ID: 955214648

View in Genome Browser
Species Human (GRCh38)
Location 3:56974931-56974953
Sequence TTCCCACGCACCGACACTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 55}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955214644_955214648 3 Left 955214644 3:56974905-56974927 CCAGGACTCCTTGTTTGTGCTCT 0: 1
1: 0
2: 2
3: 18
4: 231
Right 955214648 3:56974931-56974953 TTCCCACGCACCGACACTGAGGG 0: 1
1: 0
2: 1
3: 3
4: 55
955214641_955214648 24 Left 955214641 3:56974884-56974906 CCCGAGAGTGTATTTTTCTAACC 0: 1
1: 0
2: 2
3: 15
4: 252
Right 955214648 3:56974931-56974953 TTCCCACGCACCGACACTGAGGG 0: 1
1: 0
2: 1
3: 3
4: 55
955214645_955214648 -5 Left 955214645 3:56974913-56974935 CCTTGTTTGTGCTCTGCCTTCCC 0: 1
1: 0
2: 4
3: 50
4: 441
Right 955214648 3:56974931-56974953 TTCCCACGCACCGACACTGAGGG 0: 1
1: 0
2: 1
3: 3
4: 55
955214642_955214648 23 Left 955214642 3:56974885-56974907 CCGAGAGTGTATTTTTCTAACCA 0: 1
1: 0
2: 2
3: 23
4: 332
Right 955214648 3:56974931-56974953 TTCCCACGCACCGACACTGAGGG 0: 1
1: 0
2: 1
3: 3
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955214648 Original CRISPR TTCCCACGCACCGACACTGA GGG Intronic
902834635 1:19038635-19038657 GTCCCCCGCCCAGACACTGAGGG + Intergenic
906186469 1:43865910-43865932 ATCCCACCCACTGACACTTACGG - Intronic
908613977 1:65896601-65896623 TTCCTATTCACCAACACTGAGGG + Intronic
913344555 1:117795306-117795328 TTCCCATGCACCAACTCTGCTGG - Intergenic
914794462 1:150908375-150908397 TTCCCACCAACCGTCAATGAGGG + Intergenic
916712890 1:167427553-167427575 GTCCCACGAAACCACACTGAGGG - Intergenic
917741992 1:177969873-177969895 TTCCCACACACCTGCTCTGATGG + Exonic
921824826 1:219660833-219660855 TTCCCAAGCACCCCCACGGATGG - Intergenic
1063598808 10:7461693-7461715 CTCCCCAGCACCGACACTGCTGG - Intergenic
1064290803 10:14032564-14032586 TTCCCAGGCAGCAACAGTGAGGG - Intronic
1067757857 10:49018766-49018788 TTCCCACTCTCCTACCCTGAGGG + Exonic
1076502882 10:130950880-130950902 TTCCCCCCCATGGACACTGATGG + Intergenic
1076617084 10:131762121-131762143 TTCCCACTCACTTACACTCATGG - Intergenic
1084169102 11:67391955-67391977 TTCCCGCGCACCGCCCCTGCCGG - Exonic
1085789580 11:79485601-79485623 GTCCCACGTACTGACAATGAGGG + Intergenic
1089215657 11:116833092-116833114 TTCCCATGCCCAGACACAGATGG - Intergenic
1098390931 12:69969222-69969244 TGCCAAGGCACAGACACTGATGG - Intergenic
1113653605 13:112055225-112055247 GCGCCCCGCACCGACACTGAGGG + Intergenic
1114352989 14:21874795-21874817 TTCTCATGCACCAATACTGATGG - Intergenic
1118828717 14:69408496-69408518 CTCCCAGGCACTGACACTGAAGG - Intronic
1122322004 14:100860883-100860905 TTCCCACATGCAGACACTGAAGG - Intergenic
1127332243 15:57950642-57950664 TTCCCACGCACAGACACTGGAGG - Intergenic
1129274584 15:74436598-74436620 TTCCCACTCACAGCCAGTGATGG + Intergenic
1146681818 17:34814005-34814027 TGCCCACACTCCTACACTGATGG + Intergenic
1152864424 17:82713780-82713802 TGCACACGCACCCACACTGCAGG - Intergenic
1154039003 18:10835111-10835133 TTGCCAGGCACCGACTCTGTTGG + Intronic
1156449708 18:37259866-37259888 TTCCTACGCACCTACACAGGAGG - Intronic
1157331997 18:46710894-46710916 TCCCCACCCCCAGACACTGATGG + Intronic
935116536 2:100142229-100142251 TGCACACGCACACACACTGACGG + Intronic
1171181858 20:23096862-23096884 TTCGCGGGCACTGACACTGAGGG + Intergenic
1171396463 20:24837059-24837081 TTACCATGCACGGACATTGACGG + Intergenic
1172320019 20:33989119-33989141 TTCCCACCCACTGTGACTGACGG - Intergenic
1179378440 21:40875123-40875145 TGCCCAGGCACTGATACTGATGG + Intergenic
1183751592 22:39724064-39724086 TTCCCAAGCACCTACACTGTGGG - Intergenic
1185079964 22:48704156-48704178 TTCTCTAGCACCAACACTGAAGG - Intronic
955214648 3:56974931-56974953 TTCCCACGCACCGACACTGAGGG + Intronic
955304872 3:57820446-57820468 TTCCCACACCCCAAAACTGATGG - Intronic
957531855 3:81450826-81450848 TTCCCATGCACCCACATTTAAGG - Intergenic
960488518 3:118281889-118281911 TCCCCACTTACTGACACTGATGG - Intergenic
969306304 4:6327985-6328007 ATCCCACACACCAACCCTGATGG + Intronic
972287504 4:37663040-37663062 TTCCCACAGACCCTCACTGATGG + Intronic
985705378 5:1397693-1397715 TTCCCACACACCAATAGTGAGGG + Intronic
999076262 5:148798618-148798640 TTGCCAGGCCCCGACACTGGAGG - Intergenic
999690833 5:154144575-154144597 TTCCCAGGCAAAGTCACTGAGGG + Intronic
1004316662 6:14594003-14594025 TTCCCAAACACAGGCACTGATGG + Intergenic
1007769742 6:44183288-44183310 TTCCCAAACACCCACCCTGATGG + Intronic
1009752998 6:67896736-67896758 TTTTCATGCACTGACACTGATGG - Intergenic
1014786122 6:125621524-125621546 TTCCCAAGCACCTACATTGCAGG + Intergenic
1016348840 6:143145603-143145625 TTCCCAGGCTCCCACACTGCTGG - Intronic
1020705188 7:11535402-11535424 TTACTACACACCAACACTGAAGG + Intronic
1023246581 7:38211367-38211389 TCCCCAAGCTCCCACACTGAAGG - Intronic
1031086158 7:117303572-117303594 TTCCCATGCACAGCCGCTGATGG + Intronic
1041762613 8:61383207-61383229 TGCCCACGCAGTGACACTGGAGG + Intronic
1050240466 9:3629173-3629195 TTCTCTTGCACAGACACTGATGG + Intergenic
1053072759 9:35110977-35110999 TTCCCACGGACCACCACTGTGGG + Exonic
1186472617 X:9833169-9833191 TTCCCACACACAGACAGTGAAGG - Intronic
1188477689 X:30604555-30604577 TTCCCAGGCACTAACACAGAAGG - Intergenic
1189839484 X:45058537-45058559 TTCCCAAGTAACAACACTGAGGG - Intronic
1192299590 X:69886113-69886135 TTCCCACACAGGGACACAGAGGG + Intronic
1200047871 X:153412085-153412107 TGCCCAGGCACCGGCCCTGAGGG + Intergenic