ID: 955216050

View in Genome Browser
Species Human (GRCh38)
Location 3:56985825-56985847
Sequence ACATACCCACAGGTGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 488
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 467}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955216050 Original CRISPR ACATACCCACAGGTGGGGCT GGG Intronic
900428545 1:2591623-2591645 ACATGCCCACAGGTGTGGTGCGG - Exonic
900654824 1:3751354-3751376 AAATACCCACAGGTGTGGATGGG + Intergenic
900907895 1:5573616-5573638 ATATACCCACAGGTGTGGAGGGG - Intergenic
901830808 1:11891123-11891145 AAATACCCACAGGTGTGGAGGGG + Intergenic
901879987 1:12188213-12188235 ACATACCCACAGGGGGTGGAAGG + Intronic
901902770 1:12380062-12380084 ACATACACAAATGCGGGGCTGGG - Intronic
901955849 1:12784963-12784985 AAATACCCACAGGTGTGGAGTGG - Intergenic
901979223 1:13021011-13021033 AAATACCCACAGGTGTGGAGTGG - Intronic
902002859 1:13207927-13207949 AAATACCCACAGGTGTGGAGTGG + Intergenic
902022086 1:13353691-13353713 AAATACCCACAGGTGTGGAGTGG + Intergenic
902066405 1:13691854-13691876 ACACACACACAGGCAGGGCTTGG + Intergenic
902066880 1:13695854-13695876 ACATACTCACGGTAGGGGCTGGG - Intergenic
904004924 1:27358602-27358624 ACATACCCACCTGTGGGGGGAGG + Exonic
904466942 1:30713898-30713920 ACCCACTCAGAGGTGGGGCTGGG - Intronic
905380733 1:37559688-37559710 AAATACCCACAGGTGTGGAGGGG - Intronic
905628455 1:39504614-39504636 AAATACCCACAGGTGTGGAGGGG - Intronic
905775553 1:40665388-40665410 ACTTACCCGGAGGTGGGGCCGGG + Exonic
906200799 1:43958937-43958959 ACATTCCCACAGGTGGGGGTTGG - Intronic
906395233 1:45457296-45457318 ACATACACACATGTGTGGCTGGG + Intronic
906508290 1:46395877-46395899 AAATACCCACAGGTGTGGAGGGG - Intronic
906601591 1:47134166-47134188 AAATACCCACAGGTGTGGAGGGG + Intergenic
907048622 1:51315116-51315138 AAGTTTCCACAGGTGGGGCTGGG - Intronic
907254485 1:53168252-53168274 AAATACCCACAGGTGTGGAGGGG - Intergenic
907403731 1:54241158-54241180 ACACACCCACAGGGGCCGCTTGG - Intronic
908024661 1:59938172-59938194 AAATACCCACAGGTGTGGAGGGG - Intergenic
911595382 1:99793570-99793592 AAATACCCACAGGTGTGGAGGGG - Intergenic
912450969 1:109767579-109767601 AAATACCCACAGGTGTGGAGGGG + Intronic
912583986 1:110745181-110745203 GGATTCCCACATGTGGGGCTTGG + Intergenic
912814311 1:112816793-112816815 AAATACCCACAGGTGTGGAGGGG - Intergenic
914441256 1:147709423-147709445 AAATACCCACAGGTGTGGAGGGG - Intergenic
914773204 1:150710176-150710198 AAATACCCACAGGTGTGGAGGGG + Intronic
914880040 1:151540121-151540143 ATTTACACAAAGGTGGGGCTTGG - Intergenic
916103601 1:161413585-161413607 AAATACCCACAGGTGTGGAGGGG + Intergenic
916106268 1:161434889-161434911 AAATACCCACAGGTGTGGAGGGG + Intergenic
916630266 1:166605379-166605401 AAATACCCACAGGTGTGGAGGGG - Intergenic
916630765 1:166610045-166610067 AAATACCCACAGGTGTGGACGGG - Intergenic
917599001 1:176556877-176556899 AGAGACCCAAAGGAGGGGCTGGG + Exonic
918413772 1:184286875-184286897 AATTCCCCACAGATGGGGCTGGG - Intergenic
919484442 1:198129697-198129719 AAATACCCACAGGTGTGGAGGGG - Intergenic
919767628 1:201137299-201137321 ACAGATCCACAGCGGGGGCTGGG + Intronic
920397973 1:205660289-205660311 ACATTAGCACAGCTGGGGCTGGG - Intronic
921124913 1:212168866-212168888 AAATATCCTCAGGTGAGGCTGGG - Intergenic
921821117 1:219618592-219618614 ATATACCCACAGGTGTGGAGCGG - Intergenic
922398478 1:225226616-225226638 AAATACCCACAGGTGTGGAGGGG - Intronic
922484968 1:225966821-225966843 AAATACCCACAGGTGTGGAGGGG + Intergenic
923936102 1:238762310-238762332 AAATACCCACAGGTGTGGAGGGG - Intergenic
924162518 1:241247420-241247442 AAATACCCACAGGTGTGGAGCGG - Intronic
1063306167 10:4902970-4902992 AAATACCCACAGGTGTGGAGGGG - Intergenic
1063677923 10:8158288-8158310 ACATGGCCACACGTGAGGCTTGG + Intergenic
1064637693 10:17386199-17386221 ACATACACACAGGCCGGGCGCGG + Intronic
1065809416 10:29427703-29427725 AAATACCCACAGGTGTGGAAGGG + Intergenic
1067055015 10:43045173-43045195 ACACACGCAGAGGTGGGGGTGGG + Intergenic
1067179395 10:43973415-43973437 TCATACCCTCAGGATGGGCTCGG - Intergenic
1067710427 10:48647101-48647123 ACATACAAACAGGCTGGGCTTGG + Intronic
1069677379 10:70258184-70258206 AAATACCCACAGGTGTGGAGAGG + Intronic
1069710998 10:70488702-70488724 ACATGCCCTGAGCTGGGGCTTGG + Intronic
1069794905 10:71045853-71045875 AGAGACCTGCAGGTGGGGCTGGG + Intergenic
1070998390 10:80806874-80806896 AAATACCCACAGGTGTGGAGGGG + Intergenic
1071082105 10:81824846-81824868 ACATCCCAACAAGTGGGCCTGGG + Intergenic
1072541844 10:96404231-96404253 AAATACCCACAGGTGTGGAGGGG + Intronic
1072708648 10:97700809-97700831 AAATACCCACAGGTGTGGAGGGG + Intergenic
1073106230 10:101033548-101033570 AAATACCCACAGGTGTGGAGGGG - Intronic
1074434389 10:113421473-113421495 ACATACATACAGGCTGGGCTGGG + Intergenic
1076573215 10:131446041-131446063 ACATCCATACAGGTGTGGCTGGG + Intergenic
1076940232 10:133600486-133600508 AAATACCCACAGGTGTGGAGGGG + Intergenic
1076941302 10:133611143-133611165 AAATACCCACAGGTGTGGAGGGG + Intergenic
1076980613 11:202669-202691 AAATACCCACAGGTGTGGAGAGG + Intronic
1077025467 11:438028-438050 ACATTCTCAAAGGTGGGGGTGGG + Intronic
1077408507 11:2393055-2393077 ACACACCCAGATTTGGGGCTCGG - Intronic
1077585356 11:3447441-3447463 AAATACCCACAGGTGTGGAAGGG - Intergenic
1077597456 11:3546338-3546360 AAATACCCACAGGTGTGGAGGGG + Intergenic
1077603854 11:3593674-3593696 AAATACCCACAGGTGTGGAGGGG - Intergenic
1077703072 11:4459448-4459470 AAATACCCACAGGTGTGGAGGGG - Intergenic
1077703189 11:4460481-4460503 AAATACCCACAGGTGTGGAGGGG - Intergenic
1080567592 11:33526014-33526036 AAAAACCATCAGGTGGGGCTGGG - Intergenic
1081695873 11:45108726-45108748 ACATAGCTACAGGCAGGGCTGGG - Intronic
1082037854 11:47660162-47660184 ACATACCCGTAGGTGAGCCTGGG - Exonic
1082706809 11:56502595-56502617 AAATACCCACAGGTGTGGAGGGG - Intergenic
1082969628 11:59005688-59005710 AAATACCCACAGGTGTGGAGGGG + Intronic
1083146107 11:60760071-60760093 AAATACCCACAGGTGTGGAGGGG + Intronic
1083330601 11:61896681-61896703 ACATCCCTACAGGTGGGGAGGGG + Intergenic
1083375499 11:62216904-62216926 AAATACCCACAGGTGTGGAGGGG + Intergenic
1083467716 11:62859851-62859873 AAATACCCACAGGTGTGGAGGGG - Intronic
1083677268 11:64333094-64333116 CCATCCACACAGGCGGGGCTGGG - Intergenic
1083875736 11:65523730-65523752 AAATACCCACAGGTGTGGAGGGG + Intergenic
1084242261 11:67830000-67830022 AAATACCCACAGGTGTGGAGGGG - Intergenic
1084253561 11:67922243-67922265 AAATACCCACAGGTGTGGAGGGG + Intergenic
1084482472 11:69429943-69429965 GCATACCCTCAGCTAGGGCTGGG + Intergenic
1084544467 11:69807804-69807826 CCTTACACACAGGAGGGGCTGGG - Intergenic
1084799794 11:71535659-71535681 AAATACCCACAGGTGTGGAGGGG + Intronic
1084813016 11:71626989-71627011 AAATACCCACAGGTGTGGAGGGG + Intergenic
1084819321 11:71673683-71673705 AAATACCCACAGGTGTGGAGGGG - Intergenic
1084825693 11:71729959-71729981 ACATTCTTGCAGGTGGGGCTGGG - Intergenic
1084845995 11:71900345-71900367 ACATACCCACAGCTGTGGAGGGG + Intronic
1085391015 11:76182226-76182248 ACACACACACAGGTGAGGCCTGG + Intergenic
1085463983 11:76712075-76712097 AAATACCCACAGGTGTGGAGGGG + Intergenic
1087034815 11:93744710-93744732 AAATACCCACAGGTGTGGAGGGG - Intronic
1088800024 11:113297015-113297037 AAATACCAACAGGTGGGGGCAGG - Intergenic
1088858465 11:113778019-113778041 AAATACCCACAGGTGTGGAGGGG + Intergenic
1089512399 11:119008117-119008139 AAATACCCACAGGTGTGGAGGGG - Intronic
1092234447 12:6797416-6797438 AAATACCCACAGGTGTGGAGGGG - Intronic
1092431053 12:8409233-8409255 AAATACCCACAGGTGTGGAGAGG - Intergenic
1092433948 12:8431422-8431444 AAATACCCACAGGTGTGGAGGGG - Intergenic
1094542137 12:31371434-31371456 ACAAACCCAGAGGTGGGGGTGGG + Intergenic
1094815568 12:34180288-34180310 AAATACCCACAGGTGTGGAGGGG - Intergenic
1095456211 12:42388674-42388696 ATATACCCACAGGTGTGGAGGGG + Intronic
1096125518 12:49116636-49116658 AAATACCCACAGGTGTGGAGGGG + Intergenic
1096585054 12:52614546-52614568 ACAGAGCCAGAGGTGGGGCAGGG + Intronic
1098635831 12:72782122-72782144 ACATGGACACAGGTGGGGGTGGG + Intergenic
1098680488 12:73347947-73347969 AAATACCCACAGGTGTGGAGGGG - Intergenic
1098838131 12:75445782-75445804 AAATACCCACAGGTGTGGAGAGG + Intergenic
1098995658 12:77116563-77116585 ACATTCCCACTGGTGTAGCTGGG + Intergenic
1101576897 12:106006130-106006152 ACATGCCCACAGGTAGGTCAGGG - Intergenic
1103731171 12:123028784-123028806 ACAGACGGGCAGGTGGGGCTGGG + Intronic
1104238024 12:126958690-126958712 AAATACCCACAGGTGTGGACGGG - Intergenic
1105055009 12:133090551-133090573 AAATACCCACAGGTGTGGAGGGG - Intronic
1105055538 12:133095487-133095509 AAATACCCACAGGTGTGGAGGGG - Intronic
1105545644 13:21348672-21348694 GGAGACCCACAGGTGGGGCCTGG - Intergenic
1108473269 13:50788378-50788400 ACACACGCACAGGAGGGTCTGGG - Intronic
1110710717 13:78647752-78647774 AAATACCCACAGGTGTGGAGGGG + Intronic
1110880494 13:80566456-80566478 ACTTAACTACAGGTGGGGCTGGG - Intergenic
1112367197 13:98765314-98765336 AAATACCCACAGGTGTGGAGGGG + Intergenic
1113509028 13:110837247-110837269 AAATACCCACAGGTGTGGAGGGG - Intergenic
1113537385 13:111078707-111078729 ACAAACCCACAGTTTGGGGTAGG - Intergenic
1113970092 13:114181926-114181948 AAATACCCACAGGTGTGGAGGGG - Intergenic
1114167973 14:20241571-20241593 AAATACCCACAGGTGTGGAGGGG - Intergenic
1114374994 14:22135374-22135396 ATATACCCAGAGGTAGGGTTTGG - Intergenic
1114603169 14:23972586-23972608 AAATACCCACAGGTGTGGAGGGG - Intronic
1114604013 14:23981507-23981529 AAATACCCACAGGTGTGGAGGGG - Intronic
1114607535 14:24009711-24009733 AAATACCCACAGGTGTGGAGGGG - Intergenic
1114608147 14:24015067-24015089 AAATACCCACAGGTGTGGAGGGG - Intergenic
1114609031 14:24024312-24024334 AAATACCCACAGGTGTGGAGGGG - Intergenic
1114649959 14:24278205-24278227 ACATACCTGGAGGTGGGGCCAGG + Intergenic
1117295957 14:54378976-54378998 AAATACCCAAAGGTGGGTTTTGG + Intergenic
1117335339 14:54752620-54752642 AAATACCCACAGGTGTGGAGGGG - Intronic
1118807461 14:69250557-69250579 ACACAGGCCCAGGTGGGGCTGGG - Intergenic
1119599348 14:75964593-75964615 ACATAGCTACAGGAGTGGCTCGG + Intronic
1121295669 14:92819995-92820017 ATATACCCACAGGTGTGGAGGGG - Intronic
1121533067 14:94672089-94672111 TCATACCCCCAGCTAGGGCTGGG + Intergenic
1121702994 14:95970387-95970409 ACTTACCCACAGGATGGGCCTGG - Intergenic
1121736589 14:96222202-96222224 ACAGACCCACACGTGGGGCAGGG + Intronic
1122997687 14:105274437-105274459 ATATACCCACAGGTGTGGAGGGG + Intronic
1123052513 14:105552617-105552639 AAATACCCACAGGTGTGGAGGGG - Intergenic
1123052934 14:105555770-105555792 AAATACCCACAGGTGTGGAGGGG + Intergenic
1123077516 14:105676169-105676191 AAATACCCACAGGTGTGGAGGGG + Intergenic
1124927713 15:34087858-34087880 AAAAACCCACAGGTGGGGCCAGG + Intronic
1126003006 15:44229576-44229598 AAATACCCACAGGTGTGGAGGGG + Intergenic
1127832072 15:62759753-62759775 ATGTAGCCACTGGTGGGGCTGGG + Intronic
1128252803 15:66174674-66174696 ATAGCCCCACAGGTGGGGCTGGG - Intronic
1128649135 15:69397705-69397727 AAATACCCACAGGTGTGGAGGGG - Intronic
1128800372 15:70493118-70493140 ACCCACCCACAGGCGGGGCAGGG + Intergenic
1129852763 15:78803853-78803875 ACAAAACCACAGGTGCTGCTGGG + Intronic
1129987943 15:79935261-79935283 AAATACCCACAGGTGTGGAGGGG - Intergenic
1131194741 15:90346576-90346598 AAATACCCACAGGTGTGGAGGGG - Intergenic
1131275078 15:90974033-90974055 AAATACCCACAGGTGTGGAGGGG + Intronic
1131946605 15:97629117-97629139 AAATACCCACAGGTGTGGAGGGG - Intergenic
1132678560 16:1130629-1130651 ACACATCCACAGGTGGGCCCAGG - Intergenic
1132831726 16:1931820-1931842 AAATACCCACAGGTGTGGAGGGG + Intergenic
1133214518 16:4283499-4283521 CCATACCCTCAAGTGGGTCTGGG + Intergenic
1133777333 16:8907281-8907303 ACATACCAACAGGTTGGAATTGG + Intronic
1133930023 16:10224422-10224444 CACAACCCACAGGTGGGGCTGGG + Intergenic
1133972431 16:10577795-10577817 ACTTACCCAAAGGTGGGGTGGGG - Intronic
1134007772 16:10829464-10829486 AAATACCCACAGGTGTGGAGGGG - Intergenic
1136155327 16:28378251-28378273 ACAAATTCACAGCTGGGGCTGGG - Intergenic
1136207756 16:28737037-28737059 ACAAATTCACAGCTGGGGCTGGG + Intergenic
1136355288 16:29741190-29741212 AAATACCCACAGGTGTGGAGGGG + Intergenic
1136710227 16:32230805-32230827 AAATACCCACAGGTGTGGAGGGG + Intergenic
1136991549 16:35154419-35154441 AAATACCCACAGGTGTGGAGGGG + Intergenic
1136998169 16:35205547-35205569 AAATACCCACAGGTGTGGAGGGG + Intergenic
1137717013 16:50604142-50604164 GGAAACCCACATGTGGGGCTTGG - Intronic
1139439065 16:66955390-66955412 ATATACCCACAGGTGTGGAGGGG - Intergenic
1139440922 16:66966426-66966448 GTCTACCCCCAGGTGGGGCTGGG + Intronic
1139939806 16:70597010-70597032 ACATACAAACAGGTTGAGCTGGG - Intronic
1140090745 16:71836601-71836623 ACAAACACACAGGTGTTGCTGGG - Intergenic
1140721268 16:77774563-77774585 ACATAGCCACTGGTGAAGCTGGG - Intergenic
1140831997 16:78760454-78760476 GCATACTCACAGGTGGGATTAGG + Intronic
1141210351 16:81973757-81973779 AGATACCCAGAGGTGGGCCTAGG - Intergenic
1141416448 16:83879199-83879221 AAATACCCACAGGTGTGGAGGGG - Intergenic
1203059833 16_KI270728v1_random:958955-958977 AAATACCCACAGGTGTGGAGGGG - Intergenic
1143121853 17:4612947-4612969 ATATACCCAAAGGTGGGGAAAGG - Intergenic
1143401466 17:6647325-6647347 AAATACCCACAGGTGTGGAGGGG + Intronic
1143586764 17:7854337-7854359 GCTCACCCTCAGGTGGGGCTGGG - Exonic
1144261932 17:13530030-13530052 ACATACACACGGGTTGGGGTGGG + Intronic
1144861237 17:18303905-18303927 AAATACCCACAGGTGTGGAGGGG + Intronic
1145741265 17:27276702-27276724 ACATATCCACAGGGGATGCTGGG - Intergenic
1146166589 17:30594457-30594479 AAATACCCACAGGTGTGGAGGGG - Intergenic
1147418436 17:40309925-40309947 ACACACACACAGGTGGGGTCGGG - Intronic
1149626738 17:58084814-58084836 ACAAACCCAGGGGTGGGGGTGGG - Intronic
1151456530 17:74229472-74229494 ACATTCTGGCAGGTGGGGCTGGG - Intronic
1152035376 17:77869107-77869129 ACATCCCAAAAGGTGGTGCTGGG + Intergenic
1152104817 17:78322863-78322885 ACATGTCCACAGCTGGGGGTGGG - Intergenic
1156019250 18:32580815-32580837 ACATACCCACCTTTGGAGCTAGG - Intergenic
1157250291 18:46089390-46089412 AAATACCCACAGGTGTGGAGGGG + Intronic
1157678166 18:49583015-49583037 ACTTACACACAGGTAGGGCAAGG + Intronic
1157733257 18:50022987-50023009 ACAAACCCATAGATGGGACTAGG + Intronic
1158107984 18:53906514-53906536 ACATACCCACAGCCCTGGCTCGG + Intergenic
1158335039 18:56406864-56406886 ACATACCAGCTGATGGGGCTGGG + Intergenic
1159091412 18:63853297-63853319 AAATACCCACAGGTGTGGAAAGG + Intergenic
1160655064 19:262013-262035 AAATACCCACAGGTGTGGAGGGG + Intergenic
1160897576 19:1409844-1409866 CCTTACCCACTGGGGGGGCTCGG + Intronic
1161699818 19:5788411-5788433 AAATACACACAAGTGGAGCTTGG + Intronic
1162278494 19:9676809-9676831 AAATACCCACAGGTGTGGAGGGG - Intergenic
1163101336 19:15098891-15098913 AAATACATACATGTGGGGCTGGG + Intergenic
1163986959 19:20962512-20962534 AAATACCCACAGGTGTGGAGGGG + Intergenic
1164055675 19:21620239-21620261 AAATACCCACAGGTGTGGAGGGG - Intergenic
1164229785 19:23277041-23277063 AAATACCCACAGGTGTGGAGGGG - Intergenic
1165328870 19:35130312-35130334 AAATACCCACAGGTGTGGAGGGG + Intronic
1165523455 19:36332184-36332206 AAATACCCACAGGTGTGGAGGGG - Intergenic
1165595175 19:37007083-37007105 AAATACCCACAGGTGTGGAGGGG + Intergenic
1165652262 19:37501758-37501780 AAATACCCACAGGTGTGGAGGGG - Intergenic
1166144367 19:40824061-40824083 TTATACCCAGAGGTGGAGCTTGG + Intronic
1166157145 19:40922217-40922239 AAATACCCACAGGTGTGGGGGGG - Intergenic
1166172120 19:41036060-41036082 AAATACCCACAGGTGTGGAGGGG - Intergenic
1166248109 19:41545570-41545592 AAATACCCACAGGTGTGGAGAGG + Intergenic
1167552208 19:50169074-50169096 TCACACCCACGGGTGGGGCACGG + Intergenic
1167820353 19:51922102-51922124 AAATACCCACAGGTGTGGAGGGG + Intronic
1167820781 19:51925849-51925871 AAATACCCACAGGTGTGGAGAGG + Intronic
1167827119 19:51983911-51983933 AAATACCCACAGGTGTGGAGGGG + Intronic
1167951034 19:53027921-53027943 AAATACCCACAGGTGTGGAGGGG - Intergenic
1168003665 19:53468348-53468370 AAATACCCACAGGTGTGGAAGGG - Intronic
1168235510 19:55060652-55060674 AAATACCCACAGGTGTGGAGGGG + Intronic
1168358596 19:55718850-55718872 AAATACCCACAGGTGTGGAGGGG + Intronic
1168477325 19:56686028-56686050 AAATACCCACAGGTGTGGAGGGG - Intergenic
1168638364 19:58013560-58013582 AAATACCCACAGGTGTGGAGGGG - Intergenic
924967917 2:95018-95040 AAATACCCACAGGTGTGGAGGGG + Intergenic
925037580 2:702564-702586 AAATACCCACAGGTGTGGAGGGG - Intergenic
925096334 2:1207393-1207415 ACATAGCCAGAGGTTGGGTTTGG - Intronic
925142614 2:1560285-1560307 AAATACCCACAGGTGTGGAGGGG - Intergenic
925989938 2:9246578-9246600 ATTTTCACACAGGTGGGGCTGGG - Intronic
926107837 2:10163398-10163420 CCACACCCACATGTGGAGCTTGG - Intronic
927982737 2:27384784-27384806 GCATTCCCACTGGTGAGGCTGGG - Exonic
929505515 2:42525106-42525128 AGAGACCCACAGGTGGGGGAGGG - Intronic
931231726 2:60380821-60380843 ACAGCCCCACAGATGGAGCTGGG - Intergenic
931353846 2:61516702-61516724 ACTTACTCACAGGCGGGGCATGG - Intronic
931703012 2:64924194-64924216 TCAGACCCACAGATGGGGATGGG + Intergenic
931931570 2:67142822-67142844 AAATACTCACAGGTGGGACAAGG + Intergenic
932466204 2:71925906-71925928 TCATACACCCAGCTGGGGCTGGG + Intergenic
932600253 2:73119200-73119222 ATATACCCACAGGTGTGGAGGGG - Intronic
934123789 2:88866513-88866535 AAATACCCACAGGTGTGGAGGGG - Intergenic
934543054 2:95192332-95192354 AAATACCCACAGGTGTGGAGGGG + Intergenic
934592466 2:95568147-95568169 AAATACCCACAGGTGTGGAGGGG + Intergenic
935656235 2:105426019-105426041 AAATACCCACAGGTGTGGAGGGG + Intronic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
936107411 2:109636853-109636875 AAATACCCACAGGTGTGGAGGGG - Intergenic
938235446 2:129702348-129702370 AAATACCCACAGGTGTGGAGGGG + Intergenic
940358258 2:152769091-152769113 AAATACCCACAGGTGTGGAGGGG - Intergenic
941696853 2:168562266-168562288 AAATACCCACAGGTGTGGAGGGG - Intronic
943876411 2:193072766-193072788 CCAGGCCCACAGGTGGTGCTTGG + Intergenic
945583341 2:211624924-211624946 ACATAATCACAGGGGGGGCTGGG + Intronic
946204807 2:218096491-218096513 ATATACCCACAGGTGTGGAGGGG + Intergenic
947212655 2:227722218-227722240 AAATACCCACAGGTGTGGAGAGG - Intergenic
947854838 2:233316119-233316141 ACTTACCCACAGGCTGGACTTGG - Exonic
948147698 2:235720416-235720438 AAGTAACCACAGGTGAGGCTGGG - Intronic
948260841 2:236603538-236603560 AAATAACCACAGGAGGCGCTTGG - Intergenic
948567173 2:238894512-238894534 ACAGACCCCGAGGTGGGGCCTGG - Intronic
948752069 2:240138623-240138645 ACAAACCCACAGTCAGGGCTAGG - Intergenic
1169221591 20:3826313-3826335 ACATTTCCACTGGTGGGACTTGG - Exonic
1169471052 20:5885960-5885982 ATATACCCACAGGTGTGGAGGGG + Intergenic
1170397778 20:15946679-15946701 AAATACCCACAGGTGTGGAGGGG - Intronic
1170906084 20:20516215-20516237 ACATACCAACAGGTGGGGATAGG - Intronic
1171272790 20:23829337-23829359 AAATACCCACAGGTGTGGAGGGG - Intergenic
1171451971 20:25242178-25242200 AAATACCCACAGGTGTGGAGGGG + Intergenic
1171495253 20:25550356-25550378 AAATACCCACAGGTGTGGAGGGG - Intronic
1172338514 20:34136543-34136565 AAATACCCACAGGTGTGGAGGGG + Intergenic
1172352232 20:34252125-34252147 AAATACCCACAGGTGTGGAGGGG - Intronic
1172716577 20:36968773-36968795 AAATACCCACAGGTGTGGAGGGG + Intergenic
1174079742 20:47962467-47962489 ACATAGCCAGAGGCGGGGCCAGG - Intergenic
1175932991 20:62502252-62502274 TCAGACCCTGAGGTGGGGCTGGG + Intergenic
1176119258 20:63446623-63446645 ACATGGCCAGAGCTGGGGCTGGG + Intronic
1176163343 20:63659703-63659725 AAATACCCACAGGTGTGGAGGGG - Intronic
1178285549 21:31322601-31322623 AAACACCCACAGGAGGGGCCAGG - Intronic
1178483087 21:32997252-32997274 AAATACCCACAGGTGTGGAGGGG + Intergenic
1179156225 21:38853442-38853464 ACTTGCCCACAGGTGGGGATGGG - Intergenic
1179886374 21:44315937-44315959 GCACACACACAGCTGGGGCTGGG - Intronic
1180766314 22:18347521-18347543 AAACACCCACAGGTGGGGAGGGG - Intergenic
1181184658 22:21094294-21094316 AAATACCCACAGGTGTGGAGGGG + Intergenic
1181432503 22:22890335-22890357 ACACACACACAGTTGGTGCTGGG + Intronic
1181535246 22:23538694-23538716 AAATACCCACAGGTGTGGAGGGG + Intergenic
1181536372 22:23548393-23548415 AAATACCCACAGGTGTGGAGGGG + Intergenic
1182105344 22:27685242-27685264 AAATTCACACAGCTGGGGCTGGG - Intergenic
1184651744 22:45922465-45922487 CCATGCCGCCAGGTGGGGCTGGG + Exonic
1185332205 22:50256855-50256877 ACATCCTCACAGGTGGGACGTGG + Intronic
950752981 3:15145544-15145566 AAATACCCACAGGTGTGGAGGGG - Intergenic
951886760 3:27532232-27532254 ATATACCCACAGGTGTGGAGGGG + Intergenic
952154464 3:30627828-30627850 AAATAGCCACAGGTGGCTCTTGG + Intronic
952905179 3:38135250-38135272 AAATACCCACAGGTGTGGAGGGG - Intronic
954145416 3:48632034-48632056 GCCGCCCCACAGGTGGGGCTGGG - Exonic
954331000 3:49890239-49890261 TCCTACCCAGAGTTGGGGCTGGG + Intronic
954409306 3:50363455-50363477 ACACACACACAGGTGGGGACTGG - Intronic
954698417 3:52439628-52439650 TCAGACCCAGAGATGGGGCTTGG + Intronic
955216050 3:56985825-56985847 ACATACCCACAGGTGGGGCTGGG + Intronic
955257188 3:57344176-57344198 AAATACCCACAGGTGTGGAGGGG + Intronic
955530484 3:59867800-59867822 ACATACCCTAAGGTGGAGGTGGG - Intronic
957045877 3:75374178-75374200 AAATACCCACAGGTGTGGAGGGG - Intergenic
957067621 3:75538710-75538732 AAATACCCACAGGTGTGGAGGGG + Intergenic
957074701 3:75592687-75592709 AAATACCCACAGGTGTGGAGGGG - Intergenic
958761614 3:98316148-98316170 AAATACCCACAGGTGTGGAGGGG - Intergenic
958765501 3:98362570-98362592 AAATACCCACAGGTGTGGAGGGG - Intergenic
958795862 3:98705560-98705582 ACATACCCACAAGTGGTTCTTGG + Intergenic
958819104 3:98952331-98952353 AAATACCATCAGGTGGGGCAGGG + Intergenic
959948496 3:112152022-112152044 AAATACCCACAGGTGTGGAGGGG - Intronic
960809055 3:121611119-121611141 AAATACCCACAGGTGTGGAGGGG - Intronic
961276506 3:125731431-125731453 AAATACCCACAGGTGTGGAGGGG + Intergenic
961279397 3:125754024-125754046 AAATACCCACAGGTGTGGAGAGG + Intergenic
961285528 3:125799266-125799288 AAATACCCACAGGTGTGGAGCGG - Intergenic
961822121 3:129580514-129580536 ACCTACCCACCGGGTGGGCTGGG - Intronic
961877929 3:130038302-130038324 AAATACCCACAGGTGTGGAGGGG - Intergenic
962128707 3:132649757-132649779 AAATACCCACAGGTGTGGAGGGG + Intronic
963216241 3:142752060-142752082 AAATACCCACAGGTGTGGAGGGG - Intronic
963756880 3:149243653-149243675 ACACAGACAGAGGTGGGGCTTGG - Intergenic
965823588 3:172709101-172709123 GTATACCCTCAGGTGGTGCTTGG - Intronic
966410559 3:179642394-179642416 ACATACACACAGGCCGGGCGTGG - Intergenic
966733647 3:183170970-183170992 AAATACCCACAGGTGTGGAGGGG + Intergenic
968061325 3:195728114-195728136 AAATACCCACAGGTGTGGAGGGG - Intronic
968206359 3:196804757-196804779 ACATACGCACAGGCCGGGCGCGG - Intronic
968224210 3:196963015-196963037 AAATACCCACAGGTGTGGAGGGG + Intronic
968396349 4:242164-242186 AAATACCCACAGGTGTGGAGGGG + Intergenic
968730806 4:2268423-2268445 GCCCACCCACAGCTGGGGCTGGG - Intergenic
969001466 4:3985925-3985947 AAATACCCACAGGTGTGGAGGGG - Intergenic
969012199 4:4075276-4075298 AAATACCCACAGGTGTGGAGGGG + Intergenic
969018310 4:4120324-4120346 AAATACCCACAGGTGTGGAGGGG - Intergenic
969478772 4:7435898-7435920 GGACACCCACATGTGGGGCTAGG - Intronic
969512997 4:7630224-7630246 CCATGTCCACAGGTGAGGCTGGG + Intronic
969617487 4:8262176-8262198 AGAGACCCACAGATGGGGCAGGG + Intergenic
969741885 4:9034432-9034454 AAATACCCACAGGTGTGGAGGGG - Intergenic
969752555 4:9122772-9122794 AAATACCCACAGGTGTGGAGGGG + Intergenic
969753472 4:9131330-9131352 AAATACCCACAGGTGTGGAGGGG + Intergenic
969786986 4:9466183-9466205 AAATACCCACAGGTGTGGAGGGG + Intergenic
969801256 4:9567329-9567351 AAATACCCACAGGTGTGGAAGGG - Intergenic
969812452 4:9658936-9658958 AAATACCCACAGGTGTGGAGGGG + Intergenic
969825168 4:9752028-9752050 AAATACCCACAGGTGTGGAGGGG + Intergenic
971719996 4:30232918-30232940 AAATACCCACAGGTGTGGAGGGG - Intergenic
971921766 4:32949655-32949677 ACATACCCACAGGTGGTATTTGG - Intergenic
973343511 4:49030062-49030084 AAATACCCACAGGTGTGGAGGGG + Intronic
975519622 4:75286611-75286633 ATATACCCACAGGTGTGGAGGGG - Intergenic
975895155 4:79079983-79080005 ACCTACCCAAAGGTGGAGCATGG - Intergenic
976680113 4:87746325-87746347 AAATACCCACAGGTGTGGAGCGG - Intergenic
976869521 4:89774190-89774212 GAATACCCAGAGGTGGAGCTGGG - Intronic
976928040 4:90526555-90526577 ACATAGACACAGGTGGGGGATGG - Intronic
977908416 4:102502108-102502130 ACCATCCCCCAGGTGGGGCTGGG - Intronic
978048997 4:104171957-104171979 AAATACCCACAGGTGTGGAGGGG + Intergenic
979996641 4:127439492-127439514 AAATACCCACAGGTGTGGAGGGG - Intergenic
980262975 4:130478384-130478406 ATAAACCCACAGGGAGGGCTTGG + Intergenic
981558722 4:146023869-146023891 ACATGGCCACTGCTGGGGCTGGG + Intergenic
982169995 4:152652498-152652520 ACCTGCCTACAGGTGGGGGTGGG - Intronic
982518717 4:156386369-156386391 AAATACCCACAGGTGTGGAGGGG - Intergenic
983001455 4:162419435-162419457 ATATACCCACAGGTGTGGAGGGG + Intergenic
983212831 4:164976345-164976367 AAATACCCACAGGTGTGGAGGGG + Intronic
983224597 4:165074087-165074109 AAATACCCACAGGTGTGGAGGGG + Intergenic
983313199 4:166093078-166093100 AAATACCCACAGGTGTGGAGAGG - Intronic
983661610 4:170135175-170135197 ACATACCACCAGGTGGGGGTAGG + Intergenic
984253145 4:177358595-177358617 ACATAGCCACAGGCTGGGCATGG - Intronic
984776936 4:183490077-183490099 ACATACACACAGGCCGGGCATGG + Intergenic
985494501 5:196799-196821 AAATACCCACAGGTGTGGAGGGG - Intergenic
985734092 5:1567405-1567427 AAATACCCACAGGTGTGGAGGGG - Intergenic
986021631 5:3809649-3809671 ACCTACCCACAGGGTGGCCTGGG + Intergenic
986295351 5:6433121-6433143 ACATGCCCACAGGGTGGGTTAGG + Intergenic
986299449 5:6466469-6466491 ACGCTCCCCCAGGTGGGGCTGGG + Intronic
986316972 5:6595923-6595945 CCAAACCCACGGGTGGGTCTTGG + Intergenic
986525144 5:8665394-8665416 AAATAACCACAGGTTGGGTTTGG - Intergenic
987936116 5:24466741-24466763 AAATACCCACAGGTGTGGAGGGG + Intergenic
988063072 5:26198387-26198409 AAATACCCACAGGTGTGGAGGGG + Intergenic
989085586 5:37672853-37672875 AAATACCCACAGGTGTGGAGGGG + Intronic
989296049 5:39828069-39828091 AAATACCCACAGGTGTGGAGGGG - Intergenic
989583881 5:43059076-43059098 AAATACCCACAGGTGTGGAGGGG + Intergenic
989586381 5:43077035-43077057 AAATACCCACAGGTGTGGAGAGG - Intronic
990619818 5:57547627-57547649 AAATACCCACAGGTGTGGAGGGG + Intergenic
992459398 5:76945913-76945935 AAATACCCACAGGTGTGGAGGGG + Intergenic
992656035 5:78910328-78910350 AAATACCCACAGGTGTGGAGGGG + Intronic
992779163 5:80112616-80112638 AAATACCCACAGGTGTGGAGGGG + Intronic
993698352 5:91089078-91089100 CAATACCCACAGGTGTGGCAGGG - Intronic
994404667 5:99329380-99329402 AAATACCCACAGGTGTGGAGGGG + Intergenic
994503277 5:100607011-100607033 AAATACCCACAGGTGTGGAGGGG + Intergenic
994534078 5:101006205-101006227 AAATACCCACAGGTGTGGAGGGG - Intergenic
997248678 5:132372224-132372246 ACACACCCACCTGTGAGGCTAGG - Intronic
997349087 5:133217322-133217344 AGATACCCACTGGCAGGGCTGGG + Exonic
997394800 5:133550484-133550506 ATTCACCCACAGTTGGGGCTGGG - Intronic
997438500 5:133892246-133892268 AGATACCCACAGGTGGCTTTGGG - Intergenic
999133917 5:149304868-149304890 ACAGATGCACAGGAGGGGCTAGG + Intronic
999361565 5:150990493-150990515 AAATACCCACAGGTGTGGAGGGG - Intergenic
999560586 5:152797305-152797327 AAATACCCACAGGTGTGGAGGGG - Intergenic
999752963 5:154643663-154643685 ATATACCCACAGGTGTGGAGGGG - Intergenic
999989208 5:157034015-157034037 AAATACCCACAGGTGTGGAGGGG - Intronic
1001273864 5:170336231-170336253 TCATCCCCACATGTAGGGCTGGG - Intergenic
1001919897 5:175591472-175591494 ACATAGCCCCAGGAGCGGCTGGG - Intergenic
1002268723 5:178055338-178055360 ATATACCCACAGGTATGGATGGG - Intronic
1003600666 6:7514228-7514250 AAATACCCACTGGTGGGTCGTGG + Intergenic
1004278638 6:14259683-14259705 ACATAACCAAAGAAGGGGCTGGG - Intergenic
1004620879 6:17329261-17329283 AAATAACCACAGGTCGGGCATGG - Intergenic
1005321790 6:24662756-24662778 AAATACCCACAGGTGTGGAGGGG + Intronic
1005430183 6:25748498-25748520 ATATACCCACAGGTGTGGAGGGG - Intergenic
1005525391 6:26642466-26642488 AAATACCCACAGGTGTGGAGGGG + Intronic
1005618337 6:27596736-27596758 ATATACCCACAGGTGTGGAGGGG - Intergenic
1006289257 6:33121951-33121973 AAATACCCACAGGTGTGGAGGGG - Intergenic
1007572411 6:42902648-42902670 AGATACCCACAGGTGTGGAGGGG - Intergenic
1007624836 6:43239506-43239528 AAATACCCACAGGTGTGGAGGGG - Intergenic
1008585791 6:52947713-52947735 AAATACCCACAGGTGTGGAGGGG - Intergenic
1009193379 6:60655975-60655997 AAATACCCACAGGTGTGGAGGGG + Intergenic
1009193791 6:60660938-60660960 AAATACCCACAGGTGTGGAGGGG + Intergenic
1010423787 6:75704094-75704116 ACATACCTACAGGTGTGGAAGGG - Intronic
1010839809 6:80635633-80635655 AAATACCCACAGGTGTGGAGGGG + Intergenic
1012120523 6:95361229-95361251 AAATACCCACAGGTGTGGAGGGG - Intergenic
1013182349 6:107728822-107728844 ACAGAGCCACATCTGGGGCTTGG - Intronic
1015285305 6:131479609-131479631 AAATACCCACAGGTGTGGAGGGG + Intergenic
1016177258 6:141096224-141096246 AAATACCCACAGGTGTGGAAGGG - Intergenic
1016585007 6:145674274-145674296 ACAGACCTACAGGTGGGGTTTGG - Intronic
1016862170 6:148731621-148731643 ACAGTCCCACATGTGAGGCTGGG - Intergenic
1017102646 6:150862403-150862425 AAATACCCACAGGTGTGGAGGGG + Intergenic
1020290786 7:6720906-6720928 AAATACCTACATGGGGGGCTGGG + Intergenic
1022140749 7:27491485-27491507 AGAAGCCCAGAGGTGGGGCTGGG - Intergenic
1022331877 7:29387213-29387235 AGATACCCACATGTGAGACTTGG - Intronic
1022477115 7:30718599-30718621 ATATACCCACAGGTGTGGAGGGG - Intronic
1022677513 7:32513621-32513643 AAATACCCACAGGTGTGGAGGGG - Intronic
1023248272 7:38230859-38230881 AAATACCCACAGGTGTGGAGGGG - Intergenic
1026188582 7:68103768-68103790 AAATACCCACAGGTGTGGAGGGG - Intergenic
1026429199 7:70326874-70326896 ACATAATCACAGGTGGCACTTGG + Intronic
1026855312 7:73749705-73749727 AAATACCCACAGGTGTGGAGGGG - Intergenic
1028844794 7:95467722-95467744 CACTGCCCACAGGTGGGGCTAGG - Intergenic
1029076792 7:97941032-97941054 AAATACCCACAGGTGTGGAGGGG - Intergenic
1029790642 7:102839471-102839493 AAATACCCACAGGTGTGGAGGGG + Intronic
1030009242 7:105149628-105149650 AAATACCCACAGGTGTGGAGGGG + Intronic
1031779178 7:125940657-125940679 AAATACCCACAGGTGTGGAGAGG + Intergenic
1033174894 7:139114680-139114702 ACATGACCACAGGTGAGGCTGGG + Intergenic
1033715344 7:143996141-143996163 ATATACCCACAGGTGTGGAGGGG - Intergenic
1035226352 7:157435159-157435181 AGATACCAACAGGTGGGCGTGGG - Intergenic
1035518095 8:253745-253767 ATATACCCACAGGTGTGGAGGGG + Intergenic
1035643341 8:1200137-1200159 ACAGGCCCACAGGAGAGGCTGGG + Intergenic
1036240985 8:7080910-7080932 AAATACCCACAGGTGTGGAGGGG + Intergenic
1036247079 8:7127002-7127024 AAATACCCACAGGTGTGGAGGGG - Intergenic
1036253714 8:7187367-7187389 AAATACCCACAGGTGTGGAGGGG + Intergenic
1036363778 8:8100113-8100135 AAATACCCACAGGTGTGGAGGGG - Intergenic
1036375767 8:8198166-8198188 AAATACCCACAGGTGTGGAGGGG + Intergenic
1036376689 8:8206662-8206684 AAATACCCACAGGTGTGGAGGGG + Intergenic
1036831970 8:12027629-12027651 AAATACCCACAGGTGTGGAGGGG - Intergenic
1036852848 8:12216476-12216498 AAATACCCACAGGTGTGGAGGGG - Intergenic
1036853763 8:12224977-12224999 AAATACCCACAGGTGTGGAGGGG - Intergenic
1036874221 8:12458998-12459020 AAATACCCACAGGTGTGGAGGGG - Intergenic
1036875138 8:12467487-12467509 AAATACCCACAGGTGTGGAGGGG - Intergenic
1036887181 8:12566966-12566988 AAATACCCACAGGTGTGGAGGGG + Intergenic
1036894777 8:12625067-12625089 AAATACCCACAGGTGTGGAGGGG + Intergenic
1037875474 8:22545017-22545039 CCATACCCACAGATGGGCCCTGG - Intronic
1038845667 8:31227175-31227197 ACATAGCCACACTGGGGGCTAGG + Intergenic
1039289332 8:36077223-36077245 ACACACACACTGGTGGGGCAAGG - Intergenic
1039960072 8:42239403-42239425 AGATACCCACCGGAGGGGATGGG - Intergenic
1040339095 8:46430991-46431013 AAATACCCACAGGTGTGGAGGGG - Intergenic
1040340868 8:46439934-46439956 AAATACCCACAGGTGTGGAGGGG - Intergenic
1041407476 8:57515870-57515892 ACATACCCACGGGCTGAGCTGGG - Intergenic
1041588648 8:59550270-59550292 CCCTCCCCAGAGGTGGGGCTGGG - Intergenic
1042204315 8:66313071-66313093 AAATACCCACAGGTGTGGAGGGG - Intergenic
1047291149 8:123531582-123531604 ACGTATCCACAGGGTGGGCTCGG + Intronic
1047758510 8:127936803-127936825 ACATACCCTCCCGTGGGACTTGG + Intergenic
1048848169 8:138619445-138619467 ACACACTTACAGGTGGGCCTCGG + Exonic
1049249080 8:141578547-141578569 AAAACCCCACAGATGGGGCTGGG + Intergenic
1049342746 8:142122002-142122024 ACATACACACGGGTTGTGCTTGG - Intergenic
1049501315 8:142968693-142968715 AAATACCCACAGGTGTGGAGGGG - Intergenic
1049709480 8:144057197-144057219 GCACATCCACAGGTGGGCCTGGG - Exonic
1049725969 8:144146677-144146699 AAATACCCACAGGTGTGGAGGGG + Intergenic
1049876013 8:145021259-145021281 AAATACCCACAGGTGTGGAGGGG - Intergenic
1050025691 9:1332534-1332556 ACATACCCACAGTAGGAGCCTGG + Intergenic
1051920254 9:22256750-22256772 AAATACTCACAGGTGTGCCTAGG + Intergenic
1052469945 9:28881177-28881199 AAATACCCACAGGTGTGGAGGGG + Intergenic
1052995569 9:34550159-34550181 ACAGTCCCAGAGGTGGGGCCTGG - Intergenic
1053507542 9:38655977-38655999 GCAGTCCCACAGTTGGGGCTGGG - Intergenic
1056737051 9:89219137-89219159 ACAGACCCCCTGGTGGGGATTGG - Intergenic
1056859544 9:90167234-90167256 AAATACCCACAGGTGCGGAGGGG + Intergenic
1059309620 9:113379075-113379097 AAATACCCACAGGTGTGGAGGGG - Intergenic
1060831131 9:126717490-126717512 AAATACCCACAGGTGTGGAGGGG + Intergenic
1061446067 9:130638838-130638860 CCACAGCCACAGGTGAGGCTGGG - Intergenic
1062487734 9:136788811-136788833 AAATACCCACAGGTGTGGAGGGG - Intergenic
1185575883 X:1171903-1171925 AAATACCCACAGGTGTGGAGGGG + Intergenic
1187403202 X:18980817-18980839 AAATACCCACAGGTGTGGAGGGG + Intronic
1188072436 X:25733395-25733417 ACATACCCATTAGTTGGGCTTGG - Intergenic
1189663384 X:43327274-43327296 AAATACCATCAGGTGGGGCAGGG + Intergenic
1190393653 X:49957549-49957571 AAATACCAACAGGCGAGGCTAGG - Intronic
1191018413 X:55835226-55835248 AAATACCCACAGGTGTGGAGGGG - Intergenic
1194219289 X:91171259-91171281 AAATACCCACAGGTGTGGAGGGG + Intergenic
1194262699 X:91716722-91716744 ACATACCTTCAGGTGGGGGCAGG - Intergenic
1196811973 X:119636088-119636110 ATATACTGACAGGTGGGGCTGGG - Intronic
1197509607 X:127354907-127354929 AAATACCCACAGGTGTGGAGGGG + Intergenic
1198005697 X:132490209-132490231 ACATCCCCAGAGGCGGGGTTGGG + Intergenic
1198721881 X:139631114-139631136 ATATAGCCACAGGAGGGGATGGG + Intronic
1199612019 X:149626532-149626554 AAATACCCACAGGTGTGGAGGGG - Intronic
1200009206 X:153108668-153108690 ATAGGCCCACAGGCGGGGCTGGG - Intergenic
1200030394 X:153291254-153291276 ATAGGCCCACAGGCGGGGCTGGG + Intergenic
1200152818 X:153959626-153959648 CCATTTCCACAGGTGGGGCCAGG + Intronic
1200257211 X:154589613-154589635 AAATACCCACAGGTGTGGATGGG + Intergenic
1200259869 X:154608436-154608458 AAATACCCACAGGTGTGGAGGGG - Intergenic
1200260559 X:154614789-154614811 AAATACCCACAGGTGTGGATGGG - Intergenic