ID: 955212172

View in Genome Browser
Species Human (GRCh38)
Location 3:56952400-56952422
Sequence CTGAAATCAAGCTGTCAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1817
Summary {0: 1, 1: 2, 2: 58, 3: 399, 4: 1357}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955212172_955212174 -7 Left 955212172 3:56952400-56952422 CCTGACTGACAGCTTGATTTCAG 0: 1
1: 2
2: 58
3: 399
4: 1357
Right 955212174 3:56952416-56952438 ATTTCAGTCTCAGGAGATCTTGG 0: 1
1: 0
2: 2
3: 25
4: 290
955212172_955212175 -6 Left 955212172 3:56952400-56952422 CCTGACTGACAGCTTGATTTCAG 0: 1
1: 2
2: 58
3: 399
4: 1357
Right 955212175 3:56952417-56952439 TTTCAGTCTCAGGAGATCTTGGG 0: 1
1: 0
2: 1
3: 23
4: 704

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955212172 Original CRISPR CTGAAATCAAGCTGTCAGTC AGG (reversed) Intronic
900308840 1:2023880-2023902 CTGAAATCAAGGTGTGGGTGGGG + Intronic
900693638 1:3996647-3996669 CTGAAATCAAGGTGTCTGCAGGG + Intergenic
901028369 1:6291453-6291475 CTGAAATCAAGGCGTCAGCAGGG - Intronic
901152150 1:7110963-7110985 CTGAAATTAAGGTGTCAGAAGGG + Intronic
901172415 1:7269154-7269176 CTGAAATCAAGGTGTGAGCCAGG + Intronic
901339172 1:8479715-8479737 CTGACATCAAGTTGTCAGTGGGG - Intronic
901754137 1:11430749-11430771 CCAAAATCAAGGTGTCAGTGAGG + Intergenic
901883765 1:12208790-12208812 CTGGAATCAAGATGTCAGACTGG + Exonic
902040027 1:13485854-13485876 CTGAAATTAAGGTGTCAGCCAGG + Intronic
902079363 1:13810787-13810809 CAGAACTCAAGCTTTCAGCCAGG - Intronic
902113560 1:14102811-14102833 CTGAGATCAAGGTGTCAGCAGGG + Intergenic
902132631 1:14276486-14276508 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
902247402 1:15129856-15129878 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
902260601 1:15222052-15222074 CTGAAATCAAGGTGTAAGCGGGG - Intergenic
902446123 1:16465726-16465748 CTGAAATCAAGATGCCAGTAGGG + Intergenic
902726658 1:18340676-18340698 CTGAAATCAAGGTGTCAGTAGGG + Intronic
903052516 1:20612272-20612294 CTGACATCAAGATGTCAGAATGG - Intronic
903062536 1:20679819-20679841 CTGAAATCAAGGTGTTAGCAGGG - Intronic
903315294 1:22499069-22499091 CTGCAGTCAAGGTGTCAGCCAGG + Intronic
903455920 1:23486635-23486657 CTAAAATCAAGGTATCAGTGGGG + Intergenic
905072916 1:35243245-35243267 CTGAAATCAAGATATCAGCCAGG - Intergenic
905397939 1:37679404-37679426 CTGTAGTCAAGCTGTCAGCAGGG + Intergenic
905470733 1:38189806-38189828 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
905663102 1:39743637-39743659 CTGAAGTCCAGCTCTCAGTAGGG - Intronic
905938062 1:41840494-41840516 CTGAAATCAAGGTGTCAGCAGGG - Intronic
905998595 1:42403794-42403816 CTGAAATCATGGTGTCAGCTGGG + Intronic
906010117 1:42515297-42515319 CTGAAATCAAGGTATTAGTAGGG - Intronic
906039483 1:42776998-42777020 CTGAAATCAAGTTATTGGTCAGG + Intronic
906074552 1:43042384-43042406 CTGAAATCAAGCTGTCAGCAGGG + Intergenic
906188228 1:43878043-43878065 CTGAAATCAAGGTGTTAGCAGGG + Intronic
906955703 1:50371865-50371887 CTGAAATCAAGGTGTCGGTTAGG + Intergenic
907580600 1:55568807-55568829 CTGAAGTCAAGGTGTCAGCAGGG - Intergenic
907801752 1:57773102-57773124 CTGAAATTAAGGTATCAGTAGGG - Intronic
908113254 1:60917687-60917709 CTGAAATCAAGGTGTGAGCAGGG + Intronic
908120575 1:60982381-60982403 CTGTAAGCAAGCTCTCAGCCTGG + Intronic
908731237 1:67228649-67228671 CTGAAATCAGGGTGTCAATAGGG + Intronic
908773216 1:67614931-67614953 CTGTAATCAAGGTGTCTGTCAGG - Intergenic
909115197 1:71524975-71524997 CTAAAATCAAGATGTCAGCAGGG - Intronic
909193318 1:72583108-72583130 CTGAAATGGAGGTGTCAGCCAGG - Intergenic
909352061 1:74665586-74665608 CTGACATCAAGGTGTCAGCAGGG + Intronic
909363795 1:74796458-74796480 CTAAAATCAAGGTGTCAGAAGGG - Intergenic
909465134 1:75964863-75964885 CAGAAATCAGGCTGTCAGCAGGG + Intergenic
909674785 1:78226963-78226985 CTGAAATCAAGGGGTCAGCCAGG + Intergenic
909677434 1:78253731-78253753 CTGAAATCAAGGTGTCAGCCTGG + Intergenic
909858510 1:80573244-80573266 CTAAAATCAAGATGTCAGCAGGG - Intergenic
910202478 1:84713847-84713869 CTGAATTCAAGGTGTCAGCAGGG + Intergenic
910211389 1:84797337-84797359 CCGAAATCAAGGTGTCAGCAGGG + Intergenic
910286611 1:85562751-85562773 CTGAAATCAAGGTGTTAGCAGGG - Intronic
910418980 1:87035165-87035187 CTAAAATCAAGGTGTCAGCTAGG - Intronic
910448210 1:87320203-87320225 CTGAAATCAAGGTGTCACCTGGG + Intergenic
910552363 1:88490068-88490090 CTGAAATTAAGGTGTCAGCAAGG - Intergenic
910733781 1:90428865-90428887 CTGAAATCAAGCTGTCAGCAAGG - Intergenic
910960929 1:92762247-92762269 CTGAAATTTAGCTGTAAGGCAGG - Intronic
911232441 1:95375160-95375182 CTGAAATCAAGGTGTCGGCCAGG - Intergenic
911396255 1:97314558-97314580 CTGAAAGAACGCTGGCAGTCAGG - Intronic
911709567 1:101054426-101054448 CTGAAATCAAGGTGTCTGCAGGG - Intergenic
911923146 1:103792806-103792828 GTGAAATCAAGGTTTCAGTTGGG - Intergenic
912540934 1:110414796-110414818 CCAAAATCAAGGTGTCAGTGAGG - Intergenic
912598140 1:110900143-110900165 CTGCAATCAACATGTCAGCCTGG + Intergenic
912724688 1:112048465-112048487 CCCAACTCAAGCTGTCAGGCAGG - Intergenic
912992379 1:114501264-114501286 CTGCAGTCAAGATGTCAGCCAGG + Intronic
913022020 1:114797596-114797618 CTGAAATCAGGGTGTCAGCAGGG - Intergenic
914286955 1:146236060-146236082 CTGAAATCAAGGTGTCATCTGGG - Intergenic
914348490 1:146819981-146820003 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
914357901 1:146903821-146903843 CTGGAATCAAGTTGTCAGCCAGG + Intergenic
914409978 1:147417947-147417969 CTGAAAACAAGGTGTCAGCTGGG + Intergenic
914547988 1:148686802-148686824 CTGAAATCAAGGTGTCATCTGGG - Intergenic
915044027 1:152996557-152996579 CTGCAATAAAGGTGTCAGCCTGG + Intergenic
915503200 1:156334519-156334541 CTGAAATAAAGGCGTCAGTAGGG - Intronic
915886714 1:159730142-159730164 CTGAAATCAAGATGTGAGCAGGG - Intergenic
916264244 1:162874478-162874500 CTGAAATCAAGATGTTAGCAGGG + Intergenic
916273262 1:162967003-162967025 CTGAAATGAAGGTGTCAGCCAGG + Intergenic
916310669 1:163395354-163395376 CTAAGATCAAGATGTCAGTTGGG - Intergenic
916476418 1:165173643-165173665 CTGCAATCACGGTGTCAGCCAGG - Intergenic
916622812 1:166519419-166519441 CTGATACCAAGCTCTCACTCAGG + Intergenic
916822937 1:168417350-168417372 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
917129865 1:171730109-171730131 CTAAAATCAAGGTGCCAGTAGGG - Intronic
917233294 1:172861632-172861654 CTGTAATCAAGGTGTCAATAGGG - Intergenic
917419813 1:174851072-174851094 CTGAAATCAAGATGCCTGTTGGG - Intronic
917439332 1:175053156-175053178 CTGAGATAAAGGTGTCAGTAGGG + Intergenic
917514336 1:175694844-175694866 CTGAGATCAAGGTGTCAGCAGGG - Intronic
918014230 1:180617531-180617553 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
918021209 1:180693602-180693624 CTGAAATCAAGGTGTCTGCAGGG + Intronic
918098214 1:181351582-181351604 CTGAAGTCAAGGTGTCAGCTGGG + Intergenic
918157471 1:181863233-181863255 CTGAAATCAAGCTGTCAGCTGGG - Intergenic
918493495 1:185108803-185108825 CTGAAATCGAGGTGTCAGTAGGG + Intergenic
918529450 1:185502122-185502144 CTAAAATCAAGGTGTCAGTAGGG - Intergenic
918626989 1:186667225-186667247 CTAAAATCAAGATGTCAGCAGGG - Intergenic
918729331 1:187971211-187971233 ATAAAATCAAGATGTCAGCCGGG - Intergenic
918933304 1:190885974-190885996 CTGAAATTAAGATGTCATGCTGG + Intergenic
919202746 1:194378642-194378664 CTCTAATCAAGGTGTCAGCCAGG + Intergenic
919313084 1:195936541-195936563 CCGAAATCAAGATGTCAGCAGGG - Intergenic
919680709 1:200431858-200431880 CGGAAAGCAAGCAGTCAGTGAGG - Intergenic
919788141 1:201273273-201273295 CCAAAATCAAGGTGTCAGCCTGG + Intergenic
920163511 1:204018324-204018346 CTGAAATCAAGGTGGCAGCTGGG + Intergenic
920562660 1:206949912-206949934 CTGAAATCAAGGTGCCAGCAGGG + Intergenic
920760296 1:208777283-208777305 CTGAAGTCAAGATGTTAGCCAGG - Intergenic
920818549 1:209358324-209358346 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
920839611 1:209543317-209543339 CTGAAATCAAGGTGTTGGTAGGG - Intergenic
921017289 1:211203690-211203712 CTGAGATCAAGGTGTCAGCAGGG - Intergenic
921028891 1:211318955-211318977 CTGCAATCAAGCTGTTAGCTGGG - Intergenic
921298100 1:213723387-213723409 CTGAGATCAAGGTGTCAGCAGGG + Intergenic
921309808 1:213831487-213831509 CTGAAATCAAGGTGTCTGCAGGG - Intergenic
921421509 1:214954219-214954241 CTAAGATCAAGGTGTCAGTGGGG + Intergenic
921424083 1:214982433-214982455 CTGAGATCAAGCTGTCAGCAGGG - Intergenic
921540760 1:216411779-216411801 CTGAAATCAAGTTGTTAGAAGGG - Intronic
921544181 1:216454550-216454572 CTGCAGTCAAGGTGTCAGTGGGG + Intergenic
921590731 1:217000272-217000294 CTGAAATCAAGATGTCAGCAGGG + Intronic
921953492 1:220958081-220958103 CTGAAATCAAGGTGCCAGCATGG + Intergenic
922064740 1:222125843-222125865 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
922254950 1:223885665-223885687 TAGAAATCAAGGTGTCAGTTGGG - Intergenic
922326742 1:224535366-224535388 CTGAAGTCAAGGTGTCAGCAGGG - Intronic
922332169 1:224586948-224586970 CTAAAATCAAGGTGTCAGCAGGG - Intronic
922340287 1:224649367-224649389 CTAAAATCAAGGTGTCAGCAGGG - Intronic
922494274 1:226043653-226043675 CTGAAATCAAGGTGTCAGAAGGG + Intergenic
922548702 1:226477918-226477940 CTGAAATCAAGGCATCAGCCTGG - Intergenic
922954553 1:229588088-229588110 CTGCAATCAAGGTGTCAGCCAGG + Intergenic
923325848 1:232879399-232879421 CTGAAATCAAATTATCACTCAGG - Intergenic
923595413 1:235357569-235357591 CTGCAATCCAGGTGTCAGCCAGG + Intergenic
923775449 1:236974315-236974337 CCAAAATCAAGGTGTCAGTAGGG - Intergenic
923970267 1:239194042-239194064 CCAAAATCAAGATGTCAGTCAGG - Intergenic
924155288 1:241168983-241169005 CTGAAATGAAGATGTCAACCAGG - Intronic
924238732 1:242021378-242021400 CTAAAATCAAGGTGTCAGTGGGG + Intergenic
924757117 1:246951495-246951517 CTGAAATCAAGGTGTCAGCAGGG - Intronic
924879453 1:248144182-248144204 CTGAAATCAAGTTGTCAGCAGGG + Intergenic
924884706 1:248202119-248202141 CTGAAATCAAGATGTCACCAGGG + Intergenic
924894867 1:248325502-248325524 CTGAAATCAAGTTGTCAGCAGGG - Intergenic
1062845354 10:699135-699157 CTGAGATCCAGCTGTCAGCAGGG + Intergenic
1063730988 10:8696913-8696935 CTGCAATGAAGCTGTCAACCAGG - Intergenic
1063882872 10:10549249-10549271 CTGAGATCAAGGTGTCAGTAGGG + Intergenic
1064000050 10:11656111-11656133 CTAAAATCAAGGTGTCAGTAGGG - Intergenic
1064000208 10:11657560-11657582 CTAAAATCAAGGTGTCAGTAGGG - Intergenic
1064522731 10:16220290-16220312 CTGAAATCAAGGTGTTGGTAAGG - Intergenic
1064931839 10:20637247-20637269 CTAAAATCAAGCTATCAGGAAGG + Intergenic
1065032672 10:21603713-21603735 CTGAAATCAAGATATCAGCTGGG + Intronic
1065127704 10:22590152-22590174 CTGAGATCAAGGTGCCAGTATGG - Intronic
1065634543 10:27717193-27717215 ATGACATCAAGGTGTCATTCTGG - Intronic
1065642044 10:27793289-27793311 CTGAGATCAAGGTGTCAGCAAGG + Intergenic
1065871389 10:29959211-29959233 CTGAGATCAGGGTGTCAGTGTGG - Intergenic
1066069537 10:31792874-31792896 CTGAAATTAAACTGCCAATCTGG - Intergenic
1066087030 10:31981162-31981184 CTGCAATGAAGCTGTCAGCCAGG - Intergenic
1066589733 10:36981465-36981487 CTGAAATTAAGGTTTCAGTAGGG - Intergenic
1066610717 10:37245711-37245733 CTGCAATCAAGGTGTCAGCTGGG + Intronic
1066730134 10:38429588-38429610 CTGAAGTCAAGGTGTCAGAGGGG - Intergenic
1067179579 10:43974443-43974465 CTAAAATCAAGATGTCAGTGGGG - Intergenic
1067514246 10:46923243-46923265 CTTAAATCAAGGTGTCAGCAGGG - Intronic
1067648008 10:48128588-48128610 CTTAAATCAAGGTGTCAGCAGGG + Intergenic
1067950767 10:50736554-50736576 CTAAAATCAAGGTGTCAATTGGG + Intergenic
1067970784 10:50968116-50968138 CTCAACTCAAGCAGTCAGTCAGG - Intergenic
1068096164 10:52494109-52494131 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1068177646 10:53482481-53482503 CTGAAATGAAGGTGTCAGCAGGG - Intergenic
1068272301 10:54744262-54744284 CTAAAATCAAGGTGTCAATTGGG - Intronic
1068382912 10:56281910-56281932 CTGAAATCAAGGTATCAGCAGGG - Intergenic
1068525043 10:58118538-58118560 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
1068649584 10:59507203-59507225 CTAAAGTCAAGGTGTCAGCCAGG + Intergenic
1068831120 10:61496000-61496022 CTGAAATCAAGGTGTCTGAATGG - Intergenic
1068848184 10:61704564-61704586 TTTCACTCAAGCTGTCAGTCAGG - Intronic
1068859244 10:61830103-61830125 CTGAGATCAAGGTGTCAGTGGGG - Intergenic
1069175937 10:65288063-65288085 TTGAAATCAATGTCTCAGTCTGG - Intergenic
1069206937 10:65701369-65701391 ATGAAACCAAGGTGTCAGCCAGG + Intergenic
1069791771 10:71027234-71027256 CTGAAATCGAGGTGTCAGCAAGG - Intergenic
1069802719 10:71092098-71092120 CTGAAAACAAGGTGTCAGCAGGG - Intergenic
1069811243 10:71161429-71161451 CTGATATCAAGGTGTTAGTGGGG - Intergenic
1070246740 10:74739314-74739336 CTGAAATCAAGGTGGCAGCAGGG - Intergenic
1070266051 10:74904302-74904324 CTGAAATCAAAATGTCAGCAGGG + Intronic
1070310575 10:75270726-75270748 CTGAAATGAAGGTGTCAGCCCGG + Intergenic
1070362054 10:75700031-75700053 CTGAAATCAAGGTGACAGCAGGG - Intronic
1070390014 10:75961832-75961854 CCGAATTCAAGATGTCAGTCGGG + Intronic
1070396694 10:76017374-76017396 CTGAAATCAAGGTATCAGTAGGG - Intronic
1070406281 10:76100371-76100393 CTGAAATCAATCTGTGAGATGGG - Intronic
1070542044 10:77422872-77422894 CTTAAATCAAGATGTCAGCAGGG - Intronic
1070713509 10:78700747-78700769 CTGAAATCAAGGTGTCAGCCAGG - Intergenic
1070747504 10:78943399-78943421 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
1070886112 10:79901763-79901785 CTAAAATCAAGGTGTCAGTTGGG + Intergenic
1071003959 10:80860709-80860731 CTGAAATCAAGATGTGAGCAGGG - Intergenic
1071021157 10:81058810-81058832 CTGAAATCAAGATGTGGGTGGGG + Intergenic
1071315938 10:84398092-84398114 CTAAAATCAAGATGTCAGCAGGG + Intronic
1071385621 10:85117368-85117390 CTGAAATCAAGGTGTCAACAGGG + Intergenic
1071512893 10:86276159-86276181 CTGAAATGGAGGTGTCAGTAAGG + Intronic
1071674685 10:87644467-87644489 GTGCAATCAAGGTGTCACTCAGG + Intergenic
1071705473 10:87993537-87993559 CTGCTATCCAGCTGTCATTCTGG + Intergenic
1071730959 10:88247984-88248006 CTCACATCAAGGTGTCAGTAGGG - Intergenic
1071755589 10:88535336-88535358 CTGAAACCAAGAAGGCAGTCTGG + Intronic
1071969692 10:90891160-90891182 CTGAAATCAAGGTGTCAGCATGG + Intronic
1071974819 10:90944906-90944928 CTGAGATCAAGGTGTCAGTGGGG - Intergenic
1072042096 10:91617258-91617280 TTGTAATCAAGATGTCAGGCAGG + Intergenic
1072069338 10:91901189-91901211 CTGGAATCAAGCTGCCAGCAAGG + Intergenic
1072232294 10:93424075-93424097 CTGAAATCAAGGTGTCAGCAGGG - Intronic
1072300600 10:94057794-94057816 CTAAAATCAAGGTGTCAGCTGGG + Intronic
1072527338 10:96285047-96285069 CTGAAATCAAGGTGTCAGTAGGG + Intergenic
1072759864 10:98047606-98047628 TTGAAGTCAAGATGTCAGCCAGG - Intergenic
1073474193 10:103742201-103742223 CTGAAATCAAGGTGCCAGCAGGG + Intronic
1073694503 10:105849742-105849764 CTGAGATCAACCTGCCAGGCTGG + Intergenic
1073768805 10:106712285-106712307 CAGAAAGCAAGTTGTCAGTTAGG + Intronic
1074129008 10:110556657-110556679 CTGAAATCAAGGTGTTAGCCAGG + Intergenic
1074181458 10:111068581-111068603 CTGAAATCAAGGTATCAGTGGGG - Intergenic
1074290176 10:112132452-112132474 CTGAAATCAAGGTGTCGGCAGGG + Intergenic
1074590573 10:114809030-114809052 CTGAAATGAAGGTGTCAGCAGGG - Intergenic
1074606829 10:114980208-114980230 CTGAGATCAGGGTGTCAGTGTGG + Intergenic
1074629309 10:115232953-115232975 CTGAAATCCAGGTGTCAGCAGGG + Intronic
1074688954 10:115986228-115986250 CTAAAATCAAAGTGTCAGCCAGG - Intergenic
1074702667 10:116106176-116106198 CTGAAATCAAGGTGTCAGCAGGG - Intronic
1074857952 10:117487207-117487229 CTGAAATCCAGGTGTCAGTAGGG + Intergenic
1074987991 10:118674268-118674290 CTGTGATCAAGGTGTCAGCCAGG + Intronic
1075125826 10:119698128-119698150 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
1075191615 10:120314907-120314929 CTGAAGTCAAGGTGTCAGCAAGG + Intergenic
1075610639 10:123852069-123852091 CTGAAATCAAGGTGTTAGCAGGG - Intronic
1075803858 10:125171075-125171097 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1075813961 10:125250117-125250139 TTGAAATCAAGTTGTCAGCGGGG + Intergenic
1075911031 10:126126002-126126024 CTGAAATCAAGGGGTCAGCAGGG - Intronic
1076267799 10:129122732-129122754 CTGTGATCAAGGTGTCAGCCAGG + Intergenic
1076375056 10:129978077-129978099 CTGAAATCATGCTGTCAGCCTGG - Intergenic
1077288133 11:1776621-1776643 CTGAAATCGAGGTGTCAGCAGGG + Intergenic
1077294356 11:1818101-1818123 TTGAGATCAAGCTGTCAGCCAGG - Intergenic
1077446958 11:2599636-2599658 CTGAGATCAAGGTGTCAGCAAGG + Intronic
1078120742 11:8506469-8506491 CTAAAATCAAGGTGTCAGCGGGG + Intronic
1078415311 11:11160094-11160116 CTAAAATCAAGGTGTCTGTGGGG + Intergenic
1078642836 11:13112355-13112377 CTGAGATCAAGGTGTCAGCAGGG - Intergenic
1078930578 11:15909433-15909455 ATAAAATCAAGCTGTCAGCAGGG - Intergenic
1079109316 11:17595524-17595546 CTGCAATCAAGGTGTCAGCTAGG + Intronic
1079541458 11:21580869-21580891 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1079729937 11:23927937-23927959 CTGAAATCTTGGTGTCAGCCAGG + Intergenic
1079860136 11:25658970-25658992 CTAAAATCAAGGTGTCAGGTGGG - Intergenic
1079870061 11:25786238-25786260 CTAAAATAAAGGTGTCAATCAGG + Intergenic
1079981262 11:27153777-27153799 CTAAAATCAAGATATCAGCCGGG - Intergenic
1080045706 11:27805496-27805518 CTGAAATCAAGGTGTCGGCAGGG - Intergenic
1080087305 11:28299797-28299819 CTGAAATCAAGATGTTAGAAGGG + Intronic
1080091893 11:28358252-28358274 GTAAAATCAAGGTGTCAGCCAGG - Intergenic
1080114388 11:28605933-28605955 ATGAAATCAAGGTGTTAATCAGG + Intergenic
1080207461 11:29747239-29747261 CTGAAATCAGGATGCCAGTATGG + Intergenic
1080228414 11:29987117-29987139 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
1080344974 11:31314517-31314539 CTGAAATCAAGGTGTCAGCTGGG + Intronic
1080391862 11:31855404-31855426 CTGAAATCAAGGTGTCAGTAAGG - Intronic
1080403862 11:31961224-31961246 CTAAAATCAAGGTGTCGGCCGGG + Intronic
1080420541 11:32106211-32106233 CTGAAGTCAAGGTGTCAGCAGGG + Intergenic
1080600170 11:33814891-33814913 CTGCAATCAAGGTGTCAGCCTGG - Intergenic
1080657402 11:34268707-34268729 CTGAAATCAAGGTGTCGGCAGGG + Intronic
1080688284 11:34534091-34534113 CCAAAGTCAAGGTGTCAGTCTGG - Intergenic
1080707994 11:34717023-34717045 TTGAAATCAAGGTGTCAGCAAGG + Intergenic
1080769894 11:35330845-35330867 CTAAAATCAAGGTGTCAGCAGGG - Intronic
1080847958 11:36042868-36042890 CTGAAATCAAGGTGTTAGCAGGG - Intronic
1080863113 11:36167695-36167717 CTGCAATCAAGCTGTCAGCAGGG - Intronic
1080922890 11:36726452-36726474 CTGAAATCAGGGTGTCAGCAAGG - Intergenic
1080997086 11:37617334-37617356 CTGAAATCAAGTTGTCAACAGGG - Intergenic
1081109014 11:39108523-39108545 CTGGAATCAAGTTGTCAGCAAGG + Intergenic
1081340931 11:41926632-41926654 CTGAAATCAAGGTGTCAACAGGG - Intergenic
1081486252 11:43531915-43531937 CTGAAATCAAGCTGTAGGCAGGG - Intergenic
1081601897 11:44501125-44501147 CTGATATCAAGGTGTCAGCAGGG - Intergenic
1081614650 11:44583483-44583505 CTGAAAGGAAGCTGAGAGTCAGG + Intronic
1081732620 11:45382175-45382197 CTGAAATCGAGGTGTCAGCAGGG + Intergenic
1082101101 11:48173599-48173621 CTGCAGTCAAGCTGTCGGCCAGG - Intergenic
1082664899 11:55963519-55963541 CTGAAATCAAGGTATCAGCTAGG - Intergenic
1083055913 11:59819526-59819548 CTGAAATCAAGGTGTCTGCAGGG - Intergenic
1083055959 11:59819986-59820008 CTGAAATCAAGGTGTCTGTGGGG + Intergenic
1083058665 11:59847300-59847322 CTGCAATCAAGATGTCAGCTGGG - Intergenic
1083141223 11:60723367-60723389 CTGAGATCAAGGTGTCAGCAGGG + Intergenic
1084404704 11:68964609-68964631 CTGAGATCAAGGTGTCAGCAGGG + Intergenic
1084417509 11:69041745-69041767 TTGTAATCAAGGTGTCAGCCAGG - Intergenic
1084532844 11:69738996-69739018 TTGAAATCAAGATGTCAGCTAGG - Intergenic
1084537057 11:69763513-69763535 CAGAAATCAAGGTGTCAGCAGGG - Intergenic
1084636135 11:70394132-70394154 CTAAAGTCAAGGTGTCAGTGGGG - Intergenic
1084669342 11:70596087-70596109 CTGAAACCAAGGTGTCAGCTGGG - Intronic
1084696685 11:70759966-70759988 CTGAAATCAAGGTGTCTGCAGGG - Intronic
1084725654 11:70940100-70940122 CTGAAATCAAGGTGTGGGTGGGG - Intronic
1084780591 11:71405658-71405680 CTGAAAGCAAGGTGTCAGCAAGG - Intergenic
1085393723 11:76195541-76195563 CTGAAATCGAGGTGTCAGCAGGG - Intronic
1085823488 11:79818066-79818088 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1085898337 11:80666555-80666577 CTGAAATTAAGGTTTCAGTGGGG + Intergenic
1086170926 11:83835748-83835770 CTGAAGTCAAGGTGTCAGCCAGG + Intronic
1086912399 11:92488286-92488308 CTGCAATCAAAGTGTCAGACAGG - Intronic
1086934362 11:92728681-92728703 CTGAAATGAAGGTGTCAGCAGGG + Intronic
1086943352 11:92820667-92820689 TTGCAGTCAAGCTGTCAGGCAGG - Intronic
1087056868 11:93945311-93945333 CTGAAATCAAGGTGTCATCTGGG + Intergenic
1087233388 11:95691527-95691549 CTGAAATCAGGGTGTTAGACTGG - Intergenic
1087254754 11:95940946-95940968 CTGAAATCAAGGTGTTGGACAGG + Intergenic
1087857093 11:103105088-103105110 CATAAATCAAGATGTCAGCCAGG - Intergenic
1088120192 11:106360180-106360202 CTGAAATCAAGAGGTCAGCAGGG - Intergenic
1088341808 11:108776940-108776962 CTGAAATCAAAATGTCAGCTGGG - Intronic
1088572503 11:111236708-111236730 CTAAAATCAAGGTGTCAGCTGGG + Intergenic
1088622652 11:111702287-111702309 ATTAAATTAATCTGTCAGTCAGG + Intronic
1088831840 11:113543532-113543554 CTGAAATCAAGGTGTCAGTTGGG + Intergenic
1088844301 11:113651985-113652007 CTGAAATAAAGATGCTAGTCCGG - Intergenic
1089126544 11:116180505-116180527 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
1089158470 11:116420285-116420307 GTGAAATCCAGGTGTCAGCCAGG + Intergenic
1089746704 11:120622704-120622726 CTGCAATCAAGTTGTCAGCAGGG + Intronic
1089839758 11:121405622-121405644 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
1089907847 11:122063168-122063190 CTGAAATCAAGCTGTTGGCATGG - Intergenic
1090011399 11:123048796-123048818 CTGACATCAAGGTGTCAGTAGGG - Intergenic
1090177664 11:124665503-124665525 CTGAAATCAAGGTGTAGGCCAGG - Intronic
1090201475 11:124860897-124860919 CTGAAATCAAGGTGTCAGCTGGG - Intergenic
1090286047 11:125500268-125500290 CCAAAATCAAGCTGTCAGCAGGG - Intergenic
1090320503 11:125839048-125839070 CTTAAATCAAGGTGTCAGCAGGG - Exonic
1090403660 11:126464771-126464793 CTGGAATCAAGGTGTCAGCAGGG - Intronic
1090424839 11:126600297-126600319 CTGCAATCAAGATGTAAGTCAGG - Intronic
1090563322 11:127957991-127958013 CTAAAATCAAGGTGTCAATAGGG + Intergenic
1090695300 11:129235142-129235164 CCGAAATCAAGATGTCAGCAGGG - Intronic
1090822753 11:130359040-130359062 CTGAGATCAACATGTCAGTAGGG + Intergenic
1090987231 11:131779235-131779257 CTGAAATCAAGGTGTCAGCCAGG - Intronic
1091392753 12:135870-135892 CTGAAACCAAGATATCAGTCAGG - Intronic
1092096458 12:5846593-5846615 CTGAAATCAAGGTATCAGTGGGG + Intronic
1092480301 12:8853518-8853540 TTGCAATCAAGCTGTCAGTCAGG + Intronic
1092695475 12:11166810-11166832 CTAAAATCAAGGTGTCAGCAAGG + Intronic
1092853779 12:12654090-12654112 CTGCAATCAAGGTGTCAACCAGG - Intergenic
1093117796 12:15233469-15233491 CCAACAACAAGCTGTCAGTCTGG - Intronic
1093377992 12:18454977-18454999 CTGTAATCAAGGTGTCAACCTGG + Intronic
1093656673 12:21702390-21702412 CTGAAATCAAGGTGTCAGCCAGG - Intronic
1093817556 12:23568296-23568318 CTGAAGTCAAGGTGTCAGCAGGG - Intronic
1094054202 12:26251869-26251891 CTGCAATCAAGGAGTCAGCCAGG - Intronic
1094146356 12:27232448-27232470 CTGAGATCAAGGTGTCAGAAGGG + Intergenic
1094228477 12:28075065-28075087 CTGAAATCAAGATGTCAGCTGGG - Intergenic
1094558618 12:31528172-31528194 CTGAAATCAAGGTGTCAGCAAGG + Intronic
1095342500 12:41108138-41108160 CTGAAATCAAGGTGTCAGTCAGG + Intergenic
1095399909 12:41802045-41802067 CTGAAATCAAGGTGTTAGCAAGG - Intergenic
1095454207 12:42365069-42365091 CTGAACTCAAGCAGGCAGACAGG + Intronic
1095545454 12:43362946-43362968 CTAAAATCAAGCAGTCAGCAGGG - Intronic
1095671029 12:44860456-44860478 CAGACATCAAGGTGTCAGTAGGG + Intronic
1095721307 12:45404486-45404508 CTAAAATCAAGGTGTTAGTGGGG + Intronic
1095735174 12:45548331-45548353 CTAAAATCAAGATGTCAGCAGGG - Intergenic
1095900172 12:47319869-47319891 AGGAGATGAAGCTGTCAGTCAGG - Intergenic
1095913255 12:47449975-47449997 TTGAAGTTAAGATGTCAGTCAGG - Intergenic
1096943116 12:55371559-55371581 CTGAAATCAAGGTGACAGCAGGG + Intergenic
1096998573 12:55856409-55856431 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1097408276 12:59218879-59218901 CTGCAATCAAGATGTTAGCCAGG + Intergenic
1097445845 12:59670046-59670068 CTGAAATCAAGGTGTCAGCTGGG + Intronic
1097574431 12:61373620-61373642 CTGAGATCAAGGTGTTAGTAGGG + Intergenic
1097589548 12:61557397-61557419 CTGAAATCAATGTGTCAGCAAGG - Intergenic
1097632393 12:62079992-62080014 CTAAAATCAAGGGGTCAGCCAGG + Intronic
1097763409 12:63494891-63494913 TTAAAATCAAGCTGTCAATAAGG + Intergenic
1098295665 12:69001574-69001596 CTGCAAGCAAGGTGTCAGCCAGG - Intergenic
1098332737 12:69371857-69371879 CTGATATCAAAATGTCAGTCAGG + Intronic
1098472515 12:70861892-70861914 CTGAACTCAAGTTTACAGTCTGG - Intronic
1098999004 12:77154969-77154991 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
1099011909 12:77301504-77301526 GTGAAATCAAGGTGTCAGCAGGG - Intergenic
1099023457 12:77435761-77435783 CTGAAATCAGGATGTCAGGTGGG + Intergenic
1099147958 12:79071603-79071625 CCAAACTCAAGATGTCAGTCAGG + Intronic
1099164186 12:79281900-79281922 CTGAAATCAAGGCGTCAGCAGGG + Intronic
1099331725 12:81297201-81297223 CTGCAATCAAGGTATCAGCCAGG - Intronic
1099391649 12:82087851-82087873 TTGAAATCAGGTTGTCAGCCAGG - Intergenic
1099486990 12:83241037-83241059 CTGAAATAAAGATGTCAGCTAGG + Intergenic
1099595115 12:84652792-84652814 CTAAAATCAAGATGTCAGTGAGG + Intergenic
1099652667 12:85448148-85448170 CTGAAATGAAGAGGTCAGTAGGG + Intergenic
1099656285 12:85496284-85496306 CTGAACTCAAGGTGTCAATCAGG + Intergenic
1099754915 12:86833452-86833474 CTGAAATGAAGGTGTCAGCAGGG + Intronic
1099842035 12:87977871-87977893 CTGAAATCAAGTTGCTAGTAGGG - Intergenic
1100009606 12:89937679-89937701 CTGAAATCAGGATGTCAGCAGGG + Intergenic
1100043624 12:90351486-90351508 CTAAAATCAAGATTTCAGTGGGG - Intergenic
1100383501 12:94084345-94084367 CTGAAATCAAGGGGTCAGCAAGG + Intergenic
1100443215 12:94636885-94636907 CTGAAATCAAGGTGTCAACCAGG - Intronic
1100673735 12:96844461-96844483 CTAAAGTCAAGGTGTCAGCCGGG - Intronic
1100792881 12:98150007-98150029 CAGAAATCAAGGTGTCAGCTGGG + Intergenic
1100966654 12:100020746-100020768 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
1101191228 12:102335548-102335570 CTAAAATCAAGGTGTCAGTAAGG + Intergenic
1101364713 12:104061105-104061127 CTGAAATCAAAGTGTCAGTAGGG - Intronic
1101373115 12:104148010-104148032 CTGCAATCAAGCTATCAGCTGGG - Intergenic
1101448038 12:104752100-104752122 CTGAAATCAAGCTGTTGGCAGGG + Intronic
1101517968 12:105454539-105454561 CTGTAATCAAGGTGTCAGGCAGG + Intergenic
1101578838 12:106023194-106023216 CTGTAATCAACATGTCAGCCAGG - Intergenic
1101853322 12:108421908-108421930 CTGAAATCAAGGTGTTGGCCTGG + Intergenic
1101964862 12:109275527-109275549 CTAAAATCAAGGTGTCAGTGGGG + Intergenic
1102014171 12:109636904-109636926 CTGAAATCAAGATGTCAACAGGG + Intergenic
1102495373 12:113315706-113315728 CTGAAGTCAAGTTGTCAGCAGGG + Intronic
1102588308 12:113938875-113938897 CTGAAATCAAGGTGTCAGCAGGG - Intronic
1102617510 12:114167414-114167436 CTGAAATCAAGGTGTTAGCTGGG - Intergenic
1102722810 12:115032757-115032779 CTGAGATCGAGCTGTCAGTAGGG - Intergenic
1102809721 12:115813924-115813946 CTGAAATCAAGATGTCAACAGGG + Intergenic
1102935247 12:116891073-116891095 CTGAAGTCAAGATGTCAGTAGGG - Intergenic
1103061854 12:117864615-117864637 TTGAAATCAAGGTGTCGGTGAGG + Intronic
1103196317 12:119046370-119046392 CTGAAATAAGTCTGGCAGTCTGG + Intronic
1103578069 12:121893536-121893558 CTGAAATCAAGGTGTCAGCAGGG + Intronic
1103734682 12:123052366-123052388 CTGAAATGAAGGTGTCAGTAAGG + Intronic
1104077094 12:125399585-125399607 CTGAAATCAAGGTGTTGGTAGGG - Intronic
1104092891 12:125530589-125530611 CTGAAATCAAGGTGTTAGCAGGG + Intronic
1104096615 12:125563933-125563955 CTGAAATCAGGGTGTCAGCAGGG - Intronic
1104254760 12:127126326-127126348 CTGAAATCAAGCTATCAGCAGGG + Intergenic
1104254837 12:127126950-127126972 CTGAGATCAAGGTGTCTGTAGGG + Intergenic
1104366753 12:128184955-128184977 CTGAAGTCAAAGTGTCAGTAAGG - Intergenic
1104515221 12:129419028-129419050 CTGAAATCAAGGTGTCAGCGGGG - Intronic
1104525475 12:129516818-129516840 CTGAAATCAAGGTGTTGGCCAGG + Intronic
1104698529 12:130883138-130883160 CTGAAATCAGGGTGTCAGCAGGG + Intergenic
1105061325 12:133153803-133153825 CTAAAATGAAGATGTCAGTGGGG + Intronic
1105387288 13:19943034-19943056 CTGAAATCAAGGTGTTAGCTGGG + Intergenic
1105442335 13:20425832-20425854 CTGATCTCATGCTGTCAGCCAGG - Intronic
1105634652 13:22205361-22205383 CTGAGATCAAGGTGTCTGTAGGG + Intergenic
1106404663 13:29463235-29463257 CTCAAATCAAGGTGTCAGCAGGG - Intronic
1106589503 13:31087352-31087374 CTGAAATCAGGGTGTCAGCAGGG + Intergenic
1106662758 13:31818733-31818755 CTGAAATCAAAGTGTCAGCAAGG + Intergenic
1106773953 13:32990626-32990648 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1106844190 13:33720082-33720104 CTAAACTCAAGGTGTCAGTAGGG + Intergenic
1106873340 13:34045139-34045161 CTGAGTTCAAGATGTCAGTAGGG - Intergenic
1107619091 13:42206587-42206609 CTAAAATCAAGGTGTCAGCTGGG + Intronic
1107697061 13:43010824-43010846 CCCAAATCAAGGTATCAGTCAGG - Intergenic
1107711319 13:43153128-43153150 TTGAAATCAAGGTGTCAGCAGGG + Intergenic
1107799352 13:44089719-44089741 CTAAAATCAAGGTGTCAGCAAGG + Intergenic
1107808874 13:44180310-44180332 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1108047453 13:46396655-46396677 CTAAAATCAAGGTGTCAGTGGGG - Intronic
1108242077 13:48475335-48475357 CTGTGATCAAGGTGTCAGTTGGG + Intronic
1108263938 13:48685445-48685467 CTGTAATCAAGGTGTCAGCAGGG - Intronic
1108465873 13:50714944-50714966 CTGAAATCAAGGTGTTGGCCAGG + Intronic
1108537884 13:51404878-51404900 CAGAAATCAAGCTATAACTCAGG + Intronic
1108564276 13:51679732-51679754 CTGAAATCAGGGTGTCAGGAGGG + Intronic
1108614327 13:52116564-52116586 TTGAAATCAAGGTGTCAGCTGGG - Intronic
1108801152 13:54096307-54096329 TTGAAATCTTGCTGACAGTCTGG - Intergenic
1108856131 13:54794948-54794970 CTGAAATCAAGGTGTCAACAGGG - Intergenic
1108860543 13:54853415-54853437 ATGAAATAAAGCTGTCAGTGAGG + Intergenic
1109134555 13:58630485-58630507 CTAAAATCAAGGTGTAAGCCAGG - Intergenic
1109280662 13:60351417-60351439 CTGCAATCAAGATGTCAGCTGGG + Intergenic
1109391158 13:61695458-61695480 CTGTAATCTAAGTGTCAGTCTGG - Intergenic
1109470095 13:62792505-62792527 CTGAAACCTAGCTGTCAGCAGGG - Intergenic
1109640011 13:65179363-65179385 CTGAAATCTAGTTGTCAGCAGGG - Intergenic
1109810305 13:67504790-67504812 TTGGAATCAAGCTGTCAGCAGGG + Intergenic
1109973740 13:69803913-69803935 CTGAAATCAAGGTGTTAGCTAGG - Intronic
1110105805 13:71674611-71674633 CTGAAATCATGGTGTCAGCAGGG - Intronic
1110156386 13:72321883-72321905 CTGAAACCAAGGTGTCTGTAGGG - Intergenic
1110278434 13:73664239-73664261 CTGAAATGAAGGTGTCAGCCAGG + Intergenic
1110280858 13:73692966-73692988 TTTAAACCAAGCTGTCACTCAGG + Exonic
1110384263 13:74890496-74890518 CCAAAATCAAGATGTCAGTAGGG - Intergenic
1110397361 13:75046812-75046834 CTGAAATTAAGGTATCAGTCAGG - Intergenic
1110452946 13:75657221-75657243 CTGAAATCAAGGTGTCAGCATGG - Intronic
1110535587 13:76647260-76647282 CTGAAATCAAGGTGTCGGCAGGG - Intergenic
1110593646 13:77293859-77293881 CTAAAATCAAGGTGTCAGCAAGG - Intronic
1110750786 13:79113218-79113240 CTGAGATCAAGGTGTCAGTAAGG + Intergenic
1110760241 13:79223151-79223173 CTGAAATCAAGCTGTTGGCTGGG - Intergenic
1110838332 13:80110619-80110641 CTAAAATCAAGGTGTTAGCCAGG - Intergenic
1110962116 13:81639796-81639818 CTGAAATCAAGGTCTCAGTTGGG + Intergenic
1110994617 13:82090962-82090984 CTGAAATCAAAATGTCAGCAGGG + Intergenic
1111005696 13:82245303-82245325 CTAAAGTCAAGGTGTCAGTCGGG + Intergenic
1111216420 13:85148275-85148297 CTGCAATCAAGGTATCAGCCAGG - Intergenic
1111231611 13:85351308-85351330 CTTAAAGCAAGTTGTCAGTCAGG - Intergenic
1111440297 13:88273786-88273808 CTGCAATCAAGACGGCAGTCGGG - Intergenic
1111575571 13:90150219-90150241 CTGAAATAAAGGTGTTAGTAGGG + Intergenic
1111676071 13:91390512-91390534 CTGAAATCAAAATGTCAGCAGGG + Intergenic
1111691244 13:91565820-91565842 CTGAAATCCAGGTGTCTGTGGGG + Intronic
1111917940 13:94381329-94381351 CTGAAATCAAGGTGTCGGCGGGG + Intronic
1111967814 13:94878582-94878604 TTGAAATCAAGTTGTCAGCAGGG - Intergenic
1112090676 13:96079979-96080001 CTAAAATCAAGGTGTCAGCTGGG + Intergenic
1112122466 13:96428429-96428451 CTGAAATCAGGGTGTCAGCAGGG + Intronic
1112143566 13:96673005-96673027 CTGAAATCAAGATGTCAACAGGG + Intronic
1112287425 13:98116621-98116643 CCAAAATCAAGGTGTCAGTAGGG - Intergenic
1112378132 13:98862871-98862893 CCAAAATCAAGGTGTCAGTGGGG - Intronic
1112631284 13:101163840-101163862 CTGAGATCAAGATGTCAGCAAGG + Intronic
1112842180 13:103593636-103593658 CTAAAGTCAAGATGTCAGCCAGG - Intergenic
1113084282 13:106551659-106551681 CTGAAAGCAAGGTGTCAGAAGGG + Intronic
1113135344 13:107082959-107082981 CTGAAATCAAGGTGTCTGTAGGG - Intergenic
1114139888 14:19897671-19897693 CTGAGATCAGACTGCCAGTCTGG + Intergenic
1114356964 14:21921219-21921241 CTGAAATCAAGGAGTCAGTAAGG + Intergenic
1114373058 14:22111306-22111328 CTGAAATTAAGGTGTCAGCAGGG - Intergenic
1114402232 14:22420566-22420588 TTGAAATCAAGGTGTCAGCAGGG - Intergenic
1114541243 14:23461116-23461138 CTGAAATCAAGGTGTCAACAGGG - Intergenic
1114666770 14:24382124-24382146 CTGAAATCAAGCTGTTGGCAGGG + Intergenic
1114699692 14:24664457-24664479 CCAAAATCAAGGTGTCAGCCAGG - Intergenic
1114788257 14:25625697-25625719 CTGAACTCAAGCGATCTGTCTGG + Intergenic
1114803498 14:25806476-25806498 CTGAAATTAAAGTGTCAGTAGGG + Intergenic
1114888327 14:26883320-26883342 TTGAAATCAAGATGTCAGCAGGG - Intergenic
1115162551 14:30412218-30412240 CTAAAATTAAGGTGTCAGTGAGG + Intergenic
1115306542 14:31939371-31939393 CTGAGATCAAGGTGTCAGCAGGG - Intergenic
1115324656 14:32126281-32126303 CTGAAAGCAAGGTGTCAGCAGGG + Intronic
1115475299 14:33807698-33807720 CTGAAATCAAGGTGCCAGCAAGG + Intergenic
1115762915 14:36593621-36593643 CTGAAATCAAGATGTCGGCAGGG + Intergenic
1116028978 14:39548095-39548117 ATAAAATCAAGCTGTCATCCAGG - Intergenic
1116229245 14:42194768-42194790 CTAAAATCAAGGTGTCAGCAAGG + Intergenic
1116448188 14:45036699-45036721 CTGAAATCAAAGTATCAGCCAGG + Intronic
1116512513 14:45764499-45764521 CTGAAATCAAGGTGTTGGTCAGG + Intergenic
1116548094 14:46197276-46197298 CTGAAATCAAGGTGTCAGGCAGG + Intergenic
1116596555 14:46855637-46855659 CTAAAATCAAGATGTCAGCAGGG - Intronic
1116643892 14:47501792-47501814 CTGAAATCAAGGTTTCAGCAAGG - Intronic
1116871273 14:50071025-50071047 CTGAAATCAAGGTGTCGGCAGGG + Intergenic
1117034711 14:51716076-51716098 ATGAAATAAAGCAGTCTGTCTGG + Intronic
1117250443 14:53931701-53931723 CTGAGATCAAGCTATCAGCAAGG + Intergenic
1117270732 14:54140717-54140739 CTGAAATCAAGATGTCAGCCAGG - Intergenic
1117483759 14:56173596-56173618 CTGAAATCAAGGTGTCGGCAGGG + Intronic
1117762455 14:59044766-59044788 CAGCAATCAAGGTGTCAGACAGG + Intergenic
1117799824 14:59431686-59431708 CTAAAATCAAGGTGTCAGCAGGG - Intronic
1117965868 14:61206246-61206268 CTGAAATCAAGGTGTCATCCGGG + Intronic
1118046691 14:61977897-61977919 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1118421837 14:65614522-65614544 CTGAAACCAAGATGTCAGGAGGG + Intronic
1118467272 14:66042351-66042373 CTGAAAACAAGGTGTCAGCAGGG + Intergenic
1118519153 14:66561828-66561850 CTAAAATCAAGGTGTCAATAGGG + Intronic
1118886494 14:69871101-69871123 TTGCACTCAAGCTGTCAGCCAGG - Intronic
1118912290 14:70071640-70071662 CTGAAATCAAGGTGTTGGCCAGG - Intronic
1119026823 14:71159452-71159474 CTGCAGTCATTCTGTCAGTCGGG + Intergenic
1119165328 14:72487725-72487747 CTAAAATCAAGGTGTCAGCAGGG - Intronic
1119337494 14:73846311-73846333 CTGTAATCAAGCTGCCAGTCTGG - Intergenic
1119603226 14:75991800-75991822 CTGAAAGCAAGATGCCAGTTAGG + Intronic
1119684732 14:76622633-76622655 CCAAAATCAAGGTGTCAGTAGGG + Intergenic
1119689586 14:76661078-76661100 ATGAAGTCAAGGTGTCAGTAGGG + Intergenic
1119767971 14:77202462-77202484 CTGAAATCAAGGTGTCAGCAGGG + Intronic
1119880000 14:78092406-78092428 CTGAAGTCAAACTGGCAGGCTGG - Intergenic
1119993330 14:79224883-79224905 CTGAAATCAAGATGTGAGCATGG - Intronic
1120113741 14:80589208-80589230 CTAAAATCAAGATGTCAGCTGGG - Intronic
1120216853 14:81689737-81689759 CTGCATTCAAGGTGTCAGTCAGG - Intergenic
1120248984 14:82038967-82038989 CTGTAATCAAGGTGTCAGCTTGG + Intergenic
1120424861 14:84334410-84334432 CTGAAATCAGGATGTCAGCAGGG + Intergenic
1120536698 14:85705280-85705302 CTGAGATCGAGGTGTCAGTAGGG + Intergenic
1120607520 14:86597522-86597544 CTGACATCAAGGTGTCAGCTGGG + Intergenic
1120818972 14:88894462-88894484 CTGAAATCAAGGTATCAGCAAGG + Intergenic
1120838512 14:89062486-89062508 CTAAAATCAAGGTGTCAGTGGGG - Intergenic
1121013962 14:90537099-90537121 GTCAAATCAAGCTTTCAGTGGGG - Exonic
1121160127 14:91730400-91730422 CTGAGATCAAGGTGTCTGTAGGG - Intronic
1121173980 14:91876731-91876753 CTGAAATCCAGGTGTCAGCAGGG - Intronic
1121251760 14:92505040-92505062 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
1121319454 14:92982578-92982600 CTGAAATCAAGGTGTCCGCAGGG - Intronic
1121476200 14:94206891-94206913 CTGAAGTCAAGATGTCAGCAGGG + Intronic
1121542290 14:94737492-94737514 CTGAGATCAAGGTGTCAGAAGGG - Intergenic
1121624238 14:95372870-95372892 CTGAGATCAAGGTGTCAGCTGGG - Intergenic
1121660150 14:95628958-95628980 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
1121683771 14:95816590-95816612 CTGAAATCAAGGTGTCCGGCAGG + Intergenic
1121929431 14:97958896-97958918 CTCAAATCAAGATGTCAGAAGGG - Intronic
1122018950 14:98820554-98820576 CTAAAATCAAGTTGTCAGCAGGG - Intergenic
1122253564 14:100459747-100459769 CTGAAATCAAGCTGTTGGCAGGG - Intronic
1122615869 14:103017496-103017518 CTGAAATCAAGCAATCAGAGCGG + Intronic
1122823192 14:104357258-104357280 CTGAAATCAGGCTGCCAGCAGGG - Intergenic
1124173023 15:27393827-27393849 CTGAAATCAAGGTATCAGCGGGG - Intronic
1124342364 15:28898130-28898152 CTGAAATCAAGCTGTTGGCAGGG - Intronic
1124926398 15:34074463-34074485 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1125400378 15:39295907-39295929 CTGAAATCAAGGTGTTAGAAGGG + Intergenic
1125457105 15:39870970-39870992 CTGAAATGAAGGTGTCAGTGGGG - Intronic
1125459223 15:39892789-39892811 CTGAAATCAAGCTGCCGGCAGGG - Intronic
1125787919 15:42338700-42338722 ATGAAATCAAGTTGTCAGAAAGG + Intronic
1125788533 15:42344239-42344261 CTGAAATCAAGGTGTCATCAGGG + Intronic
1126681082 15:51202747-51202769 CTGAAATCAAGGTGTCGGCATGG - Intergenic
1126790475 15:52217000-52217022 CTGAAGTCAAGGTGTCAGCAGGG - Intronic
1126891202 15:53206270-53206292 CTGAAATCAAATTGTCAGCAAGG + Intergenic
1127048788 15:55057634-55057656 CTGAAATCAAAGTGTCAGCAGGG - Intergenic
1127718756 15:61678821-61678843 CTGAAATCAACATGTCAGCAGGG - Intergenic
1127989982 15:64106836-64106858 CTAAAATCAAGGTGTCAGTAGGG - Intronic
1128207657 15:65867701-65867723 CTAAAATCAAGTTGTCAGCAGGG + Intronic
1128313080 15:66643879-66643901 CTGAGATCAAGGTGTCAGCAGGG - Intronic
1128593912 15:68928039-68928061 CTACAATCAAGATGTCAGCCGGG + Intronic
1128749160 15:70136353-70136375 CTGAGATCAAGATGTCAGCAGGG - Intergenic
1128879302 15:71228386-71228408 CTGAAATCAAGGTGGCAGCAGGG - Intronic
1129225266 15:74166595-74166617 TTGAAATCAAGGTGTCAGCAGGG + Intergenic
1129705141 15:77790071-77790093 CTGAAATCAAGGTGTCGGCAGGG - Intronic
1129952165 15:79601471-79601493 CAGAAATCAAGGTGTCAGCTGGG + Intergenic
1129958835 15:79664788-79664810 CTGAAAACAAGGTGTCAGCACGG + Intergenic
1130013081 15:80167232-80167254 CTGCAATCAAGGTGTCAGTAAGG + Intronic
1130089623 15:80809637-80809659 CTGAAATCAAGGTGTTGGCCAGG + Intronic
1130222312 15:82030033-82030055 CTGAGATCAAGGTGTCAGCAGGG - Intergenic
1130310508 15:82749842-82749864 CAGAAATCAAGATGTCAGTGGGG - Intergenic
1130424450 15:83781197-83781219 CTGAAGTATAGCTGTAAGTCAGG - Intronic
1130797452 15:87224935-87224957 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
1130817417 15:87452545-87452567 CTGCAATCAAGGTGTTAGCCAGG + Intergenic
1130885941 15:88092664-88092686 CTGAAATCAAGGCATCAGTAGGG + Intronic
1130901990 15:88214232-88214254 CAGAAATCAAGGTGTCAGCAGGG + Intronic
1130959654 15:88651403-88651425 CTAAAATCAAAGTGTCAGTGGGG + Intronic
1131337045 15:91559086-91559108 CTGAAATCAAGGTGTCAGTAGGG - Intergenic
1131505870 15:93018624-93018646 CTGATATCAAGGTGTCAGCAGGG + Intronic
1131563797 15:93467440-93467462 CTGCAATCAAGCTGTTTGCCAGG + Intergenic
1131716889 15:95121403-95121425 TTGCAATCAAGGTGTCAGCCTGG + Intergenic
1131741546 15:95398384-95398406 CTGAGAAGAAGCTGTCAGTAGGG + Intergenic
1131855925 15:96594229-96594251 CTGAAATGAAGCTGTCACTCAGG - Intergenic
1131981566 15:97999600-97999622 CTGAGATCAAGGTGTCAGCAGGG - Intergenic
1132091385 15:98950402-98950424 CAGAAATCAAGATGTCAGTGGGG + Intronic
1132103251 15:99043182-99043204 TTGAAATCAAGGTGTCAGCTGGG - Intergenic
1132138297 15:99366528-99366550 CTGAAATCAAGGGGTCAGCATGG + Intronic
1132153482 15:99478537-99478559 CCGAGATCAAGCTGTCAGCAGGG + Intergenic
1132216331 15:100064298-100064320 CTGAGATCAAGGTGTCAGCAGGG - Intronic
1132420009 15:101657363-101657385 CTGCAGTCAGGCTGTCAGCCAGG - Intronic
1133018106 16:2954259-2954281 CTGCACTCAAGGTGTCAGCCAGG + Intergenic
1133377666 16:5301713-5301735 CTGCAATCAAGCTGTCAGCCAGG - Intergenic
1133477587 16:6138379-6138401 CTGAAGTCAACGTGTCAGCCTGG + Intronic
1133498313 16:6341160-6341182 CTAAAATCAAGGTGTCAATGGGG + Intronic
1133502116 16:6376405-6376427 CTGAAATCAAGGTGTTAGCAGGG + Intronic
1133517575 16:6524672-6524694 CTGAAATCAAGATGTCTGCTGGG + Intronic
1133527584 16:6620967-6620989 CTGAAATCAGGATGTCAGCAGGG + Intronic
1133569831 16:7030419-7030441 CTGAAATCAAAATGTCAGCAAGG + Intronic
1133711794 16:8408655-8408677 TTGTAATCAAGATGTCAGCCAGG - Intergenic
1133734655 16:8605699-8605721 CTGCAATCAAGTTGTCAGCTGGG - Intergenic
1133904049 16:10004525-10004547 CTAAAATCAAGGTGTCAGCAGGG + Intronic
1133904852 16:10012808-10012830 CTAAAATCAAGGTGTTAGTAGGG - Intronic
1133981257 16:10634879-10634901 TTGCAATCAAGCTGTCAGCTGGG - Intronic
1134283275 16:12837019-12837041 CTAAAATCAAGGTGTTAGTAGGG - Intergenic
1134350168 16:13430131-13430153 CTGAGATCAAGGTGTCAGCAGGG - Intergenic
1134564624 16:15240534-15240556 CTGAAATCAAGGTGTCAGTAGGG + Intergenic
1134775862 16:16852934-16852956 CTGAGATCAACGTGTCAGTAGGG - Intergenic
1134894047 16:17868304-17868326 CTAAAATCAAGTTGTCAGCAGGG + Intergenic
1134929630 16:18195995-18196017 CTGAAATCAAGGTGTCAGTAGGG + Intergenic
1135108199 16:19669586-19669608 CTGAGATCAGGGTGCCAGTCTGG + Intronic
1135178494 16:20252480-20252502 CTGAAATGAAGGTGTCAGCAGGG + Intergenic
1135289838 16:21225847-21225869 CTGAAATCAAGGTGTGAGCGTGG - Intergenic
1135396343 16:22134568-22134590 CTGAAATCAAGGTGTCAGCAGGG + Intronic
1135402467 16:22175480-22175502 CTGAAATCAAGGTGTCTGCTGGG + Intronic
1135502977 16:23013158-23013180 CTGAAATCAACGTGTCAGCCAGG - Intergenic
1135527020 16:23221356-23221378 CTAAAATCAAGCTATCAGCAGGG + Intergenic
1135593266 16:23720756-23720778 CTGCAATCAGGGTGTCTGTCTGG + Intergenic
1135603178 16:23800788-23800810 CTGAAATCAAGGTGTCGGCCAGG - Intergenic
1135624142 16:23981155-23981177 CTGAAATCGAGGTGTCAGCAGGG + Intronic
1135841169 16:25877652-25877674 CTGAAATCAAAGTGTCAGCAGGG - Intronic
1135965280 16:27030180-27030202 CTGCAATCAAGGTGTCATCCTGG - Intergenic
1136275222 16:29175807-29175829 CTGAAATCAAGGTGTCGGCAGGG - Intergenic
1137512499 16:49114010-49114032 CTGTAATCAAGTTGTCAGCTGGG + Intergenic
1137854637 16:51781861-51781883 CTGCAATCAAGGTGTCAGCCAGG - Intergenic
1137882252 16:52062249-52062271 CTGAAATCAAGGTGTCAGCAGGG + Intronic
1137932961 16:52605979-52606001 CTGAAATAAAGGTGTCTGTAGGG - Intergenic
1137992723 16:53176135-53176157 CTAAAATCAAGATGTCAATAGGG + Intronic
1137999506 16:53260662-53260684 ATAAAATCAAGGTGTCAGTAGGG + Intronic
1138214622 16:55192270-55192292 CTGAAATCTAGCTGTGAGCCAGG - Intergenic
1138261465 16:55626354-55626376 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
1138451560 16:57096218-57096240 TTGAAATCCAGCTGTCAGCAAGG - Intronic
1138649888 16:58453882-58453904 CTGAAATCAAGATGTCGGCAGGG + Intergenic
1138778774 16:59757063-59757085 CTGAAATCAGGGTGTCAGTAGGG + Intergenic
1138791584 16:59910389-59910411 CTGCATTCAAGCTGTCTTTCTGG + Intergenic
1138889005 16:61117931-61117953 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
1138909046 16:61374466-61374488 CTGAAATCAAGGTGTCAGTAGGG + Intergenic
1139011425 16:62639307-62639329 CTGAAATCAAGGTATCAGAAGGG + Intergenic
1139164037 16:64545123-64545145 CTGCAATCAAGGTGTCATCCAGG - Intergenic
1139280309 16:65764891-65764913 GTGAGATCAAGGTGTCAGTAGGG - Intergenic
1139287272 16:65826852-65826874 CTAAAATCAAGGTGTCAGAAGGG + Intergenic
1139976283 16:70813471-70813493 CTGGAATCAAGTTGTCAGCCAGG - Intronic
1139985545 16:70895567-70895589 CTAAAATCAAGGTGTCAGCAGGG - Intronic
1140023307 16:71260344-71260366 CTGAAATCAACCTGTCAGTGGGG - Intergenic
1140118193 16:72060916-72060938 CTGAAAGCAAGATTTCAGCCTGG + Exonic
1140120226 16:72077107-72077129 CTGAAAGCAAGATTTCAGCCTGG + Exonic
1140282372 16:73566410-73566432 CTGAAATCAAGGTATCAACCGGG + Intergenic
1140615493 16:76657810-76657832 CTGTAATCAAGTTGTCAGCCAGG - Intergenic
1140740168 16:77934509-77934531 CTAAAATCAAGGTGTCAGCTGGG - Intronic
1140755895 16:78066380-78066402 CTAAAATCAAGGTGTCAGTGAGG + Intronic
1140764176 16:78140464-78140486 CTGAAATCAAGGTGTTGGTAGGG + Intronic
1140793036 16:78410505-78410527 CTGCAATCAAGATGTCAGCTGGG + Intronic
1140827044 16:78716326-78716348 CTGAAATCAAGGTGTCAACAGGG - Intronic
1140859673 16:79008053-79008075 CTGAAATCAAAGCGTCAGCCAGG + Intronic
1140889579 16:79273507-79273529 CTAAAATCAAGGTGTCTGCCAGG + Intergenic
1140957966 16:79884806-79884828 CTGAAATCAACGTGTCAGCAGGG - Intergenic
1141109800 16:81262916-81262938 CTGAAACCAAGGTGTCAGCCCGG + Intronic
1141192656 16:81835749-81835771 CTGAAATCAAGGTGTTGGTAGGG + Intronic
1141240300 16:82259735-82259757 CTGAAGTCAAGGTGTCAGTAGGG + Intergenic
1141276012 16:82588931-82588953 CTGAAATCAAGACGTCAGCAGGG - Intergenic
1141296202 16:82772153-82772175 CTGATTTCAAGCTGTCAGTGGGG - Intronic
1141489633 16:84363425-84363447 CTGAAATCAAGGTGTGAGGGGGG + Intergenic
1141575382 16:84960002-84960024 CTGAAACCAAGGTATCAGTGGGG - Intergenic
1141763685 16:86045125-86045147 CTGGAATCAAGGTGTCAGCAGGG - Intergenic
1141826633 16:86485291-86485313 CTGAAATCAAGCTGTCAGCAGGG - Intergenic
1142023688 16:87800818-87800840 CTGAAATCAAGGTACCAGTAGGG - Intergenic
1142079583 16:88141875-88141897 CTGAAATCAAGGTGTCGGCAGGG - Intergenic
1142510677 17:390708-390730 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
1142918198 17:3161083-3161105 CCTAAATCAAGCTGTCAGTAGGG - Intergenic
1143066665 17:4254520-4254542 CTCAAATCAAGGTCTCAGTAGGG - Intronic
1143207096 17:5150830-5150852 CTGAAACCAAGGTTTCAGTAGGG + Intronic
1143333696 17:6157222-6157244 TTGAAATCAAGGTGTCAGCAGGG + Intergenic
1143352450 17:6298691-6298713 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1143701213 17:8661661-8661683 CTGAAATCAGGGTGTCAGCAGGG + Intergenic
1143844975 17:9767155-9767177 CTGAAATCCAGATGTCAGCAGGG + Intergenic
1143890840 17:10101212-10101234 CTACAATCAAGATGTCAGCCAGG + Intronic
1144095600 17:11897915-11897937 CTGAAATTAAGGTGTCAGCAGGG + Intronic
1144127875 17:12219873-12219895 CCAAAATCAAGGTGTCAGTGGGG - Intergenic
1144158287 17:12530204-12530226 GTGAAATGAAGGTGTCAGGCAGG + Intergenic
1144183059 17:12770692-12770714 TGGGAATCAAGCTGTCAGTGAGG + Intergenic
1144281379 17:13730480-13730502 CTGAAATGAAGGTGTCAGCAGGG - Intergenic
1144291419 17:13830316-13830338 GTGTAATCAAGGTGTCAGCCAGG - Intergenic
1144311009 17:14014346-14014368 CTGAAGTCAAGGTGTCTGCCGGG - Intergenic
1145313828 17:21716672-21716694 CTGGAATCAAGGTGTCAGCAGGG - Intergenic
1145712272 17:26988646-26988668 CTGGAATCAAGGTGTCAGCAGGG - Intergenic
1146299528 17:31677427-31677449 CTCAAATCAAGGTGTCTGTAGGG + Intergenic
1146540564 17:33689941-33689963 CTGAAATCAAGGTATCAGCAGGG - Intronic
1146734640 17:35227906-35227928 CTGAAATCAAGTTGTCAGTAGGG - Intergenic
1146829972 17:36060176-36060198 CTAAAACCAAGCTGTTAGTGGGG + Intergenic
1146959892 17:36965218-36965240 CTAAAATCAAGGTGTCAGCAGGG + Intronic
1147244862 17:39113265-39113287 CTGAAATTAAGGTGTCAGCAGGG - Intronic
1147569965 17:41563865-41563887 GTGAAATCAAGATGTCAGCCAGG + Intergenic
1148481613 17:47963220-47963242 CTGAAATCCAGGTGTCAGCATGG - Intergenic
1148957218 17:51363807-51363829 CTGAAATCAAGGTGTCGGCAGGG + Intergenic
1148986058 17:51622337-51622359 ATGAAAACAAACTGTGAGTCAGG - Intergenic
1149028802 17:52061396-52061418 CTAAAATCAAGGTGTCACTAGGG - Intronic
1149125909 17:53232634-53232656 CTGAAATCAAGGTGTCAGGAGGG + Intergenic
1149136298 17:53368732-53368754 CTGAAATCAAGGTGTCTGCAGGG - Intergenic
1149179979 17:53924185-53924207 CTGAAATTAAGGTGTTAGTAGGG - Intergenic
1149283125 17:55130205-55130227 CGGAAATCAAGGTGTCAGCTGGG - Intronic
1149317271 17:55450265-55450287 ATGAAATCAAGGTGTCAGAGGGG - Intergenic
1149324448 17:55515742-55515764 CTGGAATCAAGATGTCAGCAGGG - Intergenic
1149420535 17:56506530-56506552 TTGAAATCAAGGTGTCAGCAAGG - Intronic
1149445850 17:56712746-56712768 CTGAAATCAAGGTGTCGGCAAGG - Intergenic
1150246860 17:63682511-63682533 CTGCGATCAAGGTGTCAGCCAGG + Intronic
1150257269 17:63757486-63757508 CTGAAATCAAGATGTCATTCAGG - Intronic
1150318801 17:64192490-64192512 CTGAAATCAAGGTGTTAGCAGGG - Intronic
1150362160 17:64545786-64545808 CTGAAAGGAGGCTGTCAGTCAGG + Exonic
1150694053 17:67389045-67389067 CTGACATCAAGGCGTCAGTCAGG + Intronic
1150804997 17:68311755-68311777 CTGAAATCAAGATGTCGGCCGGG - Intronic
1150898185 17:69238251-69238273 CTAAAATCAAGATGTCAGCAGGG - Intronic
1150949497 17:69786256-69786278 CTGAGATCAAGGTGTCAGCCTGG + Intergenic
1151259064 17:72902461-72902483 CTGAAATCATGGCGTCAGTAGGG - Intronic
1151264014 17:72939738-72939760 CTGAGATCAAGGTGTCAGCAGGG - Intronic
1151271819 17:73002780-73002802 CTGAAATCAATGTGTCAGCAGGG + Intronic
1151432577 17:74073811-74073833 CTGTAATCAAGCTGTCAGCTAGG - Intergenic
1151487607 17:74411130-74411152 CTGAAATTAAGGTGTCAGCCAGG - Intergenic
1151903276 17:77031788-77031810 TTGCAATCAAGCTGTCAGCCAGG - Intergenic
1151953737 17:77370218-77370240 CTGAAATCAAGGTGCCAGCAGGG + Intronic
1151999502 17:77636659-77636681 CCGAGATCAAGGTGTCAGTAAGG + Intergenic
1152323054 17:79619336-79619358 TTGAAATCAAGGTGTCAGTGGGG + Intergenic
1152372906 17:79901588-79901610 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1152424850 17:80213377-80213399 TTGAAATCAAGGTGTCAGCAGGG - Intronic
1153038169 18:784562-784584 CTAAAATCAAGGTGTCAGCAGGG + Intronic
1153045968 18:856171-856193 CTGAATTCAAGGTTTCAGCCAGG + Intergenic
1153501497 18:5754705-5754727 CTGAAATCAAGATGTCAGCAGGG + Intergenic
1153612623 18:6901846-6901868 CTGAAATAAAGATGTCAGCAGGG + Intronic
1153825272 18:8868986-8869008 CTGCAATCCAGCTGCCAGCCAGG + Intergenic
1153833958 18:8947869-8947891 CTGAAATCAAGCTGTCAGCAGGG - Intergenic
1153987399 18:10365417-10365439 TTGAAATCAAAGTGACAGTCAGG - Intergenic
1154076475 18:11207216-11207238 CTGAAATCGAGGTGTCAGTTGGG - Intergenic
1154100503 18:11468675-11468697 CTGCAATCAAGGTGTCAGTCTGG + Intergenic
1154283321 18:13028031-13028053 CTGAAATCAAGGTGTTAGCAGGG + Intronic
1155234421 18:23805143-23805165 CTGGAATGCAGCTGTTAGTCTGG - Intronic
1155336077 18:24766693-24766715 CTGAAATCAAGATGTCAGCAAGG - Intergenic
1155364753 18:25038847-25038869 CTAAAATCAAGGTGTCAGCTGGG + Intergenic
1155437377 18:25827275-25827297 CCAAAATCAAGGTGTCAGTAGGG + Intergenic
1155567597 18:27153341-27153363 CTGAAATCAAGGTGTGATTAGGG + Intronic
1155571582 18:27200638-27200660 CTGAAATCAAGGTGTTGATCAGG + Intergenic
1155705332 18:28803346-28803368 TTGCATTGAAGCTGTCAGTCAGG - Intergenic
1155794027 18:30011020-30011042 CTAAAATCAAGTTGTCAGCAGGG - Intergenic
1156056195 18:33006937-33006959 CTGAAATCCAGTTGTCAGCCAGG - Intronic
1156712592 18:39964829-39964851 CTAAAATCAAGATTTCAGTAGGG + Intergenic
1156963846 18:43066214-43066236 CTGAAACCAAGTGGTAAGTCTGG + Intronic
1157033349 18:43940417-43940439 CTAAAATCAAGCTGTTAGCAGGG + Intergenic
1157085419 18:44575534-44575556 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
1157194252 18:45607751-45607773 CTGCAGTCAAGATGTCAGTCAGG + Intronic
1157257507 18:46152181-46152203 CTGAAATCAAGGTGTCAGCTGGG - Intergenic
1157282890 18:46357826-46357848 CTGCAATCAAGCTGTCCGCGGGG + Intronic
1157314362 18:46575683-46575705 CCAAAATCAAGGTGTCAGCCAGG - Intronic
1157440361 18:47707006-47707028 CTGAAATCAAGGTGTTGGTAAGG - Intergenic
1157479789 18:48046035-48046057 TTGCAATCAAGATGTCAGCCAGG - Intronic
1157504503 18:48217125-48217147 CTGAGATCAAGCTGTCAGCAGGG - Intronic
1157524083 18:48365615-48365637 CTGCAATCCAGGTGTCAGCCTGG - Intronic
1157694168 18:49707770-49707792 GAGAAATCAAGTTGTCAGTTGGG + Intergenic
1157905089 18:51562654-51562676 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
1158007515 18:52690080-52690102 CTGCTGTCAAGCTGTCAGTCTGG - Intronic
1158007641 18:52691428-52691450 TTGAGATCAAGGTGTCAGTAGGG + Intronic
1158033799 18:53000090-53000112 CTGAAAACAAGATGTCAGCAGGG - Intronic
1158048673 18:53188717-53188739 CCGAAATCGAGGTGTCAGTAGGG + Intronic
1158326697 18:56320688-56320710 CTGAAATTAAGGTGTCAGTAGGG + Intergenic
1158328800 18:56338996-56339018 CTGCAATCAAGATGTCAGCTAGG + Intergenic
1158665500 18:59429156-59429178 CTGAAATCAATGTGTCAGTAGGG - Intergenic
1158725409 18:59967568-59967590 CTGAAATCAGGGTGTCAGCAGGG + Intergenic
1158943121 18:62424688-62424710 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
1159173888 18:64809888-64809910 CCAAAATCCAGGTGTCAGTCGGG - Intergenic
1159223483 18:65498617-65498639 CTGAAATCAAGGTGTTTGTTGGG + Intergenic
1159776889 18:72612920-72612942 CCAAGATCAAGCTGTCAGTAGGG + Intronic
1160073027 18:75645069-75645091 CTGAAATCAAGCTGTTGGCAGGG - Intergenic
1161289818 19:3487437-3487459 TTGCAATCAAGCTGTCGGCCAGG - Intergenic
1161597346 19:5157378-5157400 CTGAGATCAAGGTGTCAGCAGGG + Intergenic
1161882367 19:6965016-6965038 CTGAGATCAAGATGTCAGCAGGG - Intergenic
1161999898 19:7737366-7737388 CTGAACTCAAGGTGTCAGCAGGG - Intergenic
1162005990 19:7779647-7779669 CTGGAATCAAGGTGTCAGCAGGG + Intergenic
1162890076 19:13726424-13726446 CAGAAATCAAGGTGTCAGCAGGG + Intergenic
1163088134 19:14997805-14997827 CTGAAATCAAGGTGTTGGTAGGG + Intronic
1163367135 19:16881487-16881509 CTGAGATCAAGGTGTCAGCTGGG - Intergenic
1163473945 19:17514150-17514172 CTGAAATCAAGGTGTTGGTGGGG + Intronic
1163538942 19:17895101-17895123 CTGACATCAAGGTGTCAGTAGGG - Exonic
1164966404 19:32488723-32488745 CTGCAATCAAGGTATCAGCCGGG + Intergenic
1165290794 19:34883764-34883786 CTGACAGCCAGCTGTCAGTCTGG + Intergenic
1165643926 19:37417208-37417230 CTAAAATCAAGGTGTCAGTGGGG - Intronic
1166135098 19:40771858-40771880 CTGCAATCAGCCTGTCAGCCAGG - Exonic
1166335163 19:42101563-42101585 CAGAAATCAAGCTGTCAGCAGGG - Intronic
1166441015 19:42815451-42815473 CTGAGATCAAGGTGTCAGCAGGG - Intronic
1166460489 19:42984057-42984079 CTGAGATCAAGGTGTCAGCAGGG - Intronic
1166477790 19:43144031-43144053 CTGAGATCAAGGTGTCAGCAGGG - Intronic
1166934937 19:46326091-46326113 TTGAAGTCAAACTCTCAGTCAGG + Intronic
1167245595 19:48371277-48371299 CTGAAATCCAGCCCTCAATCTGG + Intronic
1168714990 19:58521740-58521762 CAGAAATAAAGCTTTCAGTGAGG - Intronic
925132166 2:1501820-1501842 CTGAAATCAGGGTGTCGGCCGGG - Intronic
925416839 2:3676310-3676332 CTGTGATCAGGCTGTCAGGCTGG + Intronic
925719569 2:6813910-6813932 CCTAAATCAGGGTGTCAGTCTGG + Intergenic
925742091 2:7014906-7014928 CTGAAATTAAACTGACATTCTGG + Intronic
925744432 2:7032480-7032502 CTGAAATCGAGGTGTCAGCAGGG + Intronic
926061018 2:9804922-9804944 CTGAAATCAAGGTGTCAACAGGG - Intergenic
926276602 2:11408048-11408070 CTGAAATCAAGGTGTCAGCGGGG + Intergenic
926764656 2:16313743-16313765 CTGAAATTTAGGTGTCAGTAGGG + Intergenic
926814203 2:16784289-16784311 CTAAAATCAAGGTGTCAGCATGG - Intergenic
926900466 2:17746188-17746210 CTAAAATCCAGATGTCAGTAGGG - Intronic
927206463 2:20614240-20614262 CTAAAATCAAGGTGTTAGTAGGG - Intronic
927221735 2:20716886-20716908 CTCAAATCAAGTTGTCAGCCAGG - Intronic
927225424 2:20760491-20760513 CTGCAATCAAGGTGTCAGCTAGG + Intronic
927240903 2:20918870-20918892 CTGAAGTCAAGTTCTCATTCTGG - Intergenic
927327350 2:21820413-21820435 CTGAAATCAAGGTGCCGGTCTGG + Intergenic
927501000 2:23583130-23583152 CTGAAGTGAAGCTGTCAGCAGGG - Intronic
928041959 2:27887334-27887356 CTAAAATCAAGGTGTCAGCAGGG - Intronic
928315063 2:30238479-30238501 TTGACATCCATCTGTCAGTCAGG + Intronic
928416416 2:31095945-31095967 CTAAAATCAAGGTGTCAGCAAGG + Intronic
928428359 2:31197902-31197924 CTGAAATCAAGGTGTGAGCAGGG - Intronic
928469191 2:31556688-31556710 CTGAAATCAAGGTGTCAGCAGGG - Intronic
928539039 2:32267004-32267026 CTGAAATCAGGGTGTCAGCAGGG - Intergenic
928564618 2:32532295-32532317 CTGAAATCAAGATATCAGCAGGG + Intronic
928592746 2:32834076-32834098 CTGCAGTCAAGATGTCAGCCTGG - Intergenic
929029544 2:37637654-37637676 CCGAAATCAAGCTGTCAGCAAGG + Intergenic
929510391 2:42561977-42561999 TTGAAAGCAAGGTGTCAGTAGGG + Intronic
930412195 2:51039046-51039068 CTAAAATCAAGGTGTCAGCCAGG - Intergenic
930424675 2:51197431-51197453 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
930561352 2:52963261-52963283 CTGAAATCAAGGTGTCGGCTAGG + Intergenic
930568372 2:53052252-53052274 CTGAAATCAAAGTGTCAGCAAGG - Intergenic
930633899 2:53784510-53784532 CAGAAATCAAGATGTCAGCAGGG + Intronic
930829423 2:55726958-55726980 CTGCAATCAAGATATCAATCAGG + Intergenic
931020010 2:58033512-58033534 CTAAAATCAAGCTGTCAGCAGGG - Exonic
931047766 2:58375846-58375868 CTGAAATCAAGGTGACAGCCAGG + Intergenic
931214248 2:60226529-60226551 ATGAAATCAAGGTGTCAGCAGGG + Intergenic
931446734 2:62333088-62333110 CTGAATTCATGCTGTCAGTGTGG + Intergenic
931465973 2:62487161-62487183 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
931645222 2:64416173-64416195 CTGAAGTCAAGGTGTCAGCAGGG + Intergenic
931782187 2:65588392-65588414 CTAAAATTAAGGTGTCAGTGGGG + Intergenic
932226920 2:70048738-70048760 TTGAAATCCAGGTGTCAGTAGGG + Intergenic
932314618 2:70771564-70771586 CAGAAATCAAGGTGTCAGCCAGG - Intergenic
932388169 2:71357990-71358012 CTGAAATCATGGTGTTAGTTGGG + Intronic
932755308 2:74404024-74404046 CTGAAATCAAGAAGTCATCCAGG + Intergenic
932928159 2:76001136-76001158 CTGAAATCCAGGTGTCAGCAGGG + Intergenic
933146073 2:78854523-78854545 CCAAAATCAAGATGTCAATCAGG - Intergenic
933315523 2:80709845-80709867 ATGCAATCAAGTTGTCAGCCAGG - Intergenic
933605124 2:84374689-84374711 CTGAAATCAAGGTGTCAGCTGGG - Intergenic
933833256 2:86227112-86227134 CTGCAGTCAAGATGTCAGCCTGG - Intronic
933871900 2:86574510-86574532 CTGAAATCAAGCTGTTGGCATGG - Intronic
934054310 2:88239309-88239331 CTGAAATCAAGGTGTCGGCAGGG + Intergenic
934886821 2:98032294-98032316 CTGAGATCAAGGTGTCAGCAAGG + Intergenic
935012106 2:99145062-99145084 CTAAAATCAAGATGTCAGGCAGG + Intronic
935050959 2:99524677-99524699 CTGAAATCAGGGTGTCAGCTTGG - Intergenic
935325460 2:101931897-101931919 CTGAAATCAAGGTGGTAGCCAGG - Intergenic
935502595 2:103859382-103859404 CTGAAATCAAGGTCTCAGCAGGG + Intergenic
935691535 2:105736367-105736389 CTAAAATCAAGGTGGCAGTGGGG - Intergenic
935740531 2:106143626-106143648 CAGAAATCAAGGTGTCAGCAGGG + Intronic
935741720 2:106154615-106154637 CTGAAATCAAGATGTCAGCAGGG - Intronic
935795292 2:106635059-106635081 CTGAGATCAAGGTGTCAGCCGGG - Intergenic
935801663 2:106703278-106703300 CTGAAATCCAGGTGTCAGTGGGG + Intergenic
935861856 2:107339768-107339790 TTAAAATCAAGGTGTCAGCCGGG - Intergenic
936648660 2:114401186-114401208 CTAAAATTAAGGTGTCAGTACGG - Intergenic
936808850 2:116371627-116371649 TTGAAATCAAGATGTCAGCAGGG - Intergenic
936974446 2:118205164-118205186 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
937104709 2:119299550-119299572 CTGAAATCCAGGTGTCAGCAGGG + Intergenic
937294666 2:120802739-120802761 CTGGAATCAAGCAGCCAGACAGG + Intronic
937470630 2:122171140-122171162 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
937488802 2:122343871-122343893 CCAAAATCAAGCTGTCAGCAGGG - Intergenic
937898866 2:127000759-127000781 CTGAAATCAAGGTGACAGCAGGG + Intergenic
937951326 2:127390065-127390087 CTGAAATCAAGGTATCAGCTGGG + Intergenic
938153818 2:128910567-128910589 CTGAGATCAAGCTGTCAGCACGG + Intergenic
938174843 2:129116215-129116237 CTAAAATCAAGATGTTAGCCAGG + Intergenic
938542352 2:132294787-132294809 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
938619076 2:133030804-133030826 CCAAAATCAAGGTGTCAGTAGGG + Intronic
938624653 2:133095036-133095058 CTGAAATCAAGGTGCCAGCCAGG - Intronic
938717900 2:134037512-134037534 CTGAAATCAAGGTGTCGGCAGGG + Intergenic
938954634 2:136286463-136286485 GTGAAATCAAGGTGTCAGCAGGG + Intergenic
939038790 2:137163631-137163653 CTGAAATCAAGGTGTCAGCAGGG - Intronic
939214853 2:139222914-139222936 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
939408933 2:141799032-141799054 CTGAAATCAAGGTCTCGGTAGGG - Intronic
939428093 2:142066923-142066945 CTAAAATCAAGCTGTCTGCAGGG + Intronic
939585018 2:143993656-143993678 CTGAAATCAAGGTGTTAGCTTGG - Intronic
939753733 2:146083539-146083561 CTGCAATCAAGGTGTCAGCCAGG + Intergenic
939965429 2:148605955-148605977 CTGCAATCAAGGTGTCAGGAAGG - Intergenic
940019477 2:149141799-149141821 CTGAAATCAAGGTGTCAGCAAGG + Intronic
940122800 2:150286399-150286421 CTGAAATCAAGGTGTCGGCAGGG + Intergenic
940128475 2:150354553-150354575 CTGAAATCAGGATGTCAGCAGGG - Intergenic
940180117 2:150922756-150922778 CTGAAATCAAACTTACAGACTGG - Intergenic
940180155 2:150923150-150923172 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
940259067 2:151761644-151761666 CTGAAATCAAGGCGTCAGAAGGG - Intergenic
940295253 2:152116113-152116135 CTGAAATCAAGATGTTAGCAAGG + Intergenic
940649539 2:156427800-156427822 CTGAAATCAAGGGGTCAGCAGGG + Intergenic
940779132 2:157914742-157914764 CTGAAATCAAAGTGTCAGCAGGG + Intronic
940933521 2:159465110-159465132 CTGAAATCAAGGTGTCAACAAGG + Intronic
941307247 2:163885498-163885520 CTGAAATCAAGGTGTCAGGAGGG + Intergenic
941396873 2:164984108-164984130 CTAAAATCAAGGTGACAGTAGGG + Intergenic
941805713 2:169710251-169710273 CTATAATCAAGGTGTCAGCCTGG - Intronic
941865640 2:170331637-170331659 CTAAAATCAAGGTGTCAGTAGGG + Intronic
941953819 2:171184233-171184255 CTAAAATCAAGGTGTCAGCAGGG - Intronic
941977953 2:171425643-171425665 CTGAAATTATGGTGTCAGCCTGG - Intronic
941996269 2:171604743-171604765 CTGAAATCAAGGTGTCAGGTGGG - Intergenic
942054522 2:172169865-172169887 CTGAAATCAAGGTATCAGTAGGG - Intergenic
942471768 2:176268232-176268254 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
942633935 2:177981346-177981368 CTAAAATCAAGGTGTCAGAAGGG + Intronic
942956796 2:181782864-181782886 CTGAAACCAAGGTGTCAGCAGGG - Intergenic
943110219 2:183595439-183595461 CTGAAATCAAGGTGTCTGCAGGG + Intergenic
943258045 2:185622028-185622050 CTGAAATCAATATGACAGTAGGG - Intergenic
943263216 2:185693052-185693074 CTAAAATCAAGTTGTCATTCAGG - Intergenic
943603232 2:189945439-189945461 TTGTAATTAAGCTGTCAGCCAGG - Intronic
943778369 2:191793198-191793220 CTGAAATTAAGTTGTCAGCTGGG + Intergenic
943798579 2:192029305-192029327 CTGCAATCAAGATGTCAGCCAGG - Intronic
943848592 2:192686704-192686726 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
943897671 2:193386541-193386563 CTGAAATCAAGATGTTAGCAGGG - Intergenic
944117433 2:196204569-196204591 CTGAAATCAAGCTGTGGGTGGGG - Intronic
944278871 2:197871566-197871588 CTGAAATCAGGGTGTCAGCAAGG + Intronic
944472789 2:200072838-200072860 CTGAATTCAAGGTGTCAGCAGGG + Intergenic
944546094 2:200800225-200800247 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
945224447 2:207519240-207519262 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
945471704 2:210234511-210234533 CTGAAATCAAAGTGTCAGCAGGG - Intergenic
945722767 2:213439073-213439095 CTGAAATCAAGGTGTTAACCAGG - Intronic
946062679 2:216957909-216957931 CTAAAATCAAGGTGTCAGTAGGG + Intergenic
946481780 2:220063988-220064010 CTGAAATCAAGGTGTCAGTGGGG + Intergenic
946646551 2:221843580-221843602 CTGAAATCAATGTGTCAGACAGG + Intergenic
946711756 2:222513849-222513871 CTGAAATCAAGGGGTCTGCCAGG - Intronic
946787663 2:223264803-223264825 CTGAAATCAAGGTATCAGTAGGG + Intergenic
946974439 2:225132350-225132372 TTGAAATCAAGGTGTCAGTGGGG + Intergenic
947041912 2:225932103-225932125 CTGAAACCATGATGTCAGTAAGG - Intergenic
947106148 2:226669862-226669884 CTGAAATCAAGGTGCCAGCTGGG + Intergenic
947338022 2:229107197-229107219 CTGAAATCAAGGTGACAGCAGGG - Intronic
947765903 2:232637147-232637169 CTGAAACCAACGTGTCAGCCGGG + Intronic
947932192 2:233973313-233973335 CTGAGATCAAGCTGTCAGCAGGG + Intronic
948015474 2:234686724-234686746 CTGAAATGGAGATGTCAGTAGGG - Intergenic
948026599 2:234782926-234782948 CTAAAATCAAGGTGTCGGCCCGG - Intergenic
948245982 2:236486272-236486294 CTGCAGTCAAGGTGTCAGCCAGG - Intronic
948275616 2:236705726-236705748 CTGGAGTCAAGCTGTCTGCCTGG + Intergenic
948279370 2:236734717-236734739 CTGAAATCAAGGTGTCTGCAGGG - Intergenic
948400763 2:237683237-237683259 CTAAAATCAAGCCGACGGTCAGG + Intronic
948647126 2:239412373-239412395 CTGAAATCAAGGCGTCGGTCAGG + Intergenic
948681305 2:239636536-239636558 CTGCAATCAAGATGTCAGCCAGG - Intergenic
948834237 2:240617150-240617172 CTGCAATCCAGGTGTCAGCCGGG - Intronic
948834254 2:240617264-240617286 CTGCAATCCAGGTGTCAGCCGGG - Intronic
1169334841 20:4747643-4747665 CTGAAATCAAGGGGTCAGCAGGG - Intergenic
1169735537 20:8833673-8833695 CTGAAATCAACATGTCAGCAGGG - Intronic
1169881166 20:10349028-10349050 CTGAAATCAAGCTGTTAGCAAGG + Intergenic
1169894514 20:10488430-10488452 CTGAAATTAAGGTGTCAGCAGGG - Intronic
1169908997 20:10631910-10631932 CTGAAATCAGGGCGTCAGCCAGG + Intronic
1170018891 20:11813759-11813781 CTGAAATCAAGGTGTCGGCAGGG - Intergenic
1170067878 20:12334244-12334266 CTGAAATCAAGGTGTCTGCAGGG + Intergenic
1170284869 20:14695774-14695796 TTGGAGTCAAGCTGTCAGCCAGG - Intronic
1170608175 20:17889430-17889452 CTGAAATCAATCCATCAGTGGGG + Intergenic
1170753188 20:19170919-19170941 CTGAAATCAAGGTGTCACCAGGG - Intergenic
1170804569 20:19618321-19618343 CTGAGATCAAGGTGTCAGGAGGG + Intronic
1170879498 20:20283616-20283638 CTAAAATCAAGGTGCCAATCAGG + Intronic
1170971041 20:21116781-21116803 CTGCAATCAAGGTGTCAGCAGGG - Intergenic
1171502382 20:25603801-25603823 GGGAAATCAAGGTGTCAGCCGGG + Intergenic
1171871231 20:30527630-30527652 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1171934553 20:31261486-31261508 CTGAGATCAAGGTGTCAGTAGGG - Intergenic
1172406966 20:34696999-34697021 CTGAAATCAAGGTGTTGGCCAGG + Intronic
1172588019 20:36098405-36098427 CTGAAATCCAGGTGTCAGCAAGG + Intronic
1173058590 20:39639948-39639970 CTGAAATCAAGGTGTCAATAGGG - Intergenic
1173203014 20:40967844-40967866 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
1173299043 20:41784272-41784294 CTGAAATCAAACAGGCTGTCAGG - Intergenic
1173410417 20:42804654-42804676 CTGAGATCAAGGTGTCAGCAGGG + Intronic
1173428794 20:42967542-42967564 CTGAAATCAAGGTGTCAGCAGGG - Intronic
1173472628 20:43335627-43335649 CCAAAATCAAGGTGTCAGGCAGG + Intergenic
1173474733 20:43351065-43351087 CTGAAATCAAGGTGTTGGTAGGG - Intergenic
1173892461 20:46523300-46523322 CCAAAGTCAAGCTGTCAGTAGGG - Intergenic
1173915714 20:46707521-46707543 TTGAAATCAAGGTGTCAGCCAGG + Intergenic
1174037969 20:47679684-47679706 CTGAAATCAAGGTGCCGGCCAGG - Intronic
1174064777 20:47856505-47856527 CTGAGATCAAGGTGGCAGTGGGG + Intergenic
1174194744 20:48764977-48764999 CTGAAATCAAGGTGCCAGCAGGG - Intronic
1174301033 20:49582530-49582552 CTGAAGTCAAGGTGTCAGCAGGG + Intergenic
1174498703 20:50968289-50968311 CTAAAATCAAGCTGTCATCAAGG + Intergenic
1174511530 20:51057076-51057098 CTGCAATCAAGCTGTCAGCCTGG - Intergenic
1174566699 20:51469839-51469861 CTGAAATCAAGGTGTCAGCAGGG - Intronic
1174581453 20:51574873-51574895 TTGAAGTCAAGATGTCAGCCAGG + Intergenic
1174705347 20:52649671-52649693 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
1174844412 20:53929401-53929423 CTGAAATCAACATGTTGGTCAGG + Intergenic
1174851961 20:54004295-54004317 CTGAAATCAAGATGCCAGCATGG - Intronic
1174865948 20:54135794-54135816 CTAAAATCAAGGTGTCAGTAGGG + Intergenic
1174876592 20:54232821-54232843 CTGCAATCAAGGTGTTAGCCAGG - Intergenic
1174876879 20:54236256-54236278 CTGTACTCAAGGTGTCAGACGGG + Intergenic
1175002231 20:55641834-55641856 CTGCCATCAAGGTGTCAGTGGGG - Intergenic
1175149320 20:56920712-56920734 CTGAAATCATGATGTCAGCAGGG + Intergenic
1175274652 20:57759935-57759957 CTAAAATCAAGCTGTCAGCAGGG + Intergenic
1175323492 20:58106426-58106448 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1175351801 20:58327366-58327388 TTGCAATCAAGATGTCAGGCAGG + Intronic
1175595165 20:60225199-60225221 CCAAAATCAAGATGTCAGCCAGG - Intergenic
1175692633 20:61076489-61076511 CTGAAATCAAGGTATCAGCAGGG + Intergenic
1175717307 20:61263747-61263769 CTGAAATCAAGGTGTCTGCAGGG + Intronic
1176071649 20:63229767-63229789 CTGACATCTAGCTGTCAGAGAGG + Intergenic
1176927809 21:14771287-14771309 CTGAAATCAAGGTGTAAGTGAGG - Intergenic
1177059203 21:16350313-16350335 CTGATATCAAGGTGTCAGCGTGG + Intergenic
1177218955 21:18166052-18166074 CTGGAATTAAGCTGTCAGCCAGG + Intronic
1177576450 21:22962623-22962645 CTGCAATCAAGGTGTCAACCGGG - Intergenic
1177628983 21:23702102-23702124 CTGAAATCAAAGTGTCAGTCCGG + Intergenic
1177943905 21:27443981-27444003 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
1178055514 21:28793945-28793967 CTGAAATGAAGGTGTCAGTAGGG - Intergenic
1178056652 21:28806856-28806878 CTGAAATCAAGGGGTTAGTAAGG - Intergenic
1178148776 21:29769809-29769831 CTGAAATCAAGATGTTAGCAGGG - Intronic
1178175058 21:30087245-30087267 CTGAAATCAAGGTGTCAGCTGGG + Intergenic
1178368943 21:32011143-32011165 CTGAAATCAAGGTGTCAGCAGGG + Intronic
1178629614 21:34247856-34247878 TTGCAGTCAAGCTGTCAGCCAGG - Intergenic
1178630191 21:34252765-34252787 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
1178763179 21:35423510-35423532 CTGAGATCAAGGTGTCAGCAGGG - Intronic
1178911850 21:36681005-36681027 CTGAAATCAAGGTGTCAGGAAGG - Intergenic
1178933370 21:36838891-36838913 CTGAAATCAAGGTGTCAGCAGGG - Intronic
1179011620 21:37560882-37560904 CTGAGATCAAGGTGTCAGCAGGG + Intergenic
1179050608 21:37885752-37885774 CTGAAATCAAGGTGTTAGCAGGG - Intronic
1179055117 21:37924569-37924591 CTGACATCAAGGTGTCAACCAGG + Intergenic
1179107319 21:38414056-38414078 CTGAAATCAAGGTATCAGCAAGG + Intronic
1179169207 21:38959705-38959727 CTGGAATCAAGCTCTCAGAAGGG - Intergenic
1179267192 21:39814105-39814127 CTGAGATCAAGGTGTCAGCAGGG + Intergenic
1179312963 21:40213027-40213049 CTGAAATCAAGAAGTCAGCAGGG - Intronic
1179419389 21:41223409-41223431 CTGAAATCAAGGTGTTGGTGGGG + Intronic
1179485243 21:41705843-41705865 CTGAAATCAAGGTGTGTGTGGGG - Intergenic
1179541801 21:42087798-42087820 CTGAAATCAAGGTGTCGGCAGGG + Intronic
1179681539 21:43024965-43024987 CTGAAATCATGCTGTCAGCACGG + Intronic
1179803492 21:43823164-43823186 CTGAAATCAGGGTGTCAATAGGG - Intergenic
1179932969 21:44583157-44583179 CTTAAATCAAGCAGACACTCTGG + Intronic
1179941763 21:44644121-44644143 CTTAAATCAAGCAGACACTCTGG - Intronic
1181078524 22:20397825-20397847 CTGAAATCAAGGTGTCAGCAGGG + Intronic
1181784420 22:25216545-25216567 CTGACATCAAGCTGTCAGCAGGG - Intergenic
1181887429 22:26032311-26032333 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1182108098 22:27703768-27703790 CTGAAATCAAGGTATCAGCAGGG + Intergenic
1182412743 22:30201087-30201109 CTGAAATCAAGGTGTCAGCTGGG + Intergenic
1182416676 22:30225787-30225809 CTGAAATCAAGGTGCCAGCAGGG + Intergenic
1182464193 22:30504348-30504370 TAGAAATAAGGCTGTCAGTCGGG - Intronic
1182509537 22:30809149-30809171 CTAAAATCAAGGTGTCAGCAAGG - Intronic
1182522588 22:30892694-30892716 CTAAAATCACTCTGCCAGTCTGG + Intronic
1182769569 22:32784535-32784557 CTGAAACTAAGATGTCAGCCAGG - Intronic
1182927087 22:34135081-34135103 GTGAGATCAAGGTGTCAGTAGGG + Intergenic
1182987504 22:34734300-34734322 CTGCAATCAAGGTGTCTGTTGGG - Intergenic
1183209957 22:36444801-36444823 CTGAAATCAAGACGTCAGCAGGG - Intergenic
1183762505 22:39835703-39835725 CTAAAATCAAGGTGTCCGTAGGG - Intronic
1184009452 22:41736033-41736055 ATGAAATCAAGGTGTCAGCAGGG + Intronic
1184121475 22:42453198-42453220 CTGCAAGCAAGGTGTCAGCCAGG - Intergenic
1184364380 22:44040646-44040668 CTAAAATCAAGGTGTCAGCAGGG - Intronic
1184996598 22:48211634-48211656 CTGAGATCAGGGTGTCAGTGTGG + Intergenic
949127523 3:464358-464380 TGGCAATCAAGCTGTCAGCCCGG + Intergenic
949215225 3:1559390-1559412 CTGAAATCAAGGTGTTGGTGGGG - Intergenic
949269237 3:2194850-2194872 CTGAAATCAAGGTGTGAGCAGGG - Intronic
949297166 3:2538251-2538273 CTGAGATCAAAGTGTCAGTGGGG - Intronic
949518565 3:4828856-4828878 CATAAATCAAGGTGTCAGTCTGG - Intronic
949543275 3:5050874-5050896 CTGAAATCAAGTGCCCAGTCTGG - Intergenic
949578833 3:5366046-5366068 CTGAAATCAACGTGTCAGCAGGG - Intergenic
949663767 3:6313255-6313277 CTGAAATAAAGATGGCAGTAGGG + Intergenic
949740117 3:7222566-7222588 CTGAAATCAAGGTGTCAGCAGGG - Intronic
949783198 3:7712797-7712819 CTGAAATCAAGGTGGCAGCAGGG + Intronic
949870905 3:8587710-8587732 CTGAAATCAAGGTGTTAGCAGGG + Intergenic
950266076 3:11574084-11574106 CTGAGATCAAGGTGTCAGCAGGG - Intronic
950736122 3:15009786-15009808 CTGAAATCAAGGTGTCAGCAGGG + Intronic
950838346 3:15942232-15942254 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
950969443 3:17171445-17171467 CTGAAATCAAGCTGTTGGCAGGG + Intronic
951190345 3:19761576-19761598 ATGAAATCAAGGTATCAGACAGG - Intergenic
951203811 3:19904302-19904324 CTGAAATCAAAGTGTCAGTAAGG + Intronic
951460766 3:22949322-22949344 CTAAAATCAAGATGTCAGCAGGG + Intergenic
951537034 3:23749783-23749805 GTGAAATCAAGGTGTCAGCAGGG + Intergenic
951661838 3:25075395-25075417 CAGTAATTTAGCTGTCAGTCTGG + Intergenic
951862603 3:27270406-27270428 CTGTAGTCAAACTGTCAGCCAGG - Intronic
951897726 3:27626246-27626268 CTGTAATCCAGGTGTCAGCCAGG - Intergenic
952018440 3:28987816-28987838 CTGAAATCAAGATGTCAGGAGGG + Intergenic
952034758 3:29186856-29186878 CTGAAATCAAGGTGTTGGTAAGG + Intergenic
952082161 3:29772204-29772226 CTAAAATCAAGGTGTCAGCAAGG - Intronic
952229443 3:31414664-31414686 AAGAAAGCAAGCTGACAGTCTGG - Intergenic
952518392 3:34129175-34129197 CTAAAATCAAGATGTCAGGAGGG + Intergenic
952611296 3:35213772-35213794 CAGAAATCAAGGTGTCAGACAGG - Intergenic
952650728 3:35723931-35723953 ATGAAGCAAAGCTGTCAGTCTGG + Intronic
952711230 3:36433988-36434010 AAGAAATCAAGCTGTGAGTGGGG + Intronic
952872780 3:37916657-37916679 GTGAAATCAAGCTGTCAGGAGGG - Intronic
953163854 3:40446639-40446661 CAGCAATCAAGTTGTCAGCCAGG + Intergenic
953294269 3:41697006-41697028 CTAAAATGAAGGTGTCAGTATGG - Intronic
953363327 3:42320339-42320361 CTGAAATCAAGGTGTGGGTGGGG - Intergenic
953379371 3:42455310-42455332 CTGAAATCAAGGTGTCATGGAGG - Intergenic
953384106 3:42495913-42495935 TTGAAATCAAAGTGTCAGCCAGG - Intronic
953605834 3:44412648-44412670 CTGACATCAAGGTGTCAGCAGGG + Intergenic
954125728 3:48527141-48527163 CTGAAATCAAGGCGTCAGCGGGG - Intronic
954594384 3:51812868-51812890 CTGAAATCCAGGTGTCAGGAGGG + Intergenic
954623747 3:52010860-52010882 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
954929688 3:54270655-54270677 CTGAAATCAAGGTGTCACCTAGG + Intronic
954990592 3:54837632-54837654 CTGAAATCAAGATGTCAGCAGGG + Intronic
955149455 3:56352690-56352712 GTGTAATCAAGGTGTCAGGCAGG + Intronic
955212172 3:56952400-56952422 CTGAAATCAAGCTGTCAGTCAGG - Intronic
955251788 3:57290202-57290224 CTGAAATCAAGATGTCAGCAGGG + Intronic
955270745 3:57496192-57496214 TTGCAGTCAAGCTGTCAGTTGGG - Intronic
955485910 3:59434161-59434183 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
955567882 3:60269038-60269060 CTAAAATCAAGATGTCAGCAGGG - Intronic
955737534 3:62055626-62055648 CTGAGATCAAGATGTCTGTAGGG + Intronic
956134076 3:66081863-66081885 CTGAATTCAAGGGGTCAGCCAGG - Intergenic
956193565 3:66630267-66630289 CTATAATCAAGATGTCAGTCAGG - Intergenic
956323840 3:68028546-68028568 ATGAAATCAAGGTGTCAGCAGGG + Intronic
956401327 3:68883140-68883162 CTAAAATCAAGGTGTCAGCTGGG + Intronic
956588814 3:70891731-70891753 CTGAAATCAAGACGTCAGCGGGG - Intergenic
957013014 3:75029447-75029469 CCAAAATGAAGGTGTCAGTCAGG + Intergenic
957169930 3:76725029-76725051 CTGACATCAAGTTGTCAGCAGGG - Intronic
957224104 3:77420888-77420910 CTAAAATCAAACTGTCAATGTGG - Intronic
957312525 3:78539340-78539362 CTAAAATCAAGTTGTCAGCAGGG - Intergenic
957424856 3:80024352-80024374 CTGAAATCAAGGTGTCAGTAGGG - Intergenic
957470223 3:80649588-80649610 CTAAAGTCAAGGTGTCAGTAAGG + Intergenic
957586076 3:82133712-82133734 CTAAAATCAAGGTGTCAATGGGG + Intergenic
957705279 3:83772195-83772217 CTGAAATCAAGGTGTTGGTAGGG + Intergenic
958271497 3:91505224-91505246 CTAAAATCAAGGTGTCAGCAAGG - Intergenic
958489869 3:94758748-94758770 CTGAAATCGAAGTGTCAGTAGGG + Intergenic
958600060 3:96285874-96285896 CTGAAATCAAGGTGTCTGCTGGG + Intergenic
958797263 3:98718777-98718799 CTGAAATCAACGTGTCAGAAAGG - Intergenic
958799996 3:98744207-98744229 CTGAAATCAAGGTGTTAGCAGGG - Intronic
958958962 3:100491258-100491280 GTGCAATCAAGGTGTCAGCCGGG - Intergenic
959102611 3:102029919-102029941 CTAAAATCAAGATGTCACCCAGG - Intergenic
959160759 3:102721579-102721601 CTGAAATCAAGATGTCAGTAAGG - Intergenic
959447429 3:106457541-106457563 CTGCAATCAAGATGTCAGTGGGG - Intergenic
959532328 3:107447731-107447753 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
959813046 3:110641799-110641821 CTGAAATCAAGGTGTCAACCAGG - Intergenic
959850863 3:111084937-111084959 CTGAAATCAAGGTGTAAGCAAGG + Intronic
960100068 3:113732493-113732515 CCAAAATCAAGCTGTCAGCAGGG + Intronic
960958687 3:123053589-123053611 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
961496273 3:127294118-127294140 CTAAAATCAAGGTATCAGTGAGG + Intergenic
961660174 3:128464408-128464430 CTGAAATCGAGGTGTTAGTGGGG - Intronic
961958974 3:130834088-130834110 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
962024216 3:131529843-131529865 CTGAAATCAAGGTGTCAGTAGGG - Intergenic
962035756 3:131649919-131649941 CTGAAATCTAGGTGTCAGGTAGG + Intronic
962059583 3:131911350-131911372 CTGCAATCGAGGTGTCAGTCAGG - Intronic
962231695 3:133671196-133671218 CTTAAATCAAGATGTCAGCAGGG + Intergenic
962363691 3:134762699-134762721 CTGAAATCGAGGTGTTAGTGGGG - Intronic
962686823 3:137855988-137856010 CCGAAATCAAGGTGTCAGCAGGG + Intergenic
962803004 3:138906178-138906200 CTGAAATCAAAATGTCAGCAGGG + Intergenic
962906479 3:139808048-139808070 CAGAAATCAAGGAGTCAGCCAGG + Intergenic
962906829 3:139811270-139811292 CAGAAATCAAGGAGTCAGTCAGG + Intergenic
962908140 3:139823913-139823935 CTGAAATCAAAGTGTCAGCAGGG + Intergenic
963375358 3:144457313-144457335 CTGAAATCAGGGTGTCAGCAGGG - Intergenic
963584369 3:147165568-147165590 CTGAAATCAAAGTGTCAGCAAGG + Intergenic
963666044 3:148187589-148187611 CTGAAATTAAAGTGTCAGTATGG - Intergenic
963919164 3:150889210-150889232 CTAAAATCAAGATGTCAGCAGGG + Intronic
964129566 3:153271858-153271880 CTGAAATCAAGTTGTCAGCAGGG - Intergenic
964474433 3:157085863-157085885 CTGTAATCAAGGTGTCAGCCAGG + Intergenic
964654899 3:159055499-159055521 CTGAAATCAAGGTGTCCTTAGGG + Intronic
964750536 3:160050127-160050149 CTAAAATCAAGGTGTCAGCAAGG + Intergenic
964839796 3:160981278-160981300 TTGCATTCAAGCTGTCAGCCAGG + Intronic
964915521 3:161836995-161837017 CTGAAATCAGGATGTCAGAATGG - Intergenic
965199996 3:165645693-165645715 CTGCAACCAAGGTGTCAGCCAGG - Intergenic
965304653 3:167049276-167049298 CTGTAACCAAACTGTCATTCTGG - Intergenic
965312009 3:167140057-167140079 CTAAAATCAAGTTGTCAGTAGGG - Intergenic
965410207 3:168320666-168320688 CTAAAATCAAGGTGTCAGCATGG - Intergenic
965537933 3:169843405-169843427 CTAAAATCAAGGTGTCAGCCTGG - Intronic
965555921 3:170018360-170018382 CTAAAATCAAGGTGTCAGCCAGG + Intergenic
965702045 3:171467890-171467912 CTAAAATCAAGATGTTAGTAGGG - Intergenic
965802019 3:172504475-172504497 CTGAAATCAAGGTGTCAGCAAGG + Intergenic
965836695 3:172860864-172860886 CTGAGATCAAGGTGTCAGCAGGG - Intergenic
965907660 3:173728836-173728858 CTGAAATCAACCTGCCAGCAGGG - Intronic
965977357 3:174641265-174641287 CTGCACTCAAGGTGTCAGCCAGG - Intronic
966230092 3:177642182-177642204 CTGAAATCAAGCTGTTTGTCTGG + Intergenic
966533964 3:181010273-181010295 CTTAAATCAAGATGTCAGCCAGG - Intergenic
966627903 3:182038652-182038674 CAGAAATCAAGGTGTCAGTAGGG + Intergenic
967264769 3:187680782-187680804 CTGAAATCGAGGTGTCAGCAAGG - Intergenic
967629781 3:191732024-191732046 CTGAAATCAAAGTGGCAGTAGGG + Intergenic
967735565 3:192948256-192948278 CTAAAATCAAGATGTCAGCAGGG + Intergenic
967943116 3:194781432-194781454 CTGCAATGAAGATGTCAGCCAGG + Intergenic
968036582 3:195553032-195553054 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
969108702 4:4828023-4828045 CTCAAATCAAGGTGTCAGCAGGG - Intergenic
969207337 4:5656725-5656747 CTGAAATCAAGGTATCAGCAGGG - Intronic
969256004 4:6002337-6002359 CGGAAATCAAGGTGGCAGTGGGG - Intergenic
969597138 4:8155932-8155954 CTGAGATCAAGGTGTCAGCTGGG - Intronic
970015138 4:11504672-11504694 TTGAAATCAAGGTGTCATTAGGG - Intergenic
970188603 4:13488000-13488022 CTGAAATCAAAGTGTCAGCAGGG - Intergenic
970229852 4:13898471-13898493 CTGAAATCAAGGTGTCAGCGGGG - Intergenic
970242256 4:14021770-14021792 CTGAAATCAAGGTGCTAGCCAGG - Intergenic
970262747 4:14245625-14245647 ATGAAATCAAGGTGTCTGTCAGG - Intergenic
970340823 4:15104913-15104935 CAGAAATCAATGTGTCAGTCAGG + Intergenic
970384398 4:15541907-15541929 CTGAAATCAAGGCGTCAGTAGGG + Intronic
970410091 4:15797638-15797660 CTAAAATCAAGGTGTCAGAAGGG + Intronic
970476697 4:16430900-16430922 CTGAAATCAAGGTGTCGGTGGGG + Intergenic
970648197 4:18147345-18147367 CTGAAATCAAGGTGACAGAAAGG + Intergenic
970677001 4:18462650-18462672 CTGCAATCAAGGTGTCACTCAGG + Intergenic
970720396 4:18981389-18981411 CTGCAATCAAGGTGTCAGCCAGG - Intergenic
970881258 4:20934873-20934895 CTGAAATCAAGGTGTCAGCAGGG + Intronic
970921173 4:21396862-21396884 CTAAAATCAAGGTGTCAGCAAGG - Intronic
970938759 4:21606502-21606524 CTGAAATCAAGGTGTCAGCAGGG + Intronic
970939074 4:21610240-21610262 CCAAAATCAAGATGTCAGTGGGG + Intronic
970992260 4:22225890-22225912 CTGAAATCAAGGTGTTAGCAGGG - Intergenic
971003040 4:22343597-22343619 CTGAAATCAAGGTGTCATCAAGG - Intergenic
971069079 4:23070204-23070226 CTGAGATCAAGGTGTCAGTGAGG - Intergenic
971075099 4:23139002-23139024 CTGAAATCAGGGTGCCAGTGTGG - Intergenic
971247746 4:24945518-24945540 CTGAAATCAAGGTGTCAGGAGGG - Intronic
971285195 4:25282208-25282230 CTGAAATCAAGGTGCCAGTAGGG + Intergenic
971364423 4:25966193-25966215 CTGGAATCAAGATGTCAGCAGGG + Intergenic
971630755 4:28990228-28990250 CAGAAATCTAGGTGTCAGTAGGG + Intergenic
971778204 4:30995660-30995682 CTAGAATCAAGGTGTCAGTAAGG + Intronic
971794923 4:31215215-31215237 CTGAAATCAAGGTGTCACCAGGG + Intergenic
972041095 4:34600763-34600785 CTGAAATCAAGATGTCAGTAGGG + Intergenic
972059838 4:34855425-34855447 CCAAAATCAAGCTGTGAGTGGGG - Intergenic
972316921 4:37935300-37935322 CACAAATCCAGCTGTCAATCAGG + Intronic
972777176 4:42252328-42252350 CTGTAGTCAAGGTGTCAGTAAGG + Intergenic
973121654 4:46528002-46528024 CTAAAATCAAGATGTCTGTAAGG - Intergenic
973599726 4:52529949-52529971 CTAAAATCAAGGTGTCAGTGGGG - Intergenic
973787675 4:54348752-54348774 CTGGAATCAAGATTTCAGTGTGG + Intergenic
973956613 4:56069147-56069169 CCGAAATCGAGGTGTCAGTGGGG - Intergenic
974012084 4:56616170-56616192 CTGAGATCAAGGTGTCGGTGGGG + Intergenic
974134286 4:57795180-57795202 CTGAAATCAAGGTGTTGGTAGGG + Intergenic
974140741 4:57883375-57883397 CTGAAATCAAGGTGTCAGAAGGG + Intergenic
974471165 4:62319665-62319687 CTACAATCAAGGTGTCAGTAGGG - Intergenic
974893971 4:67915779-67915801 CTGTAATCAAGGTGTCAGCTGGG - Intronic
975412799 4:74074406-74074428 CTAAAATCGAGGTGTCAGTAGGG - Intergenic
975571053 4:75818208-75818230 CTACAATCAAGGTGTCAGCCAGG - Intergenic
975572574 4:75832838-75832860 CAGAAATCAAGGTGTCAGCAGGG - Intergenic
975709943 4:77151032-77151054 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
975954581 4:79822254-79822276 CTGAAATCTAGGTGTCAGCTGGG + Intergenic
976048204 4:80978184-80978206 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
976334446 4:83869342-83869364 GTGAAATCAAGGTGTCAGCAGGG - Intergenic
976392064 4:84516127-84516149 CTGAAATCAAGGTGTCTGCAAGG - Intergenic
976392568 4:84520552-84520574 CTAAAATCAAGTTGTCAGCAGGG + Intergenic
976663153 4:87561525-87561547 CTGAAATCAAGTTGTCAGCAGGG - Intergenic
976702875 4:87990156-87990178 CTGAAATCAAGGAGTCAGCAGGG - Intergenic
976836694 4:89382734-89382756 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
976896664 4:90120341-90120363 CTGAAATCAAGGTGTTATTTAGG - Intergenic
977055602 4:92186808-92186830 CCAAAATCAAGTTGTCAGTAGGG + Intergenic
977165447 4:93689165-93689187 CTGAGATCAAGGTGTCAGCAGGG - Intronic
977576941 4:98684950-98684972 CTAAAATCGAGCTGTCAGCAGGG + Intergenic
978020299 4:103801413-103801435 CTCAAATCAAGGTGTCAGTAGGG + Intergenic
978197532 4:105988769-105988791 CTGTAATCAAGGTATCAGCCAGG + Intronic
978280388 4:107005005-107005027 CTAAAATCAAGGTGTCAGTAGGG - Intronic
978316260 4:107440831-107440853 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
978348576 4:107797698-107797720 CTGAAATTAAGATGTCAGTGGGG - Intergenic
978428010 4:108602517-108602539 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
978476495 4:109136994-109137016 CTGCAATCAAGGTGTCAACCAGG - Intronic
978716521 4:111850057-111850079 CTGCAATGAAGTTGTCAGGCAGG + Intergenic
978764655 4:112391747-112391769 CTGAAATCAAGACGTCAGTGGGG - Intronic
979162637 4:117483078-117483100 CTGAAATCAAGGTGTCAACAGGG + Intergenic
979442554 4:120768771-120768793 CTGAAATCAAACAGTAAGTTTGG + Intronic
979715224 4:123829662-123829684 CAGAAATCAAGGTGTCAGCAGGG - Intergenic
979954583 4:126936111-126936133 CTGAAATCGAGTTGTCAGCAGGG - Intergenic
980258976 4:130422911-130422933 CTGAAATCAAGGTGTTGGTTTGG - Intergenic
980408571 4:132384728-132384750 CTGAAATCAAGGTGTCAGTGGGG - Intergenic
980413595 4:132456488-132456510 CTGAAATAAAGGTGTCAGCAGGG + Intergenic
980450742 4:132967747-132967769 CTGATATCAAGGTGTCAGCAGGG + Intergenic
980719995 4:136683079-136683101 TCAAAATCAAGGTGTCAGTCAGG + Intergenic
980849610 4:138365293-138365315 CTGAAATCAATGTGTCAGGAAGG + Intergenic
980953907 4:139409084-139409106 CTGAAATCAGGCTGTCAATGGGG + Intronic
980971545 4:139572068-139572090 CTGAAATCAAGGTGTCAGCAGGG + Intronic
981175225 4:141674955-141674977 TAGAAATCAAGGTGTCAGCCAGG + Intronic
981409973 4:144418172-144418194 CTGAAATCAAGGGGTCAGCCAGG - Intergenic
981429472 4:144643685-144643707 AAGAAATTATGCTGTCAGTCTGG + Intergenic
981451651 4:144905108-144905130 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
981541506 4:145851156-145851178 CTGAAATCAAAATGTTGGTCTGG - Intronic
981988941 4:150892531-150892553 CTAAGATCAAGATGCCAGTCGGG - Intronic
982019438 4:151189039-151189061 CTGAAATCAAGGTGTCAGCAGGG - Intronic
982417266 4:155150349-155150371 ATGCAACCAAGGTGTCAGTCAGG + Intergenic
982659286 4:158187741-158187763 CTGAAATCAAGGTATCAGCGGGG - Intergenic
982693972 4:158579205-158579227 CTGCAACCAAGGTGTCAGTGGGG - Intronic
982823518 4:159974111-159974133 CTGAAATAAAGGTGTCAGTAGGG + Intergenic
983009968 4:162536022-162536044 CTGAAATCAAGGTGTCACCTGGG + Intergenic
983141696 4:164157558-164157580 TTGAAATCAAGATGTCAGCAGGG + Intronic
983275878 4:165616633-165616655 CTGCAATCAAAATGTCAGCCAGG - Intergenic
983302871 4:165949350-165949372 CTGAAATCAAGGTATTAGTAGGG - Intronic
983524631 4:168748624-168748646 CTGCAATCAAGGTGTCACTCAGG + Intronic
983569380 4:169188111-169188133 CTGAAATCAAGGTGTTAGCAGGG - Intronic
983603685 4:169560200-169560222 CAGAAATCAAGGTGTCAGCCAGG + Intronic
983771948 4:171561693-171561715 CTAAAATCAAGGTGTCAGCAAGG - Intergenic
983886199 4:172983273-172983295 CTGAAATCAAGCTGTCGGCAGGG - Intronic
984078374 4:175212681-175212703 ATGAAATCAAGGTGTCAGCAGGG - Intergenic
984402331 4:179282316-179282338 CTAAAATCAAGGTGTCAACCGGG - Intergenic
984570044 4:181381293-181381315 CTGAAATCAATTTATCAGTAGGG + Intergenic
984744423 4:183200575-183200597 TTGCAATCAAGGTGTCAGCCAGG + Intronic
984746127 4:183220222-183220244 CTGAAATCAGGGTGTTAGCCAGG - Intronic
984782757 4:183540759-183540781 CTGAAATCAAGCCCTCAGCCAGG - Intergenic
985025144 4:185733041-185733063 CTGAGATCAAGGTGTCAGCAGGG - Intronic
985115317 4:186584464-186584486 CTGGAATCAAGCTGTCAGCTAGG - Intergenic
986119900 5:4824943-4824965 CTAAAATTAAGGTGTCAGTGCGG - Intergenic
986292957 5:6415070-6415092 CTGAAATCAAGGTGCCAGCAGGG + Intergenic
986396417 5:7335177-7335199 CTAAAGTCAAGATGTCAGTTGGG - Intergenic
986855669 5:11865952-11865974 CTAAAATCAAGGTGTCACTAGGG - Intronic
987203588 5:15602148-15602170 CTGAAATCAAGGTGTCATCAGGG - Intronic
987345514 5:16975410-16975432 CAGAGATCAGGGTGTCAGTCTGG - Intergenic
987633414 5:20506589-20506611 CAGAAATCATGGTGTCAGCCAGG - Intronic
987782454 5:22457290-22457312 CTGAAATCAAGGTGTCAGGTGGG + Intronic
987883029 5:23774573-23774595 CTGTAATCAAGGTATCAGCCAGG + Intergenic
988003125 5:25375064-25375086 CTAAAATCAAGGTGTCAGTAGGG - Intergenic
988327854 5:29794492-29794514 CTGAGATCAGGGTGTCAGTATGG - Intergenic
988393387 5:30664939-30664961 CCAAAATCAAGGTGTCAGCCGGG - Intergenic
988414072 5:30923720-30923742 CTAAAATCAAGATGTCAGCAGGG - Intergenic
988475495 5:31581301-31581323 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
988600083 5:32631642-32631664 CTGAACTGAAGCTGTCAGCATGG - Intergenic
989546694 5:42682882-42682904 CTGCAATCAAAGTGTCAGCCAGG + Intronic
989751569 5:44900865-44900887 CTGCAATCAAGGTGTCAGCCTGG - Intergenic
989799628 5:45521399-45521421 CTGAAATCAAGGTATCAGCAAGG + Intronic
990054063 5:51547871-51547893 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
990183971 5:53192796-53192818 TTGAAATCAAGGTGTCAGGAGGG - Intergenic
990194660 5:53301137-53301159 TTGAAATCAAGATGTCAGCCTGG + Intergenic
990271993 5:54152224-54152246 CTGAAATCAAGTTGTCTGAGAGG - Intronic
990320485 5:54625322-54625344 CTGCAATCAAGTTGTCAGCCAGG + Intergenic
990778499 5:59331286-59331308 CTGAGGTCAAGATGTCAGTGGGG + Intronic
991203381 5:64020322-64020344 CTGAAATCAAGGTATCAACCAGG - Intergenic
991259833 5:64655000-64655022 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
991473602 5:66996563-66996585 CTGAAATCAAGGTGTCGGCTGGG + Intronic
991570068 5:68044541-68044563 CTGAGATCAAGGTGTCAGTATGG + Intergenic
991618714 5:68522976-68522998 CTGAAATCAAGATGTCATCAGGG - Intergenic
991627780 5:68622196-68622218 CTGAGATCAAGGTATCAGTAGGG + Intergenic
992075106 5:73184838-73184860 CTGAAGTCAAGGTGTCAGCAAGG - Intergenic
992231721 5:74670628-74670650 CTGTTAACATGCTGTCAGTCAGG + Intronic
992279250 5:75156826-75156848 CTAAAATCAAGATATCAGTGGGG - Intronic
992646553 5:78816903-78816925 CTGAATTCAAGGTGTCAGTCAGG - Intronic
993071527 5:83170471-83170493 CTGAAATCAAAGTATCAGTTGGG + Intronic
993091549 5:83432871-83432893 CTGAAATCAAGGTGTTTGTAGGG - Intergenic
993176743 5:84496340-84496362 CTGAAATCAAGTTGTCAGCCAGG + Intergenic
993180873 5:84550154-84550176 CTGAAATCAAAGTGTCAACCTGG - Intergenic
993282298 5:85940270-85940292 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
993318409 5:86440791-86440813 CTAAAATCAAGGTATCAGCCAGG + Intergenic
993342398 5:86740746-86740768 CTGAAATCAAGGTGTCCATAGGG + Intergenic
993486615 5:88495164-88495186 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
993759851 5:91780985-91781007 CTGCAATCAAGGTGTCAGCTGGG + Intergenic
993783494 5:92099066-92099088 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
994049261 5:95344082-95344104 CTGAAATCAAGGTGCCAGCAGGG + Intergenic
994369383 5:98950985-98951007 CTGAGATCAAGGTATCAGTAGGG - Intergenic
994598908 5:101876507-101876529 CTGAGATCAAGGTGCCAGACAGG - Intergenic
994797565 5:104324004-104324026 TTAAAATCAAGGTGTCAGTAGGG + Intergenic
994881316 5:105500707-105500729 CCAAAATCAAGGTGTCAGGCAGG + Intergenic
995007220 5:107214441-107214463 CTGAAATCAAGATGTCAGCTGGG + Intergenic
995062129 5:107822416-107822438 CTGTAATCAAGGTATCAATCAGG - Intergenic
995126362 5:108580410-108580432 CTGCTATCAAGGTGTTAGTCAGG - Intergenic
995154736 5:108897225-108897247 ATAAAATCAAGGTGACAGTCTGG - Intronic
995254577 5:110031956-110031978 CTGAAATCAAGTTGTCAGTGGGG + Intergenic
995269021 5:110199819-110199841 CCAAAATCAAGATGTCAGTGGGG - Intergenic
995299390 5:110559787-110559809 CTGAAATGAAGGTGTCAGTAAGG + Intronic
995315920 5:110774210-110774232 CTGAGATCAAGGTGTCAGCAGGG + Intergenic
995647033 5:114324561-114324583 CTAAAATCAAGATGTCAGCAGGG - Intergenic
995729576 5:115223578-115223600 CTAAAATCAAGATGTCAGCAGGG - Intronic
995947864 5:117671585-117671607 CTGAAATCAAGGTGTCATCTGGG - Intergenic
996026098 5:118647580-118647602 CTAAAATCAAGGTGTCAGCAAGG + Intergenic
996303448 5:122017281-122017303 TTGAAATTAAGGTGTCAGTGAGG + Intronic
996368570 5:122728587-122728609 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
996414687 5:123197515-123197537 CTGAAATCAAGGTGTGAGCAAGG - Intergenic
996560225 5:124820522-124820544 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
996683212 5:126250737-126250759 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
996770534 5:127080970-127080992 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
996816907 5:127584177-127584199 CTAAAATTAAGGTGTCAGTTGGG - Intergenic
996881277 5:128299427-128299449 CTGAGATCAAACTGTGAGGCTGG - Intronic
997025738 5:130058791-130058813 CTGAAAGCAAGGTGTCAGCAGGG + Intronic
997274883 5:132577087-132577109 CTAAAATCAAGATGTTAGTAGGG + Intronic
997276551 5:132597650-132597672 TCGCAATCAAGCTGTCAGCCAGG - Intronic
998362406 5:141600328-141600350 CTGAAATCAAAATGTCAGGCTGG - Intronic
998747573 5:145278352-145278374 CTGCAATCAAGATGTTAGCCAGG + Intergenic
998804637 5:145906494-145906516 CTCAAATGAAGCCATCAGTCAGG - Intergenic
998927721 5:147145035-147145057 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
999487704 5:152015677-152015699 CTGAAATCAAGATGTTGGTAGGG - Intergenic
999638686 5:153649190-153649212 CTAAAATCAAGGTGTCAGCAGGG - Intronic
999897449 5:156050691-156050713 CTAAAATCAAGGTGTCAGCAGGG + Intronic
999937886 5:156507409-156507431 CTAAAATCAAGGTGTCAGAAGGG - Intronic
1000228764 5:159295427-159295449 CTGCAATCAAGGTGTCGGCCAGG + Intergenic
1000241299 5:159410954-159410976 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
1000263938 5:159616852-159616874 CTTTAATCAAGGTGTCAGTCCGG + Intergenic
1000265186 5:159629541-159629563 CCAAAATCAAGCTGTCAGCAGGG - Intergenic
1000423856 5:161068020-161068042 CTGAAAGTAGGCTGTTAGTCTGG + Intergenic
1000505782 5:162116056-162116078 TTGGAATCAGACTGTCAGTCAGG - Intronic
1000603376 5:163301457-163301479 CTGAAGTCAAGGTGTCAGCAGGG + Intergenic
1000650224 5:163808404-163808426 CTGAAATCAAGGTGTCAATAGGG - Intergenic
1000660384 5:163931263-163931285 CTAAAATCAAGATGTCAGCAGGG - Intergenic
1000704639 5:164495452-164495474 CTCAAAACAAGCTCTCACTCTGG - Intergenic
1000788864 5:165580192-165580214 CTGAAATCAAGGTGTCTGTAGGG - Intergenic
1000803208 5:165754603-165754625 CTGAAATCAAGGTGTGAGCAGGG + Intergenic
1000971634 5:167721437-167721459 CTAAAATCAAGGTGTTAGTTGGG + Intronic
1001243976 5:170092021-170092043 CTGAAATCCAGGTGTCAGCAGGG + Intergenic
1001370336 5:171193598-171193620 CTAAAATCAAGGTGTCAGCAGGG + Intronic
1001765112 5:174239647-174239669 CTGAAATCAAGGTGTCACCAAGG - Intronic
1001782116 5:174378574-174378596 TTGCAGTGAAGCTGTCAGTCTGG + Intergenic
1001832462 5:174800830-174800852 CTGCAATCAAGGTGTCAGTTAGG - Intergenic
1001832956 5:174804928-174804950 CTGAAATCAAGATGTTGGTATGG + Intergenic
1001885250 5:175284409-175284431 CTGAAATCCAGATGTCAGTGGGG - Intergenic
1002290728 5:178198986-178199008 CTAAAATCAAGCTGTCAGCAGGG + Intergenic
1002565319 5:180109836-180109858 CTAAAATCAAGCTGTCAGCAGGG - Intronic
1002611707 5:180423718-180423740 CTGAAATCAAGGTGCCAGCTGGG + Intergenic
1002667493 5:180836294-180836316 CTGAAATCAAGTTGTTAGTAGGG + Intergenic
1003061094 6:2863347-2863369 CTAAGATCAAGGTGTCAGTAAGG + Intergenic
1003429332 6:6024658-6024680 CTAAGATCAAGGTGTCAGTAGGG + Intergenic
1003670654 6:8154771-8154793 CTGAGATCAAGGTGTCAGCAAGG - Intergenic
1003825943 6:9952110-9952132 CTAAAATCAAGGTGTCAGCAGGG - Intronic
1003840750 6:10116891-10116913 CTATAATCAAGGTGTCAGCCAGG + Intronic
1003841781 6:10128068-10128090 CTGCAATCAAGATGTTAGCCAGG - Intronic
1003878324 6:10457900-10457922 CTGAAATCAAGGAGTCAGCAAGG + Intergenic
1004004873 6:11629209-11629231 CTGAAATCAAGGTGGCAGCAGGG - Intergenic
1004123594 6:12850637-12850659 CTGAAACCAAGGTGTCAGCAGGG + Intronic
1004134725 6:12955741-12955763 CAGACATCAATCTGTCATTCAGG + Intronic
1004453281 6:15767388-15767410 CTGAAATCAAGGTGTTGGTGGGG - Intergenic
1004553517 6:16673107-16673129 CTGAAATCAAAGTGTCAGCCAGG - Intronic
1004563164 6:16770702-16770724 CTGAAATCAAGGTGTCAACAGGG - Intergenic
1004675705 6:17839873-17839895 CTGAAATCAAGGGGTCAGCAGGG - Intronic
1004740929 6:18460146-18460168 TTAAAATCAAGGTGTCAGCCGGG + Intronic
1004816459 6:19316349-19316371 CTTAGATCAAAGTGTCAGTCAGG - Intergenic
1005165125 6:22910567-22910589 CTGAAATCCAGGTGTTAGTGGGG - Intergenic
1005175691 6:23041977-23041999 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
1005213380 6:23495974-23495996 CTGAAATCAAGGCGTCAGCAGGG - Intergenic
1005245367 6:23878242-23878264 CTGAAATTAAGGTTTCAGTAGGG + Intergenic
1005375550 6:25178904-25178926 ATGAAATCAAGGTGGCAGTAGGG + Intergenic
1005902429 6:30228521-30228543 CTAAAATCAAGTTGTCAGTGTGG + Intergenic
1005911439 6:30313314-30313336 CTGAAATCCAAGTGTCAGCCAGG - Intergenic
1005917067 6:30362021-30362043 CTAAAATCAAGATGTCAGATGGG - Intergenic
1006366520 6:33619434-33619456 CTCTGATCAAGCTGTCAGCCTGG - Intergenic
1006404567 6:33837348-33837370 CTGAAATCAAGTTGTCTGCAGGG + Intergenic
1006926645 6:37659158-37659180 CTGCAATCCAGCTGTCAGGCAGG - Intronic
1007029623 6:38616267-38616289 CTGAAATCAAAGTGTCAGCAGGG - Intronic
1007290327 6:40780876-40780898 CTGAAATCAAGATGTCAGTTGGG - Intergenic
1008315645 6:50036870-50036892 CTGTAATCAAGGTGTCAGCAGGG - Intergenic
1008415799 6:51238812-51238834 CTGTAATCAAGGTGTTGGTCAGG - Intergenic
1008479403 6:51969331-51969353 CTGAAATCAAAGTGTCAGCATGG - Intronic
1008703641 6:54131238-54131260 TTGAAATCAAGGTGTCAGTCAGG + Intronic
1008791943 6:55246164-55246186 CTCAAATCAAGGTGTCAGCAGGG - Intronic
1008983618 6:57515854-57515876 CTAAAATCAAGGTGTCAGCAAGG + Intronic
1009171674 6:60408759-60408781 CTAAAATCAAGGTGTCAGCAAGG + Intergenic
1009197038 6:60699247-60699269 CTGAAATCAAGGTGTCAACAGGG + Intergenic
1009284708 6:61802202-61802224 CTAAAATCAAAGTGTTAGTCAGG - Intronic
1010010694 6:71044566-71044588 CTGAAATCAAGATGTCTGCTAGG - Intergenic
1010117135 6:72327066-72327088 CTAAAATCAAGGTGTCAGCTGGG - Intronic
1010321751 6:74518338-74518360 CTAAAATCAAGGTGCCAGTAGGG - Intergenic
1010567011 6:77428515-77428537 CTCAGCTCAAGCTGTCAGGCAGG - Intergenic
1010738894 6:79475798-79475820 CTGAAATCAAGGTGTTGGCCGGG + Intergenic
1011019574 6:82797215-82797237 CTAAAATCAATGTGTCAGCCAGG + Intergenic
1011201815 6:84845325-84845347 CTGCAGTCAAGATGTCAGCCAGG + Intergenic
1011301803 6:85883134-85883156 TTGCAATCAAGATGTCAGTTGGG - Intergenic
1011648047 6:89478929-89478951 CTGAAATAAAGGTGTCAGCAGGG - Intronic
1011820486 6:91247575-91247597 CTGAGATCAAGGTGTCAGCAGGG + Intergenic
1012254070 6:97012475-97012497 CTAAAATCAAGGTGTCAGCAGGG - Intronic
1012425901 6:99114163-99114185 CAGAAATCAAGGTGTCAGCAGGG + Intergenic
1012466310 6:99520443-99520465 CTAAAATCAAGGTGTCAGCAAGG - Intronic
1012553973 6:100490086-100490108 CTAAAATCAAGTTGTCAGTAGGG + Intergenic
1012657408 6:101841890-101841912 CTGAAAAGAAGCTTTCAGTAAGG + Intronic
1013186003 6:107758781-107758803 CTGAAATCAGGGTGTCAGCAGGG - Intronic
1013223489 6:108101332-108101354 CTGAGATCAAGGTGTCAGCAGGG - Intronic
1013297729 6:108774595-108774617 CTGAAATCCAGGTGTCAGCCAGG + Intergenic
1013301008 6:108804942-108804964 CTGCAATCAAGGCGTCAGCCCGG + Intergenic
1013508847 6:110826491-110826513 CTGAAATCAAGATGTCTGGAGGG + Intronic
1013677521 6:112482167-112482189 TTGAAATCAAACTGTCAGTTAGG + Intergenic
1013721725 6:113038547-113038569 CTGAGATCAAGGTGTCAGCAGGG - Intergenic
1013722542 6:113048343-113048365 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
1013730354 6:113157302-113157324 CTGAAATCAAGGTGTCAACAGGG + Intergenic
1013811359 6:114048537-114048559 CTGAAATCAAGTTGTTAGCAGGG + Intergenic
1013840522 6:114386942-114386964 CTGAAATCATGCTTGCGGTCAGG - Intergenic
1013840763 6:114390475-114390497 CTGAAATCAAGGTGTCACTGGGG - Intergenic
1014283406 6:119466623-119466645 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
1014483984 6:121976334-121976356 CTGAAATCAAGGTGTCAGCTGGG - Intergenic
1014608599 6:123511726-123511748 CTGAAATCAAGTTGTCACCTAGG + Intronic
1014947062 6:127511199-127511221 CTGGAATCAAGGTGTTAGTAGGG - Intronic
1014987170 6:128025655-128025677 CCAAAATCAAGGTGTCAGTAGGG + Intronic
1015212180 6:130710909-130710931 CTGAAATTGAGTTGTCAGTAGGG + Intergenic
1015502233 6:133946314-133946336 CTGAAATCAAGGTGTTAGCAGGG - Intergenic
1015546014 6:134362223-134362245 CTGAGATCAAGGTGTCAGCTGGG + Intergenic
1015636583 6:135280667-135280689 CTGAACTCATGATTTCAGTCTGG + Intergenic
1015798494 6:137036683-137036705 CTGAAATCAAGGTGTCAGCAGGG - Intronic
1015814687 6:137196047-137196069 CTGAAATCAAGGTTTCAATAGGG - Intergenic
1015873683 6:137801733-137801755 CTGAAATAAAGGTGTCAGCCAGG + Intergenic
1015988771 6:138913526-138913548 CTCTAATAAAGCTGACAGTCCGG + Intronic
1016171443 6:141023010-141023032 CAGAAATCAGGGTGTCAGTATGG + Intergenic
1016225266 6:141727519-141727541 CTGAGATCAAGATGTCAGCAGGG + Intergenic
1016302052 6:142643827-142643849 CTAAAGTCAAGTTGTCAGCCAGG + Intergenic
1016340189 6:143053840-143053862 CTGAAATCAAAGTTTCAGTGGGG + Intergenic
1016399132 6:143659393-143659415 CTGCAGTCAAGGTGTCAGTAGGG + Intronic
1016618013 6:146075678-146075700 CTGAAATAAAGGTGTCAGCAGGG + Intronic
1016743840 6:147557409-147557431 CTGAAATCAACGTGTCAGCAAGG + Intronic
1016771775 6:147860083-147860105 CTGAAATCAAGTTGCCAGCAGGG + Intergenic
1016774249 6:147886963-147886985 CTGCAATCAAGATGTCAGCTAGG - Intergenic
1016876688 6:148872673-148872695 CTCAAATTAAGATGTCAGTAGGG + Intronic
1016879237 6:148894571-148894593 CTGAAATCAAGGTGTCTATAGGG - Intronic
1016908408 6:149173626-149173648 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
1017061350 6:150488027-150488049 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1017183662 6:151578307-151578329 CTGGCATCAAGGTGTCAGTAGGG + Intronic
1017317865 6:153053006-153053028 CTGAGATCAAGGTGCCAGTATGG - Intronic
1017326534 6:153146899-153146921 CTGAAATCAAGGTGTCCATAGGG - Intergenic
1017410828 6:154166023-154166045 CTGTGATCAAGCTGTCAGCTGGG - Intronic
1017495648 6:154980840-154980862 CTGAAATCAAAGTGTCGGTAGGG - Intronic
1017533576 6:155322331-155322353 CTCAAATCAAGATGTCAGCAGGG - Intergenic
1017575201 6:155794536-155794558 CTGAAATCGAGGTGTCAGTAGGG - Intergenic
1017652840 6:156599016-156599038 CTGTAATAAAGCTGTCTGTTAGG - Intergenic
1017675633 6:156810980-156811002 CTGTAATCCAGGTGTCAGCCGGG + Intronic
1017726567 6:157280432-157280454 CTGCCATGAAGCTGTCTGTCAGG + Intergenic
1018146700 6:160898180-160898202 CTGAAATCAAAGTGTCAGTGAGG - Intergenic
1018292146 6:162302650-162302672 TTGAAATCAAGGTGTCAATAAGG - Intronic
1018392098 6:163348445-163348467 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
1018653454 6:166010249-166010271 CTGAAATGAAGGTGTCAGCAGGG + Intergenic
1018711368 6:166500173-166500195 ATGAAATCAAGGTGTCAGCAGGG - Intronic
1018883939 6:167916053-167916075 TTGAAATCAAGATGTCAGCAGGG + Intronic
1019125481 6:169837843-169837865 CTGAAATCAAGGTGTCGGCAGGG - Intergenic
1019619440 7:1982969-1982991 CTAAAATCAAGCTGACAGGCTGG + Intronic
1020347991 7:7185461-7185483 CTGAAATCAAGATGTAGGTATGG + Intronic
1020551970 7:9618610-9618632 CTGCCATCAAGGTGTCAGCCAGG - Intergenic
1020958155 7:14769683-14769705 CTGAAATCAAGGTGTCAGCAGGG + Intronic
1021427754 7:20521991-20522013 CTGAGATCAAGGTGTCACTAGGG - Intergenic
1021476194 7:21064186-21064208 CTAAAATTAAGATCTCAGTCTGG + Intergenic
1021483274 7:21141855-21141877 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
1021816106 7:24449102-24449124 CTGAAATCAAGACATCAGTGGGG + Intergenic
1021855082 7:24847219-24847241 CTGGAGTCAAGTTTTCAGTCTGG + Intronic
1021903830 7:25313937-25313959 CTGAAATCAAGGTGTTGGTGGGG - Intergenic
1021951735 7:25781525-25781547 CTGAAATGAAGGTGTCAATAGGG - Intergenic
1022144809 7:27526553-27526575 CAGAAATCAAGGTTTCTGTCTGG - Intronic
1022477542 7:30721567-30721589 CTAAAATCAAGGTGTCAGCAGGG - Intronic
1022851908 7:34272255-34272277 CTGAAATTAGTCTATCAGTCTGG - Intergenic
1022874220 7:34512127-34512149 CTGAAATCAAGGTGTTGTTCGGG - Intergenic
1022976783 7:35566050-35566072 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
1022976890 7:35566913-35566935 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1023019878 7:36001744-36001766 CTAAAAGCAAGGTGTCAGCCAGG - Intergenic
1023029526 7:36080192-36080214 CTGAAATCAAGGAATCAGCCAGG + Intronic
1023031032 7:36090542-36090564 TTAAAATCAAGGTGTCAGTCAGG - Intergenic
1023047683 7:36225096-36225118 CTGAAATCAAGCTATCGGAATGG - Intronic
1023088560 7:36596714-36596736 CTGAGATCAAGATGTCAGCAGGG - Intronic
1023269374 7:38444652-38444674 CTGAGATCAAGGTGTCAGTAGGG - Intronic
1023346881 7:39279553-39279575 CTGAAATCAAGGTGTCAACAGGG + Intronic
1023385303 7:39650801-39650823 CTGCAATCAAAGTGTCAGCCAGG + Intronic
1023566928 7:41532696-41532718 GTGAAATCAAGTTGTCTGTAGGG + Intergenic
1023754195 7:43400826-43400848 CTAAAATCAAGCTGTCAGCCAGG + Intronic
1023892159 7:44400641-44400663 CTGAAATCAAGGTGTCAGTAGGG + Intronic
1023895490 7:44429505-44429527 CTGAGATCAAGGTGTCAGCAGGG - Intronic
1024304443 7:47915370-47915392 CTGATATAAAGCTGTTTGTCAGG - Intronic
1024610777 7:51062398-51062420 CTGAAGTCATGCTGTGACTCAGG - Intronic
1024960622 7:54970955-54970977 CTGAAATCAAGGTGTCACCAGGG + Intergenic
1025036500 7:55596076-55596098 ATGTAATCAAGATGTCAGCCAGG - Intergenic
1025829409 7:65036842-65036864 ATACAATCAAGCTGTCAGCCAGG - Intergenic
1025916627 7:65871782-65871804 ATACAATCAAGCTGTCAGCCAGG - Intergenic
1026187275 7:68091724-68091746 CTGAAATCAAGGTGTTAGCAGGG + Intergenic
1026198158 7:68190810-68190832 CTGAAATCAAGGTGCAAGTAGGG - Intergenic
1026282546 7:68934469-68934491 CTAAAATCAAGATGTTAGCCAGG - Intergenic
1026534454 7:71228520-71228542 CTGAAATCAAGGTGTCAGCAGGG + Intronic
1026788416 7:73316593-73316615 CTGACATCAAGCTGACCGTGTGG - Exonic
1026839482 7:73661612-73661634 CTGAAATCAAGGTGTCCTGCTGG + Intergenic
1027508311 7:79046397-79046419 CTGAGATCAAGATGTCTGTAGGG - Intronic
1027589946 7:80105903-80105925 CTGAAATCAAGATGACAGCAGGG - Intergenic
1027942640 7:84704523-84704545 CTGAAATCATGTTGTCAGCAGGG + Intergenic
1027950529 7:84809261-84809283 CTGATATCAAGGTGTCAGCAGGG + Intergenic
1028000614 7:85493393-85493415 CCGAGATCAAGGTGTCAGCCAGG + Intergenic
1028101901 7:86831049-86831071 CTGAAATCAAGGTGTCAGCAAGG - Intronic
1028366706 7:90040623-90040645 CTGAAATCAATGTGTCAGCAAGG + Intergenic
1028380530 7:90194386-90194408 GTTAAAACAAGCTGTCAGTAAGG - Intronic
1028431875 7:90757046-90757068 CTGAAATCAAGGTGTCTGCAGGG + Intronic
1028451259 7:90986231-90986253 CTGAAAACAAGCTATCAATATGG - Intronic
1028538360 7:91914733-91914755 GTGAGATCAAGGTGTCAGCCGGG - Intergenic
1028954072 7:96669047-96669069 CTGAAATTAAGGTGTCAGCAGGG - Intronic
1029237883 7:99137559-99137581 CTGAAAGCAAGCTGCAAGTTGGG + Intronic
1030173337 7:106626816-106626838 CTGAAATCAAAGTGTCAGCAGGG - Intergenic
1030382095 7:108823805-108823827 CTGAAATCAATCTTTCAGCATGG - Intergenic
1030836340 7:114291591-114291613 CTGCAATCAAAATGTCAGCCAGG + Intronic
1030982356 7:116201042-116201064 CTGAAATCAAGGTATCAGAAGGG - Intergenic
1031029083 7:116715267-116715289 CTGAAATCAAGGCATCAGCCAGG + Intronic
1031265128 7:119572043-119572065 CTGCAATCAAGATGTCAGCTAGG - Intergenic
1031299667 7:120048425-120048447 CTAAAATCAAGTTGTGTGTCAGG - Intergenic
1031335131 7:120519527-120519549 CTGAAACCAAGGTGTTAGCCTGG - Intronic
1031504344 7:122562492-122562514 CTAAAATCAAGCTCTCAGCAGGG - Intronic
1031563244 7:123263536-123263558 GTGAAGTCAAGATGTCAGTGAGG + Intergenic
1031706885 7:124991964-124991986 CTGAAATTAAGTTGTCAGCAGGG - Intergenic
1032251620 7:130262426-130262448 CTGAAATCAATCTGTGAGGTGGG + Intergenic
1032342078 7:131083162-131083184 GTGAAGTCAAGATGTTAGTCAGG - Intergenic
1032491167 7:132325689-132325711 CTGAAATTAAGGTGTCAGCAGGG - Intronic
1032720716 7:134549108-134549130 CTGTAAGCCAGCTGTCTGTCTGG - Intergenic
1032728932 7:134618347-134618369 CTGAAATCAAGGTGTCTGCAGGG - Intergenic
1033132101 7:138753390-138753412 CTGAAATCAAGGCGTCAGCAGGG - Intronic
1033263262 7:139861807-139861829 CTGAAGTCAAGGTGTCAGGCAGG + Intronic
1033289690 7:140072779-140072801 CCAAAATCAAGGTGTCAGTAGGG - Intergenic
1033297642 7:140155435-140155457 CTTAAATAAACCTGGCAGTCAGG - Intronic
1033436809 7:141340238-141340260 CTGAAATCCAGCTGTCAGCTGGG - Intronic
1033591980 7:142816519-142816541 TTAAAATCAAGCTGTCAGCTAGG - Intergenic
1033636823 7:143219456-143219478 CTCAATGCAAGCTGGCAGTCTGG - Intergenic
1033852025 7:145508276-145508298 CTGTAATTGAGCTGTCAGTTAGG + Intergenic
1033889127 7:145986607-145986629 CTAAAATCAAGATGGCAGTTGGG - Intergenic
1034048327 7:147953710-147953732 CTGAAATCAAGGTATCAGCAGGG + Intronic
1034090673 7:148361444-148361466 CTGAAATCAGGGTGTCAGTAGGG + Intronic
1034150669 7:148912818-148912840 CTGAGATCATGCAGTTAGTCAGG - Intergenic
1034152171 7:148925608-148925630 CTGAAATCAAGATGTCAGTAGGG - Intergenic
1034209892 7:149354341-149354363 CTGAAATCAAGTTGTCGGCAAGG - Intergenic
1034252613 7:149704533-149704555 CCGAAATCAAGGTGTCAGTGGGG + Intergenic
1034328891 7:150265113-150265135 CTGAAATCCAGCTCTCAGTTTGG - Intronic
1034472953 7:151265395-151265417 CTGAAATCAAGGTGTCAGCGGGG - Intronic
1034484835 7:151353237-151353259 CTGACATAAGGCTCTCAGTCTGG - Intronic
1034669156 7:152844632-152844654 CTGAAATCCAGCTCTCAGTTTGG + Intronic
1034778083 7:153850196-153850218 CTGCAATCAAGATGCCAGCCAGG + Intergenic
1034903314 7:154921589-154921611 CTGAAATCGTGCTGTCAATTAGG + Intergenic
1036092679 8:5685192-5685214 CTGAGATCAAGGTGTCAGCAGGG + Intergenic
1036429835 8:8679844-8679866 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
1036504587 8:9343866-9343888 CTGAAATCAAGGTGTCAGCTAGG - Intergenic
1036517916 8:9462053-9462075 CTGCAATCAAGGTGGCAGTTAGG - Intergenic
1036607657 8:10321840-10321862 CTGTAATCAAACTGTCAGGCAGG - Intronic
1036988214 8:13560909-13560931 CTGAAATCAAGGCATCAGTAGGG - Intergenic
1037019232 8:13947620-13947642 CTGAAATCAAGGAGTCAGCCAGG - Intergenic
1037615038 8:20511304-20511326 CTGAAATCAAGGTGTCAGTTAGG - Intergenic
1038009083 8:23459557-23459579 CTGAAATGAAGGTGTCAGCAGGG + Intergenic
1038123262 8:24642155-24642177 CTGAAGTCAAGGTGTCAGCAGGG - Intergenic
1038293279 8:26268725-26268747 CTGAAATCAAGGTGTTAGCAGGG - Intergenic
1038530189 8:28312203-28312225 CTGAAATCAAGGTGTCAGCAAGG - Intergenic
1038821236 8:30953706-30953728 TTGAAATCAAGGTGTCAGAAGGG - Intergenic
1038849819 8:31264887-31264909 CTGAAATCAAGGTGTCAGCCTGG - Intergenic
1038869405 8:31478184-31478206 CTGAAATCAAGGTGTTGGTAGGG + Intergenic
1038888158 8:31688904-31688926 CTAAAATCAAGGTGTCAGGAGGG + Intronic
1039133311 8:34292509-34292531 CTGAAATCAAGATGTCAGCAGGG - Intergenic
1039286567 8:36048222-36048244 CTGCAATCAAGGTGTCAGCCAGG + Intergenic
1039301552 8:36214717-36214739 CTGAAAACAAGGTGTTGGTCTGG + Intergenic
1039439971 8:37588356-37588378 CTGAGATCAAGGTGTCAGCAGGG + Intergenic
1039449219 8:37658248-37658270 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1039720775 8:40161930-40161952 CTGAGATCAAGCTGTCAACTGGG + Intergenic
1040641620 8:49340960-49340982 CTGAAACCAAGGTGTCAGTGTGG - Intergenic
1040679524 8:49791946-49791968 CAGAAATCAAGGTGTCAGAATGG + Intergenic
1040723608 8:50354729-50354751 CTGCAGTCAAGATGTCAGCCAGG + Intronic
1040804801 8:51382320-51382342 CTGGAATCAAGGTGTCAGCAGGG - Intronic
1040864760 8:52037913-52037935 CTGAGATCAAGGTGTCAGCAGGG + Intergenic
1040977125 8:53205853-53205875 CTGAAATCAAGGTGTCAGTGGGG - Intergenic
1041139188 8:54796716-54796738 CTGAAATCAAGACGTCAATGAGG - Intergenic
1041202776 8:55467048-55467070 CTGCATTCAAGGTGTCAGCCAGG + Intronic
1041636074 8:60146505-60146527 CTGAAATCGAGGTGTCAGCTGGG + Intergenic
1041731945 8:61071292-61071314 CCGAAATCAAGGTGTCAGCAGGG + Intronic
1041812422 8:61926463-61926485 CTGAAATCAAGCTGTCAGCAAGG - Intergenic
1041888660 8:62843634-62843656 CTAAAATCAAGATGTCAGCAGGG - Intronic
1041895119 8:62915485-62915507 CTAAAATCAAGGTGTCAGCAGGG - Intronic
1041957371 8:63570862-63570884 ATGAAATCAAGGTGTCAGAAGGG - Intergenic
1042127672 8:65555082-65555104 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
1042236841 8:66621705-66621727 CTAAAATCAAGGTGTCAGGAGGG + Intergenic
1042315043 8:67417279-67417301 CCAAAATCAAGATGTCAGTGGGG - Intergenic
1042317572 8:67440125-67440147 CTGGAATCAAGGTGTCAGCAGGG + Intronic
1042334677 8:67617743-67617765 CTGAAATTAAGGTGTCAGTTGGG + Intronic
1042458131 8:69029326-69029348 CTGAAATCAAGATGGCAGTAGGG - Intergenic
1042648607 8:71014364-71014386 CTGAAATCAAGGTGTTAGCAGGG + Intergenic
1042655708 8:71093211-71093233 CTGAAATCAAGCAGCTAGTTAGG + Intergenic
1042775797 8:72429497-72429519 CTGAGATCAAGGTGTCAGCAAGG - Intergenic
1042801793 8:72726288-72726310 CTGAGATCAAGGTGCCAGTATGG - Intronic
1042869565 8:73386054-73386076 CTGAAATCAAGATGCCAGCTGGG - Intergenic
1042885105 8:73540415-73540437 CTGAAATCAAAGTGTCAGCAGGG - Intronic
1043046751 8:75334440-75334462 CTTCAATCAAGGTGTCAATCTGG + Intergenic
1043442964 8:80292586-80292608 CTGAGATCAAGGTGTCAGGAGGG + Intergenic
1043505203 8:80895627-80895649 CTGCAATCAAGGTGTCAGCCAGG - Intergenic
1043646538 8:82527562-82527584 CTGAAATCCAGGTGACAGCCCGG - Intergenic
1043785470 8:84393184-84393206 CTGCAATCAAGAAGTCACTCAGG + Intronic
1043983940 8:86671855-86671877 CTGAAATCAAGGTGTTGGCCAGG - Intronic
1044017375 8:87060170-87060192 CTAACATCAAGGTGTCAGTTGGG - Intronic
1044046664 8:87443808-87443830 CTGAAATCAAGTTGTCAGTAGGG - Intronic
1044059337 8:87615145-87615167 CTGAAATCAAGTTGCCAGCATGG - Intronic
1044226457 8:89724561-89724583 CTAAAATCATGGTGTCAGTAGGG + Intergenic
1044410418 8:91876255-91876277 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1044438869 8:92199486-92199508 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1044450053 8:92324916-92324938 TTGAAATTAAGCTTTGAGTCTGG + Intergenic
1044474436 8:92609547-92609569 CTGAAATCAAGGCGTCAGCAGGG + Intergenic
1044580687 8:93823191-93823213 CTGAAATCAACTTGTCAGCCTGG + Intergenic
1044598073 8:93977737-93977759 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
1044785612 8:95789215-95789237 CTGAAATCAAGGTGTTGGTAGGG - Intergenic
1044871702 8:96626172-96626194 CTGAGATCAAGCTGTCAGCAGGG + Intergenic
1044963234 8:97551689-97551711 ATGAAATCAAGGTGTCAGCAAGG + Intergenic
1045000310 8:97872537-97872559 CTAAAATCAAGGTGTCAGCAGGG + Intronic
1045139386 8:99263471-99263493 CTAAAATCAAGGTGTCAGTTGGG + Intronic
1045151789 8:99416278-99416300 CTGAAGTCAAGCTGGAACTCTGG - Intronic
1045349911 8:101329310-101329332 CTGAAATCAAGATGTCGGCAGGG + Intergenic
1045496530 8:102714211-102714233 CTGAAATCAAGATGTCAGCAGGG + Intergenic
1045543907 8:103111413-103111435 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
1045712706 8:105004229-105004251 CTGAATTTAAGCTGCTAGTCAGG + Intronic
1045988765 8:108281589-108281611 CTGCAGTCAAACTGTCAGTTGGG - Intronic
1046001291 8:108423698-108423720 CTGAATTTAAGCTTTTAGTCTGG + Intronic
1046042221 8:108919553-108919575 CTGAAATCAAGATGTCAGCAAGG - Intergenic
1046076282 8:109315856-109315878 GTGAAAACAAGCTGACATTCAGG + Intronic
1046474068 8:114717778-114717800 GAGAGATCAAGCTGTCAGTAGGG + Intergenic
1046479367 8:114794795-114794817 CTGCAATCAAGTTGTCAGCCAGG - Intergenic
1046665571 8:116998860-116998882 CTGAAATCAAGGTGTCAGCAAGG - Intronic
1046839195 8:118838718-118838740 CCAAAATCAAGGTGTCAGTAGGG + Intergenic
1047003529 8:120596505-120596527 CTGAAATCAAGATGTCAGCATGG + Intronic
1047047746 8:121073742-121073764 CTGAATTCAAGATGTCAGCTGGG - Intergenic
1047063639 8:121255479-121255501 CTAAAATCAAGATGTCAGCAGGG - Intergenic
1047065132 8:121273475-121273497 CTCAATTCAAGGTGTCAGTAGGG + Intergenic
1047276169 8:123407202-123407224 CTGAAATCAAAGCGTCAGCCAGG - Intronic
1047295879 8:123570176-123570198 CTAAAATCAAGGTGTCAATAGGG - Intergenic
1047311300 8:123694654-123694676 CTGAAATCAAGGTGTCGGCCAGG - Intronic
1047324725 8:123825289-123825311 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
1047366452 8:124216106-124216128 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1047381533 8:124368762-124368784 TTGAAATCAAGCTCTCAGCTGGG - Intronic
1047655572 8:126973364-126973386 TTGAAATCAAGGTGTCAGCAAGG + Intergenic
1047762520 8:127964589-127964611 CTGAAATCAAGGTGTCAGCGAGG + Intergenic
1047818516 8:128492297-128492319 CTAAAGTCAAGCTGTCAGGAGGG - Intergenic
1048205085 8:132408924-132408946 CAGAAGTCAAGGTGTCAGGCAGG - Intronic
1048351317 8:133619000-133619022 CTGACATCAAGCTCTGTGTCTGG - Intergenic
1048455609 8:134575499-134575521 CTAAAATCAAGGTGTCAGCCTGG - Intronic
1048542923 8:135359225-135359247 CTGAGATCAAGATGTCAGCAGGG + Intergenic
1048835691 8:138516868-138516890 CTGAGATCAAGGTGTCAGCAAGG + Intergenic
1048984079 8:139722179-139722201 CAGAAATAAAGGTGTCAGTAGGG + Intergenic
1049307700 8:141914689-141914711 CTGAAATCCAGGTGTCAGCCAGG - Intergenic
1049768997 8:144370805-144370827 CTGAAATCAAGGTGTCAACAGGG + Intergenic
1050128293 9:2382533-2382555 CTGAAATCTAGGTGTCAGCAAGG + Intergenic
1050189001 9:3005400-3005422 CTGAAATCAAGATGTCTGCAGGG - Intergenic
1050654206 9:7807832-7807854 CTGAAATCAAGGTGTCAACAGGG - Intronic
1050663107 9:7905538-7905560 CTGAAATTAAGGTATCAGGCAGG + Intergenic
1050859583 9:10409915-10409937 TTGTAGTCAAGATGTCAGTCAGG - Intronic
1050921247 9:11203481-11203503 CTGAGATCAAGATGTCAGCAGGG - Intergenic
1051066063 9:13104495-13104517 CTGAAATCAAGGTGTCAATAAGG + Intergenic
1051175443 9:14355356-14355378 CTGAGATCAAGTTGTCAGCAGGG - Intronic
1051481698 9:17568879-17568901 CTGAACTCAAGGTGTCAGCAGGG - Intergenic
1051640364 9:19219401-19219423 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
1051763717 9:20498978-20499000 CTGAAATCAAAGTGTCAGTAGGG + Intronic
1052084567 9:24248418-24248440 CTGGAATCAAACTGTCAGCAGGG - Intergenic
1052262075 9:26528600-26528622 CTGAAATCAAGGTGTCTATAGGG - Intergenic
1052280579 9:26728929-26728951 CTGAAATCAAAGTGTCAGCAAGG + Intergenic
1052338054 9:27339166-27339188 CTGAAAACAAGCTTCCAGGCAGG - Intronic
1053172988 9:35904306-35904328 CTGATCTCAGGCTGTCACTCTGG + Intergenic
1053214729 9:36260961-36260983 CCAAAATCAAGGTGTCAGTTGGG + Intronic
1053467277 9:38317918-38317940 CTGAACTCAAGGTGTCAGCCAGG + Intergenic
1054744459 9:68840526-68840548 CTAAAATCAAGGTGTCAGTGTGG + Intronic
1054860619 9:69949111-69949133 CTGAGATCAAGATGTCATCCGGG - Intergenic
1054990203 9:71316702-71316724 CTAATATCAAGGTGTCAGTTGGG - Intronic
1054993328 9:71355497-71355519 CTGAAATCCAGTTGTCAGTGGGG - Intronic
1054998074 9:71415235-71415257 CAGAAATCAAGGTGTCAGGAGGG - Intronic
1055095850 9:72413325-72413347 CTAAAATCAAGGTGTCAGCAAGG - Intergenic
1055098095 9:72435077-72435099 CTGAAATCAAGGTGTTAGCCAGG + Intergenic
1055630221 9:78216103-78216125 CTGAAATCAAGGTGTCAGCAGGG - Intergenic
1055675472 9:78654962-78654984 CTGACATCAATGTGTCAGTAGGG - Intergenic
1055710462 9:79055285-79055307 CTGAAATCAAGGTCTCAGCAGGG - Intergenic
1055861338 9:80753174-80753196 CTGAAATCAAGGTGTTAGCAGGG + Intergenic
1056107517 9:83361943-83361965 CTGAAACCAAGTTGTCAGCAGGG - Intronic
1056164388 9:83927283-83927305 TTGCAATCAAGGTGTCAGTCAGG + Intergenic
1056223015 9:84468407-84468429 CTGAAATCAAGGTGTCAGTAGGG - Intergenic
1056783150 9:89566495-89566517 CTGAAATCAAGATGGCAGCAGGG - Intergenic
1057333193 9:94135399-94135421 CTGACATCAAGGTGTCGGTAGGG + Intergenic
1057468202 9:95335376-95335398 CTGAAATCAAAGTGTCAGCTGGG + Intergenic
1057540287 9:95961440-95961462 CTGAAATCAAGGTGTCCATAGGG - Intronic
1057878014 9:98772404-98772426 CTGAAATCAAGGTGTCAGCAGGG - Intronic
1057931056 9:99193377-99193399 CTGAAATCAAGGTGTCGGCAAGG - Intergenic
1057954338 9:99395858-99395880 TTAAAATCAAGCTGCCAGTGGGG - Intergenic
1058132525 9:101268939-101268961 ATGAAATAAAGGTGTCAGACAGG + Intronic
1058165196 9:101611174-101611196 CTGAAATCAAGGTGTCAGCAGGG + Intronic
1058187658 9:101874432-101874454 CTGAAATTAGGGTGTCAGTAGGG + Intergenic
1058651437 9:107178798-107178820 CTGAAATTAAGATGTCAGAAGGG + Intergenic
1058816421 9:108686748-108686770 GAGCAATCAAGCTGTCAGTTGGG - Intergenic
1058918281 9:109588373-109588395 CTGAGATCAAGGTGTCAGTGTGG - Intergenic
1058920292 9:109608145-109608167 CTGAAATCAAGATGTCAGCAGGG + Intergenic
1058921258 9:109617375-109617397 CTGCAATCAAGTTGTCAGCCAGG + Intergenic
1058935209 9:109763652-109763674 CTGAAATCAAGGTGTCAGCAGGG + Intronic
1059149409 9:111935818-111935840 CTGAGTTCAAGCTGTGAGCCCGG - Intergenic
1059199463 9:112400686-112400708 CTGAAATCAAGATGTCAGCAGGG + Intronic
1059263593 9:113004244-113004266 CCAAAATCAAGCTGTCAGCAAGG - Intergenic
1059830593 9:118090926-118090948 CTGAAATCAAAGTGTCAGCAGGG - Intergenic
1059948474 9:119437616-119437638 CTGAAATCAAGATGTTGGTAGGG + Intergenic
1060007975 9:120017180-120017202 CTGAAATCAAAATGTCAGCAGGG + Intergenic
1060122377 9:121005504-121005526 CTGAAATCAAGATTTCAGAGAGG + Intronic
1060203317 9:121666051-121666073 CTAAAATCAAGGTGTCAGCAGGG + Intronic
1060739528 9:126089130-126089152 CTGAAATCAAGGTGTCAATGGGG + Intergenic
1060836758 9:126761406-126761428 CTCAAAGGAGGCTGTCAGTCAGG + Intergenic
1061954196 9:133953173-133953195 CTGAAACCAAGGTGTCAGCAGGG - Intronic
1203619296 Un_KI270749v1:105716-105738 CTGAAAGCAGGGTGTCAGCCTGG + Intergenic
1185843230 X:3412950-3412972 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
1185922430 X:4108308-4108330 CTGAAATGAAGGTGTCAGCAGGG - Intergenic
1186148965 X:6654115-6654137 CTGAAATCAAGGTGTCTGTCAGG - Intergenic
1186155281 X:6719023-6719045 CTCCAATCCAGGTGTCAGTCAGG - Intergenic
1186187854 X:7039629-7039651 CTGAGATCAAGGTGTCAGCAGGG - Intergenic
1186229714 X:7439936-7439958 GTGAAATCAAGGTGTCAGCTGGG - Intergenic
1186402989 X:9276886-9276908 CTGAAATCTAGGTGTCAAGCAGG + Intergenic
1186422023 X:9433892-9433914 ATGAAATCAAGGTGTCAGTTGGG - Intergenic
1186506346 X:10096087-10096109 CTGCAATCAAGGTGTCAGCCAGG + Intronic
1186583019 X:10841096-10841118 CTAAAATCAAGCTGTCAGCAGGG - Intergenic
1186633459 X:11376537-11376559 CTAAAATCAAGGTGTCAGCAGGG - Intronic
1186676060 X:11818593-11818615 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
1186686540 X:11930575-11930597 CTGAAATCAAGATGTCTATAAGG - Intergenic
1186695589 X:12028110-12028132 TTGAAAGCAAGATGTCAGCCAGG + Intergenic
1186711183 X:12198871-12198893 CAGAGTTCAAACTGTCAGTCTGG - Intronic
1186711537 X:12202964-12202986 CTGAAACCAAGGTGTCAGCAGGG - Intronic
1186755756 X:12669828-12669850 CTAAAATCAAGGTGTCAGCTGGG - Intronic
1186782733 X:12929645-12929667 CTGAAATCAAGGTGTCTGCAGGG + Intergenic
1186790844 X:12997019-12997041 CTGAAATCAAGGTGTCAGCCTGG + Intergenic
1186798908 X:13073392-13073414 CTGAAATCAAGTTGTCAGCTGGG - Intergenic
1186813781 X:13215619-13215641 CTGAAATCAAGGTGTCAACAGGG - Intergenic
1186865639 X:13718086-13718108 CTGAAATCAAGGTGTCAGTGGGG - Intronic
1186907820 X:14130865-14130887 CAGAAATCAAGTTGTCAGCAGGG + Intergenic
1186950429 X:14618670-14618692 CTGAAATCAAAGTGTCAGCTGGG + Intronic
1186961706 X:14743729-14743751 ATGAAATCAAGGTGTCAGCAGGG + Intergenic
1187091502 X:16101740-16101762 CTGAAATCAAGGTGTCAGCAGGG + Intergenic
1187260911 X:17684411-17684433 CTGAAATCAAGGTGTCAGCTGGG + Intronic
1187536829 X:20148603-20148625 CTAAAATCAAGGTGTCAGCAAGG - Intergenic
1187577812 X:20576979-20577001 CTGAAATCAAGGTGTCATCTGGG + Intergenic
1187587330 X:20677888-20677910 CTGAAATCAAGATGTCAGCAGGG - Intergenic
1187597560 X:20790451-20790473 CTGAAAACAAGTAGTCAGTAAGG - Intergenic
1187727031 X:22214112-22214134 CTAAAATCAAGTTGTCAGCAGGG + Intronic
1188016771 X:25114927-25114949 CTGACATCAAGGTGTCAGCAGGG - Intergenic
1188071105 X:25719522-25719544 CTGAAATCAAGTTGTCACGCAGG + Intergenic
1188081722 X:25851363-25851385 CTGATATCCATCTGTCAGCCTGG + Intergenic
1188138482 X:26519184-26519206 CTAAAATCAAGTTGTCAGCAGGG - Intergenic
1188142164 X:26564822-26564844 CTTAAATCAAGATGTCAGCAGGG - Intergenic
1188206380 X:27364129-27364151 CTGAAATCAAGGTGTCAGTGGGG + Intergenic
1188380998 X:29492415-29492437 CTAAAATCAAGGTATCAGTAGGG + Intronic
1188510218 X:30927848-30927870 CTGAAATCAAAGTGTCAGCAGGG + Intronic
1188569416 X:31564162-31564184 CTGAGATCAAGGTGTCAGGAGGG - Intronic
1188847843 X:35095924-35095946 CTAAAATCCAGGTGTCAGTCAGG + Intergenic
1189155363 X:38751093-38751115 CTGTAATCAAGGTGTCAGTGGGG + Intergenic
1189158370 X:38783591-38783613 ATGAAATCAAGGTGTCAGTAAGG - Intergenic
1189202148 X:39205542-39205564 CTGCTATCAAGGTGTCAGCCAGG - Intergenic
1189245307 X:39558731-39558753 CTGAAATCAAGGTGTTGGTGGGG - Intergenic
1189343189 X:40220097-40220119 CCGAAATCAAGGTGTCAGCGGGG + Intergenic
1189622586 X:42857846-42857868 CTGAAATCAAGATGTCAGCAGGG + Intergenic
1189629864 X:42941590-42941612 CTGAAATCAAGGTGTTAGCAAGG + Intergenic
1189649098 X:43169917-43169939 CTGCAATCAAGGTGTCAACCAGG - Intergenic
1189728804 X:43997188-43997210 CTGAGATCAAGGTGTCAGCAGGG - Intergenic
1189729611 X:44005260-44005282 CTAAAATCAAGGTGTCAGCAAGG + Intergenic
1190188090 X:48253437-48253459 TTGAAATCAAGTTGTCAGCAGGG - Intronic
1190371770 X:49749433-49749455 CTGAAATCAGGGTGTCAGCATGG + Intergenic
1190451303 X:50583825-50583847 CTGCAGTCAAGGTGTCAGCCAGG - Intergenic
1190656980 X:52621204-52621226 TTGAAATCAAGTTGTCAGCGGGG - Intergenic
1190748888 X:53344013-53344035 CTGTAATCAAGGTGTCATCCAGG + Intergenic
1190768375 X:53494510-53494532 CTGAAATCAAGGTGTTAGCCAGG + Intergenic
1191025953 X:55913618-55913640 ATGAAATCAAGGTGTCAGCAGGG - Intergenic
1191741840 X:64444579-64444601 CTCAAATCAAGATGTCAACCAGG + Intergenic
1192039450 X:67602739-67602761 CCAAAATCAAGGTGTCAATCAGG - Intronic
1192093698 X:68187527-68187549 CTAAAATCAAGGTGTCAGCAAGG - Intronic
1192412914 X:70950692-70950714 CTGAAATCAAGATGTAGGCCAGG + Intergenic
1192531332 X:71889377-71889399 CTGAAATCAAGGTGTTGGTAGGG - Intergenic
1192572296 X:72216354-72216376 CTGAAATCAAGGTGTCAGCAGGG - Intronic
1192743842 X:73919207-73919229 CTGAAACGAAGATGTCAGCCAGG - Intergenic
1193079978 X:77397274-77397296 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
1193525615 X:82584499-82584521 CTGAAATCAAGATGTCATGAAGG + Intergenic
1193672971 X:84412528-84412550 CTGAAAGTATGCTGTTAGTCTGG + Intronic
1193772158 X:85600593-85600615 TTGGAAGCAAGCTTTCAGTCTGG - Intergenic
1193847006 X:86484489-86484511 CATAAATTAAGCTGTCATTCAGG - Intronic
1194039084 X:88917506-88917528 CTGAAATCAAGCTGTTTTTCAGG - Intergenic
1194164279 X:90495621-90495643 CTGCAATCAAAGTGTAAGTCAGG - Intergenic
1194293076 X:92099416-92099438 CTTAAAGCAAGCTGTGAGCCAGG + Intronic
1194950738 X:100122533-100122555 CTGCAGTCAAGTTGTCAGCCAGG - Intergenic
1195252224 X:103060308-103060330 CTGCAATCAAGATGTTAGCCTGG + Intergenic
1195262050 X:103142076-103142098 CTGAAACCAAGATGTCAATAGGG - Intergenic
1195288154 X:103405339-103405361 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
1195299387 X:103512106-103512128 CTGAAATCCAGGTGTCAATTGGG - Intronic
1195336694 X:103861887-103861909 CTGTAATCAAGCTGCTATTCAGG + Intergenic
1195537136 X:106021765-106021787 CTGAAACCAAGATGTCAGCAGGG + Intergenic
1195664581 X:107417155-107417177 CTGAAATCAAGGTGTAAGCAGGG - Intergenic
1195832880 X:109078823-109078845 ATAAAATCAAGGTGTCAGTTGGG - Intergenic
1195843561 X:109201771-109201793 CTGTAATCAAGGTGTCAGCAGGG - Intergenic
1196118075 X:112018773-112018795 CTGAAATCAAGGTGTCTGGCAGG + Intronic
1196228611 X:113194812-113194834 CTAAAATCAAGGTGTCAGTAAGG - Intergenic
1196265026 X:113633436-113633458 CTGAAATCAAGGTGTCAACAGGG - Intergenic
1196276858 X:113776341-113776363 CTGAAATCAAGGTGTCAGCGGGG - Intergenic
1196352491 X:114747891-114747913 CTGCAATCAAGGTGTCAGCCAGG - Intronic
1196502936 X:116406780-116406802 CTAAAATCAAGGTGTCAGGAGGG + Intergenic
1196668113 X:118337741-118337763 CTGAAACCAAGATGTCAGCCAGG + Intergenic
1196732538 X:118955390-118955412 CTGCAATCAAGGTGTCAGCCAGG - Intergenic
1196778961 X:119365298-119365320 CTGAAATCAAGGTGTTGGCCAGG + Intergenic
1196779804 X:119373565-119373587 CTGAAATCAAGGGGTCAGCAAGG - Intergenic
1197029119 X:121792320-121792342 CCAAAATCAAGGTGTCAGTGGGG + Intergenic
1197183087 X:123557651-123557673 CAGAAATCAAGCTATCAGCAGGG - Intergenic
1197203397 X:123768993-123769015 CTGCAATCAAGGTGTCAGCTGGG + Intergenic
1197249137 X:124196562-124196584 CTAAAATCAAGATGTCAGCAGGG - Intronic
1197422081 X:126249997-126250019 CTGAAATCAAGATGTCAGCAGGG + Intergenic
1197610882 X:128636949-128636971 TTGAAATCAAGGTGTCAGCAGGG + Intergenic
1197657763 X:129136118-129136140 CTGTAATCAAGGTGTCAGCAGGG + Intergenic
1197821148 X:130542149-130542171 CTGAAACCAAGGTGTCATTGGGG + Intergenic
1197831994 X:130652911-130652933 CTGAGATCAAGATTTCAGTAGGG - Intronic
1198176764 X:134164094-134164116 CTGAAATCAAGGTATCAGTAGGG - Intergenic
1198236557 X:134740900-134740922 CTGAAAGCAAGATGTCAGCAGGG - Intronic
1198246440 X:134836473-134836495 CTGAGATAAAGGTGTCAGTAGGG + Intronic
1198256866 X:134931704-134931726 CTGAGATCAAGGTGTCAGTACGG - Intergenic
1198281752 X:135149507-135149529 CTGAAATCAAGTTGTCAGTGAGG + Intergenic
1198284111 X:135172830-135172852 CTGAAATCAAGGTTTCCGTGAGG + Intergenic
1198286476 X:135196336-135196358 CTGAAATCCAGGTGTCAGTGAGG + Intergenic
1198289207 X:135223015-135223037 CTGAAATCAAGTTGTCAGTGAGG - Intergenic
1198433993 X:136597411-136597433 CTGAGATCAAGGTGTCAGCAGGG + Intergenic
1198453476 X:136792006-136792028 CTGAAATCAAGCTGTCAGTAGGG + Intergenic
1198487475 X:137102863-137102885 CTGAAGTCAAAGTGTCAGCCAGG + Intergenic
1199161443 X:144616922-144616944 CTGAAATCAAGGTGTCAGTGGGG - Intergenic
1199570348 X:149261285-149261307 CTGAGATCAAGATGTCAGCAAGG + Intergenic
1199768311 X:150956767-150956789 CTGAAATCAAGGTGTCAGGAGGG - Intergenic
1199880198 X:151968246-151968268 CTGTAATCAAGGTGTCAGCTGGG - Intronic
1199932408 X:152537091-152537113 CAGAAATCAAGCTTTCTGTTAGG + Intergenic
1199936059 X:152574764-152574786 CTGCAATGATGGTGTCAGTCAGG + Intergenic
1200243402 X:154509339-154509361 CTGAAATCAAAGTGTCAGCAGGG - Intronic
1200253553 X:154566972-154566994 CTGCAATCAAGTTGTCAGCAAGG + Intergenic
1200254633 X:154573542-154573564 CTGGAATCCAGCTGTCAGCAGGG + Intergenic
1200263136 X:154630866-154630888 CTGGAATCCAGCTGTCAGCAGGG - Intergenic
1200264214 X:154637436-154637458 CTGCAATCAAGTTGTCAGCAAGG - Intergenic
1200510538 Y:4073431-4073453 CTGCAATCAAAGTGTAAGTCAGG - Intergenic
1200610586 Y:5323964-5323986 CTTAAAGCAAGCTGTGAGCCAGG + Intronic
1201231965 Y:11873629-11873651 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
1201239458 Y:11944690-11944712 CTAAAATCAAAGTGTCAGCCAGG + Intergenic
1201486978 Y:14505327-14505349 CTGAAATCAAGGTGTCTGCCTGG - Intergenic