ID: 955213087

View in Genome Browser
Species Human (GRCh38)
Location 3:56960326-56960348
Sequence CTGATCACACAGATGAAATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 186}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955213081_955213087 29 Left 955213081 3:56960274-56960296 CCCATTTTATAGATAAGAGCACT 0: 2
1: 3
2: 94
3: 732
4: 3248
Right 955213087 3:56960326-56960348 CTGATCACACAGATGAAATTGGG 0: 1
1: 0
2: 3
3: 17
4: 186
955213082_955213087 28 Left 955213082 3:56960275-56960297 CCATTTTATAGATAAGAGCACTG 0: 1
1: 4
2: 106
3: 883
4: 3557
Right 955213087 3:56960326-56960348 CTGATCACACAGATGAAATTGGG 0: 1
1: 0
2: 3
3: 17
4: 186
955213085_955213087 2 Left 955213085 3:56960301-56960323 CCTAGGGATATTAAGTGCTTTGA 0: 1
1: 0
2: 1
3: 17
4: 189
Right 955213087 3:56960326-56960348 CTGATCACACAGATGAAATTGGG 0: 1
1: 0
2: 3
3: 17
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955213087 Original CRISPR CTGATCACACAGATGAAATT GGG Intronic
900725237 1:4212165-4212187 CTGATAAAAAAGAGGAAATTTGG + Intergenic
903198224 1:21709802-21709824 CTGATCTCAGAAATGAATTTGGG - Intronic
904500827 1:30911875-30911897 CTGATCACCCAGAGGACATCAGG - Intergenic
905714499 1:40136649-40136671 CTGGCCACAGACATGAAATTAGG - Intergenic
908884002 1:68766767-68766789 CTGATCACCCTGATATAATTGGG - Intergenic
916587451 1:166160928-166160950 CTGATCTCACAGTTGAAATTGGG - Intronic
919502404 1:198353961-198353983 CTGATCACCAAGAACAAATTAGG + Intergenic
920764091 1:208814782-208814804 CTGATCCAATAGATGATATTAGG + Intergenic
921420163 1:214937878-214937900 CTGATCATAAGGATGAAATGTGG + Intergenic
1063403200 10:5767793-5767815 CTGATCACAGAAATGAAAGGTGG + Intronic
1063506157 10:6601597-6601619 CTGTGAACACAGATGAAGTTTGG + Intergenic
1063724978 10:8627008-8627030 GTGAAAACAGAGATGAAATTGGG - Intergenic
1063770095 10:9187744-9187766 TTGTTCACACAGAGAAAATTTGG + Intergenic
1064256396 10:13746089-13746111 CAGCTCAGAGAGATGAAATTAGG + Intronic
1064433442 10:15290684-15290706 CTGACCACCCAGTTGAAAATAGG - Intronic
1068281739 10:54880661-54880683 CTTATCTCACAGATTAAAATTGG + Intronic
1070120904 10:73575801-73575823 TTGACTACACAGATGATATTTGG - Intronic
1071064394 10:81613867-81613889 ATGATCACACAGAGGAAAAGTGG - Intergenic
1075476764 10:122742290-122742312 GTGATCACTGAGATGTAATTTGG - Intergenic
1076329198 10:129652534-129652556 CTGATCACAAAGTTGAAGGTGGG + Intronic
1077006369 11:359446-359468 CTGATGACACAGATCAAGTGAGG - Intergenic
1079238819 11:18708023-18708045 CTGGTCACACAGATGATATTTGG + Intronic
1079769378 11:24439531-24439553 CTCATCAAACAGAGGCAATTTGG + Intergenic
1080731124 11:34954363-34954385 CTGTGTACACAGATGAGATTAGG + Intronic
1081730507 11:45368801-45368823 CTGTTAAGACAGATGAAAATGGG + Intergenic
1082828872 11:57600653-57600675 GTGATAAGAAAGATGAAATTAGG + Intronic
1083704797 11:64506493-64506515 GAGACCAGACAGATGAAATTAGG + Intergenic
1086385351 11:86301895-86301917 CTGATCACTCCTATAAAATTTGG + Intergenic
1087385000 11:97460021-97460043 ATTATCACACAGAAGAAAATGGG - Intergenic
1087446244 11:98258067-98258089 CTGATCATGTAGAAGAAATTGGG - Intergenic
1087850931 11:103028502-103028524 CTGAGAACACTGATGCAATTAGG + Intergenic
1088448702 11:109959848-109959870 CTGATCTCCCAGGTGGAATTAGG + Intergenic
1089940250 11:122409097-122409119 CTGACTAGACAGATGAAATAAGG - Intergenic
1090434231 11:126673558-126673580 GTGAAAACACAGATGAATTTTGG - Intronic
1091051098 11:132373449-132373471 CTGATCACTCACCTGATATTTGG - Intergenic
1092593270 12:9971388-9971410 CTGAAGCCACAGATGAGATTTGG + Intronic
1092648280 12:10603645-10603667 CACATCACACAGTTCAAATTAGG + Intergenic
1093868362 12:24256380-24256402 TTGACCACGAAGATGAAATTGGG + Intergenic
1095109679 12:38279282-38279304 ATGAACACACAGATGAAAGGTGG - Intergenic
1095917703 12:47497056-47497078 CTGAACTCACATTTGAAATTAGG + Intergenic
1096480888 12:51940232-51940254 CTGATCAGACTGATGATGTTGGG - Intergenic
1098542301 12:71670485-71670507 CTCACCACACAGTTGAAAATCGG + Intronic
1098987290 12:77026171-77026193 ATGATCACACAGATAAATGTGGG - Intronic
1100707698 12:97219576-97219598 CTGATAACACTGAGGAAATGGGG - Intergenic
1100931507 12:99615124-99615146 GTGTTTACACAGATGACATTAGG + Intronic
1101532074 12:105582400-105582422 CCAATGACACAGAGGAAATTAGG - Intergenic
1101731716 12:107432265-107432287 CTGAGGACACTGATGGAATTGGG + Intronic
1102074546 12:110049294-110049316 CTCTTCACACACATGAAACTGGG - Intronic
1102399576 12:112616822-112616844 CTGATCCAACAGCTGAAATTTGG + Intronic
1102420349 12:112798604-112798626 CGGACCACACAGATGCCATTTGG - Intronic
1103597101 12:122030589-122030611 CAGATCACACAGATGAGGGTTGG - Intronic
1105392210 13:19990930-19990952 TTGATCTCACAGATCAAACTTGG - Intronic
1106610613 13:31276081-31276103 CTGATCACACAGATGAAAGGGGG - Intronic
1108473987 13:50795274-50795296 CTGATCTCACAGGTAAAGTTGGG - Intronic
1109814236 13:67558859-67558881 CTCAGCACACAGATGAATTTTGG - Intergenic
1110700823 13:78546211-78546233 ATAACCACACAGATGAGATTTGG + Intergenic
1110957419 13:81572605-81572627 CAGACCACACAGACCAAATTAGG - Intergenic
1113817227 13:113181365-113181387 TTGATCACAGAAATGAAACTGGG - Intronic
1114185389 14:20397602-20397624 CTAATCAAATAGAAGAAATTGGG - Intronic
1115193174 14:30768891-30768913 CTGAACAAACAGATGAACTTTGG + Intergenic
1115789082 14:36858528-36858550 CTCATCACACAAAAGAAAATGGG - Intronic
1116563170 14:46409715-46409737 CTGATTCCACATATTAAATTTGG + Intergenic
1118090280 14:62467817-62467839 CTGAACACACAGGTAAAATTAGG - Intergenic
1118123311 14:62870506-62870528 CAGATCACACACATAAAAATAGG + Intronic
1125672972 15:41486695-41486717 CAGAGCTCACAGATGGAATTAGG + Intergenic
1126616006 15:50580721-50580743 CTCTTCACATAGATGAGATTAGG - Intronic
1127750458 15:62035832-62035854 CTCATGACACAGATGAACTATGG + Intronic
1129206882 15:74042499-74042521 CTGCTCAGAAAGATGAAATTAGG + Intronic
1129865729 15:78907119-78907141 CTGATTACCAAGAAGAAATTTGG + Intergenic
1130955971 15:88627669-88627691 CTCATCACACAGGTGAACTAGGG + Intronic
1131060019 15:89398931-89398953 CTGGTCACAGAGATGAGATCTGG - Intergenic
1131384415 15:91991375-91991397 CTGTTAACACATATAAAATTGGG - Intronic
1135246200 16:20859389-20859411 CTGTTTACATAGATGAATTTAGG - Exonic
1135956271 16:26958959-26958981 CTGACCACACAGATGAAGCCAGG - Intergenic
1140060832 16:71568250-71568272 ATGACCACTCGGATGAAATTCGG + Exonic
1143691628 17:8571942-8571964 CTCATCACATAGATTGAATTAGG - Intronic
1148100215 17:45085555-45085577 TTGATCACAAAGATTATATTTGG + Intronic
1148570001 17:48660651-48660673 CTGTTCACACAGATAAAACTAGG - Intergenic
1149233258 17:54561001-54561023 ATGTTCACAAAGATCAAATTTGG - Intergenic
1151600653 17:75104203-75104225 CTGGTCACACAGATGAACCCTGG - Intronic
1152519471 17:80846743-80846765 CGGATCACACAGATCCAATCAGG + Intronic
1153658041 18:7302747-7302769 CTGTTCACAGAGATGGAACTCGG + Intergenic
1155443265 18:25884271-25884293 GTGATCACTCACCTGAAATTTGG - Intergenic
1157241862 18:46018263-46018285 CAGACCACTCTGATGAAATTTGG + Intronic
1157958308 18:52124016-52124038 TTGAAGACACAGATGAAAGTAGG + Intergenic
1159349924 18:67259118-67259140 CTGGTCACATAGATAAAATTAGG + Intergenic
1166352996 19:42209437-42209459 CTGAATACACAAATGAAACTAGG + Intronic
925774957 2:7325880-7325902 CTGGTTTCACAGATAAAATTTGG + Intergenic
927877313 2:26666871-26666893 CTGAGCACAGAGAGGAAACTAGG + Intergenic
931060105 2:58518628-58518650 CTCATCACACAGAGGCAGTTAGG + Intergenic
932006170 2:67929294-67929316 CTGATCTCACAGAAGAGACTGGG - Intergenic
933131879 2:78682142-78682164 CTGGTCACATAGATGAACTCAGG - Intergenic
936800193 2:116257181-116257203 CAGATAACAAAGATGAGATTTGG + Intergenic
937721722 2:125105148-125105170 CTGATCTCATAGATACAATTAGG + Intergenic
940483451 2:154265752-154265774 CTGATCTCACAGAATGAATTGGG - Intronic
941245330 2:163088724-163088746 CTGTCCACACAGATGAGTTTAGG + Intergenic
942907514 2:181201614-181201636 TTAATAACACAGATGAAAATGGG + Intergenic
943118033 2:183697902-183697924 GTGGTCAGACAGATGAAATATGG + Intergenic
944782270 2:203031917-203031939 CTGATCACACAGATCAACAATGG - Intronic
944951369 2:204753572-204753594 CTGATTACACAGCTGGAACTAGG - Intronic
946878885 2:224158098-224158120 CTAATCACACAGACCAACTTGGG + Intergenic
1170550861 20:17474845-17474867 CTGAGCCCACAGATGGAATGAGG + Intronic
1172005232 20:31815060-31815082 CAGGACACAGAGATGAAATTGGG - Intergenic
1176697031 21:9990451-9990473 ATGAGCACACAGAAGTAATTTGG - Intergenic
1179274923 21:39883399-39883421 CTGATGACAAAGAAGAAATGTGG - Intronic
1179443882 21:41418066-41418088 ATGAACACACAGCTGAAAGTGGG + Intergenic
1183126487 22:35786838-35786860 GTGATTTCACATATGAAATTGGG - Intronic
949730663 3:7108863-7108885 CTTATCACACAGGAGAAAATTGG - Intronic
950909198 3:16570552-16570574 GTGGTCACACAGGTGAAATTTGG + Intergenic
952531332 3:34265194-34265216 CTGAGCACAGAGCTGGAATTTGG + Intergenic
953248011 3:41214131-41214153 CTGATGGCACACATGAAGTTTGG + Intronic
955213087 3:56960326-56960348 CTGATCACACAGATGAAATTGGG + Intronic
955891743 3:63657500-63657522 CTAATAACACTGATGATATTCGG - Intronic
957199715 3:77116976-77116998 GTGATCACACAGCTGAATATCGG + Intronic
958995195 3:100896177-100896199 CTTATCAAATAGATGGAATTAGG - Intronic
959605878 3:108241652-108241674 CTGGTGACCCAGATGGAATTGGG + Intergenic
959669350 3:108957547-108957569 CTGATCAAACAGGTGAAAAGTGG - Intergenic
960946788 3:122972587-122972609 ATGATCCCACAGATGTAACTGGG + Intronic
963210678 3:142686294-142686316 CTGATTAAGCAGATGAAAATAGG - Exonic
964401378 3:156302868-156302890 CTGATTACAGTCATGAAATTTGG - Intronic
966696558 3:182794770-182794792 CTCATCACACAGATAAGGTTAGG - Intronic
969034703 4:4243822-4243844 ATGATCACACATAAGATATTTGG - Intronic
970150526 4:13084588-13084610 CTGATCACCCATGTAAAATTTGG + Intergenic
970231945 4:13919903-13919925 GTAAACACACAGCTGAAATTTGG + Intergenic
973692946 4:53458012-53458034 CTGCCCACACAGATGTAATTAGG + Intronic
975159479 4:71109448-71109470 CTGATCACAGAGATGCAACAGGG - Intergenic
977793622 4:101136239-101136261 TTGATAGCACAGATGATATTTGG - Intronic
979519860 4:121653514-121653536 CTGGTCACACAGAGGAATCTAGG + Intergenic
979754186 4:124319524-124319546 TAGATTACACATATGAAATTAGG - Intergenic
980520132 4:133921109-133921131 CTGATTACCCAGGGGAAATTGGG - Intergenic
983823254 4:172224258-172224280 CTCAGCTCACATATGAAATTAGG - Intronic
983971806 4:173884502-173884524 TTAATGACACAGATGAATTTTGG - Intergenic
986208639 5:5649366-5649388 CTGATTACATAGATGACTTTGGG + Intergenic
988391228 5:30634928-30634950 CTTATCAAAAAAATGAAATTAGG - Intergenic
989443327 5:41498640-41498662 CTGATCTCACAGAATGAATTTGG - Intronic
991452034 5:66762073-66762095 ATGATCTCAAACATGAAATTTGG + Intronic
994924918 5:106102561-106102583 TTGATCTCACAGAAGAAATGGGG + Intergenic
996507321 5:124282480-124282502 CTGATAACACATATGAGAATGGG - Intergenic
996758484 5:126961686-126961708 CTCATCAAACATATGTAATTTGG + Intronic
998038840 5:138938032-138938054 CGGGTCGCACAGATGAAATGGGG - Intergenic
999010152 5:148028963-148028985 CTAATCACATAAATGTAATTAGG + Intronic
999865847 5:155699659-155699681 CTGATCACCAAGAAGAAGTTGGG + Intergenic
1000433001 5:161173325-161173347 CTGATCAGAAAGTTGAAACTTGG - Intergenic
1000498729 5:162021015-162021037 CTGATCACACAAGTGATACTGGG - Intergenic
1000969791 5:167701087-167701109 GTGGTCACACAGATGAAATGTGG - Intronic
1004007902 6:11653768-11653790 CAGAACACACACATGAAATCAGG - Intergenic
1005148718 6:22722766-22722788 CTGAGGACAAAGATGAAATCTGG + Intergenic
1008029306 6:46675402-46675424 ATGATGACATAGATGAAATAAGG - Intronic
1008108036 6:47461416-47461438 CTGAGCAGTCAGATGAAATGAGG - Intergenic
1008124816 6:47656246-47656268 CTGAGCCTAAAGATGAAATTTGG - Intergenic
1008637514 6:53425667-53425689 TTGAACACACATAGGAAATTGGG - Intergenic
1009698811 6:67147109-67147131 CTCATCACACACATGAAAGGGGG - Intergenic
1009991461 6:70847573-70847595 ATGAGCAAACAGAAGAAATTAGG - Intronic
1011852036 6:91640994-91641016 CTGATCACACAGAAGCAAATAGG + Intergenic
1014295767 6:119615327-119615349 CTGATCACTAAGAAGAAATGAGG - Intergenic
1014584202 6:123179058-123179080 CTGATCACACACATCTAATTTGG + Intergenic
1014774883 6:125497299-125497321 CTCATCAAAGAGATGATATTAGG + Intergenic
1014993780 6:128115502-128115524 CTGATCATAAAAATAAAATTAGG + Intronic
1015321436 6:131880233-131880255 CTCATTTCACAGAAGAAATTTGG - Intronic
1019496509 7:1342883-1342905 GTGGACACACAGATGAGATTTGG - Intergenic
1020911237 7:14134276-14134298 ATGATCACACAGCTCAAAGTAGG - Intergenic
1020927260 7:14346601-14346623 CTGCTCACATATATGAAATCAGG - Intronic
1023005753 7:35865282-35865304 GTGAGCACACAGAAGAAACTAGG - Intronic
1024225597 7:47324357-47324379 TTAAGTACACAGATGAAATTGGG + Intronic
1024725099 7:52185096-52185118 CTGCACACAAATATGAAATTTGG - Intergenic
1024808721 7:53182006-53182028 ATGATCACCTAGATGACATTTGG + Intergenic
1027741359 7:82010441-82010463 CTGATAGCACAAATGACATTAGG - Intronic
1028088027 7:86660911-86660933 TTGAGCACACATATTAAATTTGG + Intronic
1028322446 7:89477047-89477069 CTGGTCACAGAGAATAAATTAGG + Intergenic
1028900939 7:96100008-96100030 CTGATGTCCCAGATGAAATGTGG + Intronic
1030687310 7:112500064-112500086 CTAATCACTCAGATGAACTATGG - Intergenic
1032255438 7:130293414-130293436 CTGATTTCACAGATGAAATGGGG - Intronic
1033583020 7:142753604-142753626 CTGCTCACAGAGATGGAACTAGG - Intronic
1033584569 7:142764526-142764548 CTGCTCACAGAGATGGAACTAGG - Intergenic
1033586047 7:142775081-142775103 CTGCTCACAGAGATGGAACTAGG - Intergenic
1035816018 8:2541638-2541660 ATGATCACACTGTTGAAAATTGG + Intergenic
1038660810 8:29495078-29495100 CTGATAACACAGTTGAAAGAAGG + Intergenic
1041930938 8:63285590-63285612 TTAATCACACAGATGAACATGGG - Intergenic
1043213444 8:77553346-77553368 CTCATCAAATAGATGAAATTAGG + Intergenic
1044185950 8:89252457-89252479 CTTATAAAACAGAAGAAATTGGG - Intergenic
1047274024 8:123391644-123391666 CTGATCACCCTGATTATATTTGG - Intronic
1052181926 9:25539868-25539890 CTGACCACACAGGGGAAATGTGG - Intergenic
1052287764 9:26806239-26806261 GGCATCACACAGATGAAACTTGG + Intergenic
1052901789 9:33799742-33799764 CTGCTCACAGAGATGGAACTAGG - Intergenic
1053634015 9:39976303-39976325 ATGAGCACACAGAAGTAATTTGG - Intergenic
1053771732 9:41487201-41487223 ATGAGCACACAGAAGTAATTTGG + Intergenic
1054209872 9:62274394-62274416 ATGAGCACACAGAAGTAATTTGG + Intergenic
1054315123 9:63574560-63574582 ATGAGCACACAGAAGTAATTTGG - Intergenic
1056547379 9:87624095-87624117 TTGATCACAAATCTGAAATTAGG + Intronic
1056853630 9:90105764-90105786 GTGTTCACACAGATGAAATAAGG - Intergenic
1056882229 9:90406678-90406700 TTTATAACACAGATGAAATAAGG - Intergenic
1059969820 9:119654399-119654421 AAGACCACACAGATGGAATTGGG + Intergenic
1185595248 X:1302408-1302430 CAGATCACACAGACAAAATGGGG + Intronic
1186299807 X:8187920-8187942 CTGAACACACAGAAGAAATGGGG + Intergenic
1186418497 X:9404529-9404551 CTGATCACACAGAAGGCATTTGG + Intergenic
1186418606 X:9405460-9405482 CTGATCACACAGGAGGCATTTGG + Intergenic
1186418838 X:9407436-9407458 CTGATCACACAGGAGGCATTTGG + Intergenic
1186418948 X:9408367-9408389 CTGATCACACAGGGGGCATTTGG + Intergenic
1186419057 X:9409298-9409320 CTGATCACACAGGAGGCATTTGG + Intergenic
1186419166 X:9410229-9410251 CTGATCACACAGGAGGCATTTGG + Intergenic
1186419524 X:9413251-9413273 CTGATCACACAGGAGGCATTTGG + Intergenic
1194806677 X:98337775-98337797 CTCATCTGACTGATGAAATTTGG + Intergenic
1197256161 X:124265516-124265538 CTGATACCACTGATGAAAATGGG - Intronic
1197950911 X:131895506-131895528 ATGTTCACAAAGATGAAATCTGG + Intergenic
1198491828 X:137148752-137148774 CTGATTACACACAGGAAATCAGG - Intergenic
1200317134 X:155145982-155146004 CTTTTCACACTGATAAAATTTGG - Intronic
1200855858 Y:7937524-7937546 CATAGCACACAGATGACATTTGG - Intergenic