1168518179 19:57026207-57026229 TTCATTTAGAAACATGTGCTCGG + Intergenic
924991011 2:313245-313267 CACATTTTGCAAAATATGCTAGG - Intergenic
931957309 2:67441711-67441733 CAAAGTTAGCAGCTTGTGCTTGG - Intergenic
933075081 2:77914138-77914160 CATAATTAGCAAAATATGTTTGG - Intergenic
935052378 2:99534745-99534767 CAAAATTAGCAAAATTAGCTAGG + Intergenic
935318926 2:101866352-101866374 CCAAATTACCAACATGTGCATGG - Intronic
937741927 2:125364823-125364845 CTCAATTAGCAGGATGTGATAGG + Intergenic
940257819 2:151749868-151749890 CAAAATAATCAATATGTGCTGGG + Intergenic
941750528 2:169130579-169130601 AACAATTAAAAACATGGGCTGGG - Intronic
942963651 2:181863221-181863243 CACAATTTACAACATTTGTTTGG - Intergenic
942974303 2:181996426-181996448 AACATTTTCCAACATGTGCTGGG - Intronic
943990686 2:194687339-194687361 CACAGTTAGCAACATCCCCTAGG - Intergenic
1171361315 20:24588315-24588337 TAGAATTAGCAAAATCTGCTGGG - Intronic
1174111204 20:48199081-48199103 TAAATTCAGCAACATGTGCTGGG + Intergenic
1177504263 21:22000510-22000532 CACAACTTGCACCATGTGCCTGG - Intergenic
1178214643 21:30580465-30580487 CAGAGTTAGCAACCTGTGGTAGG - Intergenic
1178904013 21:36621425-36621447 CACATTTAACAAAAGGTGCTGGG + Intergenic
950140456 3:10611544-10611566 CACCATCAGTGACATGTGCTTGG + Intronic
952449135 3:33414383-33414405 CAGAACTAGCAACATGTGATGGG + Intronic
954128538 3:48547623-48547645 AAAAATTAGCCACATGTGGTGGG - Intronic
954761921 3:52881034-52881056 CAAAATTAGCCAGATGTGGTGGG + Intronic
955204675 3:56885116-56885138 CACAATCAGCAACACGTGCTGGG + Intronic
955204917 3:56887255-56887277 CACAATTAGCAACATGTGCTGGG + Intronic
957715284 3:83921094-83921116 AACAATCAGCAAAAAGTGCTTGG + Intergenic
958989691 3:100828570-100828592 CACAATTAGCCTCCTGAGCTGGG + Intronic
959155400 3:102660678-102660700 AGCAATTAGCAACATGTTCCAGG + Intergenic
964460000 3:156914084-156914106 CAAAATTAGCAACAGTTCCTTGG + Intronic
966742026 3:183242789-183242811 AACAGTTTGCACCATGTGCTTGG + Intronic
967526380 3:190498926-190498948 CACAATTTTTAACATGTGATAGG - Intergenic
970493528 4:16601559-16601581 CCTAATTAAAAACATGTGCTTGG - Intronic
970800399 4:19966277-19966299 GACAGCTTGCAACATGTGCTGGG - Intergenic
971987655 4:33847029-33847051 GACATCTAGCAACATGTACTGGG + Intergenic
972301873 4:37792364-37792386 TACAGTTTGCACCATGTGCTTGG + Intergenic
972350121 4:38229017-38229039 CAAACTTATCAACATGTACTTGG + Intergenic
974868634 4:67610795-67610817 CACAGTTTGCAAAAAGTGCTAGG + Intergenic
978531025 4:109713481-109713503 TACAATAAGGAACAAGTGCTGGG + Exonic
980202387 4:129672624-129672646 CATACATAGCAACATGTGCTGGG - Intergenic
987822420 5:22982949-22982971 CATATTTAGCAGCATATGCTTGG + Intergenic
988619316 5:32806288-32806310 CACTATTAGGAACCTGGGCTGGG - Intergenic
989367561 5:40673850-40673872 AAAAATTAGCAACATATTCTAGG + Intergenic
989523596 5:42427949-42427971 GACAGTTAGCACCATGTGCCTGG - Intronic
993709709 5:91212827-91212849 GACAATTAGGAACATCTGTTTGG - Intergenic
999223766 5:150002823-150002845 CTGAAATAGCAACATATGCTAGG - Intronic
1004883219 6:20028601-20028623 CACAATTAGAAACATAAGCCAGG + Intergenic
1005065387 6:21812710-21812732 CTCAATTTGTAACATGTGGTGGG + Intergenic
1012193053 6:96304231-96304253 CCCATTTAGCCAAATGTGCTCGG + Intergenic
1013972642 6:116039569-116039591 CACCATCAGAAACATGTGCAGGG - Intronic
1017757039 6:157538646-157538668 CACAAATAGCCACATGTCCAAGG + Intronic
1018837004 6:167492678-167492700 CACATTTAGTAACATCTACTGGG - Intergenic
1025759317 7:64375388-64375410 CACAATTTTCTCCATGTGCTAGG - Intergenic
1031967850 7:128040878-128040900 AACAATTAGCAAACTGTGCAAGG - Intronic
1031981535 7:128129804-128129826 CACAGTTAGAAACATATCCTGGG - Intergenic
1032712337 7:134471189-134471211 CACAATTCACATCATGTCCTAGG - Intergenic
1033935807 7:146584449-146584471 CATAATTTGGAACATGAGCTGGG + Intronic
1036056319 8:5258858-5258880 CAGAGTTAGTTACATGTGCTGGG + Intergenic
1039164834 8:34666456-34666478 GACATTTAACAACATGCGCTCGG + Intergenic
1042804136 8:72753877-72753899 CACATTAAGCAATATGTTCTTGG + Intronic
1043014665 8:74923109-74923131 CCCAAGTAGCAACATCAGCTTGG - Intergenic
1046481599 8:114826012-114826034 AACAATTAGCCAGATGTGGTGGG - Intergenic
1048378460 8:133843591-133843613 CACAACTAGTAACGTGTCCTGGG + Intergenic
1052339919 9:27354789-27354811 TACAATTAACTACATTTGCTAGG + Intronic
1053616349 9:39770356-39770378 GACAGTTTGCACCATGTGCTTGG - Intergenic
1053874514 9:42529663-42529685 GACATTTTGCACCATGTGCTTGG - Intergenic
1053898100 9:42764924-42764946 GACAGTTTGCACCATGTGCTTGG + Intergenic
1054237168 9:62572033-62572055 GACAGTTTGCACCATGTGCTTGG + Intergenic
1054551305 9:66606544-66606566 GACAGTTTGCACCATGTGCTTGG + Intergenic
1055129100 9:72754079-72754101 CAGAAGAAGCAACATCTGCTTGG + Intronic
1056299750 9:85228869-85228891 CTCAATTACCACCAAGTGCTGGG + Intergenic
1057086099 9:92211817-92211839 CTCACGTAGCAACATGTCCTAGG - Intronic
1057633086 9:96736514-96736536 CAAAATTAGAAACTTCTGCTGGG - Intergenic
1057996144 9:99822860-99822882 CACCATTAGCAACATTTACTTGG - Intronic
1059437409 9:114284961-114284983 CACATTCAGCACTATGTGCTGGG + Intronic
1186781194 X:12913728-12913750 CACAATTGGAAACATATACTTGG - Intronic
1188272807 X:28162055-28162077 AACATTTTGCCACATGTGCTTGG + Intergenic
1192427666 X:71091699-71091721 CAGAATTAGCAAGATGGTCTTGG - Intergenic
1193508435 X:82371182-82371204 AACATTTGGCAACATGTGATGGG - Intergenic
1193667138 X:84334847-84334869 CATAAATAGCAACATGTTGTAGG + Intronic
1193751604 X:85352387-85352409 CACAATCAACAAAATGTACTAGG + Intronic
1194599428 X:95902147-95902169 AAAAATTAGCAACATTTGTTAGG - Intergenic
1195488384 X:105437648-105437670 CCCATTTAGAAACAGGTGCTAGG + Intronic
1195804692 X:108750797-108750819 CTCAGTTAGCAGCATGTGGTCGG - Intergenic
1198566111 X:137906992-137907014 TACAGTTTGCATCATGTGCTGGG + Intergenic
1199196155 X:145033027-145033049 GACAGTTTGCACCATGTGCTTGG + Intergenic
1199552730 X:149076339-149076361 AACATTTAGCAGCATGTGGTTGG + Intergenic
1200414142 Y:2890393-2890415 AAAAATTAGCAAGATGTGATGGG + Intronic