ID: 955216591

View in Genome Browser
Species Human (GRCh38)
Location 3:56989401-56989423
Sequence TGGAAATGGGGCACTGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955216591 Original CRISPR TGGAAATGGGGCACTGCTGT GGG (reversed) Intronic
903224730 1:21888054-21888076 GGGAACTGGGGCACTGCAGGTGG + Exonic
903972941 1:27130966-27130988 TGGGCATGGGGCACTTCTATGGG - Intronic
904397671 1:30233308-30233330 AGGAAATGGGGCTCTGCCCTGGG - Intergenic
911333215 1:96549520-96549542 TAGAAATGGGGCCTTGCTGTGGG - Intergenic
911635732 1:100233717-100233739 TGGAAATTGGACACAGCAGTAGG - Intronic
917521211 1:175749706-175749728 GAGAAATGGGGAACTTCTGTTGG - Intergenic
919802267 1:201361108-201361130 TGGACATGGAACACTGCTGAAGG + Intronic
923436873 1:233975624-233975646 TGGGAGAGGGGCGCTGCTGTGGG + Intronic
1066247848 10:33601109-33601131 TGGAAATCGGACACAGCAGTAGG + Intergenic
1067527345 10:47046630-47046652 TGGATAAGGGGCACTGGGGTAGG + Intergenic
1069936793 10:71923092-71923114 TGGAAATGGAGCATTGCTTTGGG - Intergenic
1070528765 10:77317842-77317864 TGGAAATGGCTCACTGCTGGTGG - Intronic
1071115281 10:82211575-82211597 TGGAAATGCAGCTCTGCTCTGGG - Intronic
1071341280 10:84651385-84651407 TGGCTTTGGGGCACTGCTGTGGG + Intergenic
1071543892 10:86513012-86513034 TGGAAAATGGGAACTACTGTAGG + Intronic
1071560670 10:86644852-86644874 TGGAAATGGGGCCCAGCTCTGGG + Intergenic
1074227791 10:111504587-111504609 TGGCAAAGGGCCACTGCTATGGG - Intergenic
1074935737 10:118179546-118179568 TAGAAATGGGGGACTACTGGAGG + Intergenic
1075729654 10:124628634-124628656 TGGAGAGTGGGCACTGCTGTGGG - Intronic
1075979925 10:126729348-126729370 AGGAAATGGGGCAGTGATGATGG - Intergenic
1076510836 10:131012669-131012691 TGGCAAGGGGGCCCTTCTGTGGG - Intergenic
1077462813 11:2719093-2719115 TGGAGATGGTGCTCTGCGGTTGG - Intronic
1077836502 11:5931465-5931487 AGGAAATGGGGAACTGAGGTCGG - Intronic
1079259710 11:18866706-18866728 TGGATATGGGGCAATGGAGTAGG - Intergenic
1081410640 11:42753874-42753896 TGGAAATGAAGCACTTCTATTGG + Intergenic
1083592161 11:63902247-63902269 TGGGGATGGGGCGCTGCTATTGG - Exonic
1084048191 11:66582810-66582832 TGGAAATTGGACACAGCAGTAGG - Intergenic
1085350569 11:75795721-75795743 TGGAAAAGGGACACTGCAGCTGG - Intronic
1086840691 11:91680287-91680309 TAGAAATAGGACACAGCTGTAGG + Intergenic
1088373043 11:109112279-109112301 TGAAAATGGGACCCTGCTCTAGG - Intergenic
1088905927 11:114155477-114155499 TGGGATGGGAGCACTGCTGTAGG + Intronic
1090765385 11:129871729-129871751 CGGAAATGGGGAACCCCTGTAGG - Intronic
1090942910 11:131404270-131404292 TGGAAATTGAGCACTGCACTTGG - Intronic
1091325276 11:134682245-134682267 TGGATATGGGCCAATGCAGTGGG + Intergenic
1091641128 12:2238464-2238486 GGGAATTGGGGAACTGCTATAGG + Intronic
1100409269 12:94298684-94298706 AGCAAATGGAGCTCTGCTGTTGG - Exonic
1100988398 12:100227065-100227087 AGGGAATAGGGCACAGCTGTAGG - Intronic
1101145747 12:101839051-101839073 GGGAGTTGGGGCACTGCAGTGGG + Intergenic
1102221491 12:111197896-111197918 TTGAGTGGGGGCACTGCTGTGGG - Intronic
1104655746 12:130572738-130572760 TGGAGAAGGGGCACTGCTCTGGG + Intronic
1105790256 13:23791410-23791432 TGCAAATGGGGCAGTGCTGCTGG - Intronic
1110142048 13:72142588-72142610 TTTAAATGGGCCACTTCTGTAGG - Intergenic
1110335699 13:74327763-74327785 TGGAGATGTGGCACTGCCTTTGG + Intergenic
1112929510 13:104716294-104716316 TGGAAACGGGACACAGCAGTAGG + Intergenic
1113438953 13:110313562-110313584 TGGACACGGGGCACTGGGGTGGG - Intronic
1113438966 13:110313596-110313618 TGGACACGGGGCACTGGGGTGGG - Intronic
1113438993 13:110313664-110313686 TGGACACGGGGCACTGGGGTGGG - Intronic
1113439019 13:110313732-110313754 TGGACACGGGGCACTGGGGTGGG - Intronic
1113439046 13:110313800-110313822 TGGACACGGGGCACTGGGGTGGG - Intronic
1113707547 13:112444378-112444400 TGGTAATGGGGGACTGTTGGGGG - Intergenic
1114806938 14:25848394-25848416 TGGAAATGAGGGGCTGCTGATGG - Intergenic
1117103832 14:52378656-52378678 AGGAACTGGGTCACTGCTGCAGG - Intergenic
1119135566 14:72215553-72215575 TGGAAACGGGACACAGCAGTAGG - Intronic
1119406975 14:74405147-74405169 TGGATATGAGGGGCTGCTGTTGG - Intergenic
1119887184 14:78152858-78152880 TAGAAATGGGTCAGTGCTGCCGG + Intergenic
1120153441 14:81064161-81064183 TGGAAGTGGAGCAAGGCTGTAGG + Intronic
1120262243 14:82200325-82200347 TGGAAATGGGACACAGCCATAGG + Intergenic
1121078327 14:91087724-91087746 TGGAAACTGGGCACAGCAGTAGG + Intronic
1121177714 14:91903645-91903667 TGGGAATGGAGCGCTGGTGTGGG - Intronic
1121313480 14:92947442-92947464 AGGAAGTGGGGCACTGCACTGGG + Intronic
1123978457 15:25575748-25575770 TGGAAATAAAGGACTGCTGTGGG - Intergenic
1127675392 15:61233326-61233348 TGAAAATGCAGCACTGCTCTTGG + Intergenic
1127908834 15:63398829-63398851 GGGAAAAGGGACAGTGCTGTAGG - Intergenic
1129772915 15:78214079-78214101 TGGAACAGGGGCTCTCCTGTGGG - Intronic
1130720544 15:86382071-86382093 TGGAAATGTGGCAGGGCGGTGGG - Intronic
1132110965 15:99102238-99102260 TGGCAGTGGTGCACTGCGGTTGG - Intronic
1132270493 15:100520009-100520031 TGGAAAGGGGGCATGGATGTGGG - Intronic
1133298107 16:4765513-4765535 AGGAAATGGGGCCCTGCTGCTGG - Intronic
1134781706 16:16904131-16904153 TGGGAATGGTGCACTGGTTTTGG + Intergenic
1137039278 16:35595052-35595074 TGGAAACTGGACACTGCAGTAGG - Intergenic
1137724057 16:50645305-50645327 TGGAGATGGGGGACTGCAGAGGG + Intergenic
1140976528 16:80064938-80064960 TGGAAGTGGGGCTCTGAGGTTGG - Intergenic
1141691842 16:85601096-85601118 AGGAGATGGGGCTCTGCTGGGGG + Intergenic
1141735149 16:85847263-85847285 TGGAAATCGGGCCCTGCAGGGGG + Intergenic
1141815193 16:86404845-86404867 TGGACATGGAGGACTGCGGTGGG + Intergenic
1142014984 16:87740548-87740570 TGGAGATGGGTCACAGCTGGGGG - Intronic
1143671203 17:8397369-8397391 CGGAGATGGGCTACTGCTGTGGG - Intronic
1144717341 17:17443622-17443644 GGGAAATGGGGCACCACAGTTGG + Intergenic
1144869922 17:18363171-18363193 TGGAACTGGGGCGCTGCGGCTGG + Intronic
1145039635 17:19567715-19567737 AGCACATGGGGCACTGCTCTAGG - Intronic
1147256480 17:39185035-39185057 GGGAAATGGGGGACAGATGTGGG + Intronic
1148093134 17:45034570-45034592 TGGTAATGGGGTACAGCTGGGGG + Intronic
1149172203 17:53824244-53824266 TGGAAATAGGGAATAGCTGTCGG + Exonic
1151169930 17:72237391-72237413 TGGAGAGGGGGCACAGGTGTGGG + Intergenic
1153376378 18:4385010-4385032 TGGCAATGAGGCACTGTTGCAGG - Intronic
1153784250 18:8520371-8520393 AGGCAATGGGGAACTGATGTGGG - Intergenic
1154227265 18:12516769-12516791 TGGAAAAGGGGCCCTGTTTTGGG - Intronic
1157119784 18:44898156-44898178 TCAATATGGGTCACTGCTGTGGG - Intronic
1159242535 18:65760823-65760845 TGGACATGGTGCACTAGTGTAGG - Intronic
1160411184 18:78676516-78676538 GAGAAATGCGGCATTGCTGTGGG - Intergenic
1160411189 18:78676561-78676583 GAGAAATGCGGCATTGCTGTGGG - Intergenic
1160677588 19:399623-399645 TGGAACGGGGGCACTGTTGTTGG - Intergenic
1161663424 19:5560775-5560797 TGGAAATGGGGCACAGTTGGAGG + Intergenic
1164146394 19:22515099-22515121 TGGCAGTGTGGCTCTGCTGTGGG - Intronic
1164159968 19:22620039-22620061 TGGCAGTGTGGCTCTGCTGTGGG + Intergenic
1165826325 19:38708023-38708045 TGGGAATTAGTCACTGCTGTGGG + Intronic
1166291037 19:41863678-41863700 TGGAAATGGAGCAGAGCTGTAGG + Intronic
1167988087 19:53335194-53335216 AGGAAATGGGGCAGTGAAGTGGG + Intronic
926114544 2:10204205-10204227 TGGAGGTTGGGCTCTGCTGTTGG - Intronic
926631219 2:15138010-15138032 TGGAAAATGGGGAGTGCTGTTGG - Intergenic
926781230 2:16473954-16473976 GGGAAATGGGGAAATGGTGTGGG + Intergenic
927261280 2:21093813-21093835 TGGAACTCGGGCATTGCTGGTGG - Intergenic
928241542 2:29591102-29591124 GGGAAAGGGGCCACTGCAGTGGG - Intronic
928783128 2:34848871-34848893 AGGAAATGGATCACTGCTGCAGG - Intergenic
931778957 2:65563738-65563760 AGGAAATGGAGCAATGTTGTAGG - Intergenic
932322078 2:70829703-70829725 TGCAAATGGGTCACAGCTGAGGG - Intergenic
932530077 2:72520902-72520924 GGGAATTGGGGTACTGCTGGTGG - Intronic
934617818 2:95785802-95785824 AGGAAAGGGGGCAATGGTGTGGG + Intergenic
934643075 2:96038757-96038779 AGGAAAGGGGGCAATGGTGTGGG - Intronic
935462225 2:103351338-103351360 TGGAAATGGGACAATTGTGTGGG + Intergenic
937468474 2:122155314-122155336 TGGACAGGGGCCACTGCTCTGGG + Intergenic
940052430 2:149478699-149478721 TGGGAATGAGGCACTGCACTTGG + Intergenic
940279043 2:151970816-151970838 CGGAAGTGGGGCCCTGCTGTGGG + Intronic
943041882 2:182813586-182813608 TGGGAATGAGACACTGCTTTGGG + Intergenic
944178246 2:196857958-196857980 TTGTAATAGGGCACTGCAGTGGG - Intronic
944842125 2:203634644-203634666 TGGTAAGGGGGCACTGTTGGCGG + Intergenic
944875392 2:203959392-203959414 TGGAAATGGGGAACTGGTGCTGG + Intronic
947304166 2:228724995-228725017 AGGAAATGGAGCACTGCCTTGGG + Intergenic
947902207 2:233730512-233730534 TGGAAGTGGGGCAATGAAGTTGG + Intronic
948437373 2:237962737-237962759 TGGAAATGGGACACAGCCATAGG - Intergenic
1169048838 20:2559254-2559276 TGGAAATGTGGCACTGGTCCAGG + Intronic
1173272518 20:41550658-41550680 TGGAAATGGGCTATTTCTGTTGG - Intronic
1174485372 20:50857817-50857839 CAGAAATGGGGGACTGCTGATGG - Intronic
1175412718 20:58781749-58781771 ATGAAATGGAGCCCTGCTGTAGG - Intergenic
1175980573 20:62736568-62736590 TGGGAAAGGGGCTCTGCTGGAGG - Intronic
1176073811 20:63239542-63239564 TGCAGATGGGGCACAGCTGCAGG - Exonic
1176367239 21:6040502-6040524 TGGAATTGGAGCAGAGCTGTGGG - Intergenic
1176624514 21:9082063-9082085 GGGAAATGGGGCACTGGTCAAGG + Intergenic
1178929108 21:36802123-36802145 TGGACTTGGGCCACTGCAGTTGG - Intronic
1179044768 21:37834189-37834211 GGGTAATGGGGCAGTGCTGAAGG - Intronic
1179756280 21:43498044-43498066 TGGAATTGGAGCAGAGCTGTGGG + Intergenic
1179767003 21:43581896-43581918 GGGGAATGAGGCCCTGCTGTGGG + Intronic
1179767065 21:43582109-43582131 GGGGAATGAGGCCCTGCTGTGGG + Intronic
1179767078 21:43582149-43582171 GGGGAATGAGGCCCTGCTGTGGG + Intronic
1180005121 21:45017188-45017210 TGGACATGGGGCCCCACTGTTGG + Intergenic
1180093715 21:45544787-45544809 TGGGGATGGGGCACTGCTGTGGG - Intergenic
1180799686 22:18625968-18625990 TGGAAATGTGGCCCTGCCGTGGG - Intergenic
1181168426 22:20995270-20995292 TGGACATGGGGCACCTCTTTCGG + Intronic
1181222030 22:21369298-21369320 TGGAAATGTGGCCCTGCCGTGGG + Intergenic
1182880465 22:33728580-33728602 TGGAAATGTGTCTCTGTTGTTGG - Intronic
1183208465 22:36435110-36435132 TTGCAATGAGGCACTGCTGTGGG + Intergenic
1184611175 22:45604581-45604603 TGGAAATGGGGAACTGTTGCTGG - Intergenic
1184650431 22:45917094-45917116 TATCTATGGGGCACTGCTGTGGG + Intergenic
953363274 3:42319722-42319744 TGGGAATAGGGCACTGCAATGGG + Intergenic
953820298 3:46202580-46202602 TAGAAATGGGGAACTACTGCTGG - Exonic
954377548 3:50203080-50203102 CGAAGATGGGGCATTGCTGTTGG + Intergenic
954795052 3:53157116-53157138 GGGAGAAGGGGCACTGGTGTTGG - Intronic
955216591 3:56989401-56989423 TGGAAATGGGGCACTGCTGTGGG - Intronic
956767845 3:72499142-72499164 GGGAAATGGGGCACTGTGATTGG - Intergenic
958436164 3:94098438-94098460 TGGTAATGGGGAACCACTGTAGG - Intronic
958924238 3:100140340-100140362 TGGAAGTGGGGGACTTCTGGGGG - Intronic
959349122 3:105238320-105238342 TGGGAATGGAGCATTGCAGTGGG + Intergenic
959682567 3:109112571-109112593 TGGAAATGAGGCAAAGCTGAAGG + Intronic
959840616 3:110969882-110969904 TGGAAATCGGACACAGCAGTAGG - Intergenic
960744989 3:120877649-120877671 TGGAAGAGGGGGACTGCTGTTGG - Intergenic
961025075 3:123548363-123548385 TGGAACTGGGGGATGGCTGTTGG - Intronic
961413264 3:126738693-126738715 TAGCAATGGGGCACTGCAATGGG - Intronic
962284461 3:134074690-134074712 TGGGAGTGTGGAACTGCTGTGGG + Intronic
965839004 3:172881769-172881791 TGGAAATAGGGAGCTGCTGCTGG + Intergenic
966401899 3:179556021-179556043 TGGATCTGGTGCACTGTTGTTGG + Intergenic
970566096 4:17334064-17334086 GGGAAATGGGGCAATGAGGTAGG - Intergenic
971581111 4:28342110-28342132 TGGAAATAGGACACTGCCATAGG + Intergenic
972200638 4:36710473-36710495 TGGAATTGGGACACACCTGTGGG - Intergenic
972756402 4:42052571-42052593 TGTAAATGTGGCTCTGTTGTTGG - Intronic
977669946 4:99684125-99684147 GGCTGATGGGGCACTGCTGTGGG + Intergenic
977907299 4:102492729-102492751 TGGAAATGAGGAACTGCAGAGGG + Intergenic
978092508 4:104735472-104735494 TAGAAATGGGGAACAGCAGTTGG + Intergenic
982352615 4:154432689-154432711 TGGATCTGGGGCACAGCTGTTGG - Intronic
985760008 5:1743891-1743913 TGGAACTGGAGCTCTGCTGAAGG + Intergenic
985955091 5:3259525-3259547 TGGCAGTGGGGCACTGCGCTCGG - Intergenic
986119517 5:4819237-4819259 GTGAATTGGGGCACTACTGTGGG + Intergenic
986995401 5:13601839-13601861 AGGACATGGGGCAATGCTGATGG - Intergenic
989258518 5:39393111-39393133 AGAAAATGGGGCACTACTGATGG + Intronic
990550683 5:56875115-56875137 TGTCAGTGGGGCCCTGCTGTTGG + Exonic
992052285 5:72952333-72952355 TGGAAAGGGGGAAGTGCTCTGGG + Intergenic
997235568 5:132270318-132270340 AGGAAATGGGGGACAGGTGTAGG + Intronic
997492844 5:134293381-134293403 AGGAAATGGGGGAGTGCTGGGGG + Intronic
1000207437 5:159075820-159075842 TTGAAATGGGCCAGTGCGGTAGG - Intronic
1000963674 5:167629936-167629958 GGGAAATGGAACAATGCTGTGGG + Intronic
1001732261 5:173969192-173969214 GGGCAATGAGCCACTGCTGTTGG - Intergenic
1001930738 5:175671096-175671118 TGGGGATGGGGCAGTGCTTTGGG + Intronic
1002853433 6:1016897-1016919 TGGAAAAGGGGAACTGATTTGGG + Intergenic
1004131572 6:12925809-12925831 GGGAAATGGGAGACTGCTTTTGG - Intronic
1004336142 6:14765943-14765965 TGGAAAAGGGGAACTGGGGTGGG + Intergenic
1006341928 6:33452047-33452069 TGGAAATGGTGCAGTGGTGGGGG - Exonic
1006782924 6:36644209-36644231 GGGAAATGGGGAACTTCTCTTGG + Intergenic
1007081439 6:39107929-39107951 TGGAAATGGGAAACAGCTGAAGG + Intronic
1010090253 6:71972302-71972324 TGGAAATGCTGTACTTCTGTAGG + Intronic
1011015822 6:82754159-82754181 AGGAAATGGAGCACAGCTGAAGG + Intergenic
1011133942 6:84079673-84079695 TGGTAATAGGGCACTGCAGTGGG + Intronic
1011657104 6:89561933-89561955 GGGAAATAGGGCAATGCTTTAGG + Intronic
1011847063 6:91578981-91579003 TGCAAATGGGGCCCTGCACTGGG + Intergenic
1014452185 6:121594284-121594306 TGGAAAAGGGGCAGTGCCATTGG - Intergenic
1016798403 6:148142977-148142999 TGCAAATGGGGCACAGAGGTGGG + Intergenic
1016968683 6:149742487-149742509 TGTACATGGTGCACTGCTATAGG + Exonic
1018454484 6:163939824-163939846 TGGAAATCGGTAACAGCTGTGGG - Intergenic
1018937130 6:168280866-168280888 TGAAAATGAGGCACTGCTGTTGG - Intergenic
1020269909 7:6588797-6588819 TGGACTTGGGGCTCTGCTGACGG - Exonic
1022021134 7:26399944-26399966 TGGAATTGTGGCATGGCTGTGGG - Intergenic
1022524733 7:31029626-31029648 TGGACCTGGGGGTCTGCTGTAGG - Intergenic
1022815349 7:33908438-33908460 TGAAAAGGGGGGAATGCTGTGGG - Intronic
1023198303 7:37665811-37665833 TGGACATGAGGCACTGCTCAGGG + Intergenic
1023708602 7:42968197-42968219 TGGAAAGGAGGCAGTGGTGTTGG - Intergenic
1023907328 7:44531879-44531901 GGGAGATGGGGGACGGCTGTTGG - Intronic
1026201237 7:68216258-68216280 TGGAAATGCAGCCCTTCTGTGGG - Intergenic
1029593185 7:101520802-101520824 TGGAAATGGGAAACAGCTGCTGG + Intronic
1029601025 7:101563581-101563603 AGGAAATGGGACAGCGCTGTTGG + Intergenic
1030419514 7:109290179-109290201 TGGAAATGGGGAACTGCAGCAGG + Intergenic
1031933698 7:127713674-127713696 TGGAACTGAGGCAAAGCTGTAGG + Intronic
1034233523 7:149551020-149551042 TGGGGAGGGGGCTCTGCTGTTGG + Intergenic
1034269598 7:149797210-149797232 TGGAAGGGGGGCACTGGTGCTGG + Intergenic
1034875400 7:154720657-154720679 TGGCACTGGGGCCCTGCAGTGGG - Intronic
1035048333 7:155983638-155983660 TGGCAGTGGGGCAGTGCTGTTGG - Intergenic
1037484002 8:19330592-19330614 GGGAAAAGGGGCATTGCTGCAGG - Intronic
1038013522 8:23493982-23494004 TCTTAAAGGGGCACTGCTGTGGG + Intergenic
1039956207 8:42208879-42208901 TAGAAAAGGGGCACTGGGGTGGG + Intergenic
1039961745 8:42253814-42253836 TGGAAACTGGGCACAGCAGTAGG - Intergenic
1040460630 8:47644346-47644368 TGATAGTGGGGCACAGCTGTGGG - Intronic
1043909399 8:85843295-85843317 TAGAAATGGGGAACATCTGTGGG - Intergenic
1044400176 8:91761397-91761419 TTGCAATGGGGCACTAATGTGGG + Intergenic
1044869660 8:96606571-96606593 GAGAACTGGGGCAGTGCTGTTGG + Intronic
1044869857 8:96607962-96607984 GAGAATTGGGGCAGTGCTGTTGG + Intronic
1045461255 8:102427575-102427597 TGGAAATGGTGCGCAGCTGCTGG + Intergenic
1047171077 8:122492687-122492709 TGGAAATGAGGTTCTGTTGTAGG + Intergenic
1047198296 8:122741398-122741420 AGGAAATGGGCCACTGCTGAAGG + Intergenic
1047211461 8:122843605-122843627 TGGAAACGGTGAACTGCTGCCGG + Intronic
1047524215 8:125618647-125618669 TGGAAATGGTCCAATGCTCTTGG - Intergenic
1047819769 8:128506032-128506054 TGGATTTTGTGCACTGCTGTTGG - Intergenic
1048450741 8:134531390-134531412 TGGACATGGGGCATTGGCGTGGG + Intronic
1049012663 8:139897742-139897764 AGGGAAGGGGGCACTGCTCTTGG - Intronic
1049526628 8:143130090-143130112 TGGAAATGGGGGGCTCCTGCAGG + Intergenic
1049965676 9:776805-776827 TGGGAATGGTGCATTGCTTTAGG - Intergenic
1053379402 9:37636380-37636402 TGGAACTAGGGCTCTTCTGTCGG - Intronic
1054960065 9:70958155-70958177 TGGAAAGGGGTCACTGCCCTGGG - Intronic
1058777601 9:108300370-108300392 AGGAGATGGGGCTCTGCGGTGGG - Intergenic
1059251376 9:112890456-112890478 TGGAGATGGCTCTCTGCTGTTGG + Exonic
1059738338 9:117124602-117124624 AGGAAAGGAGGCACTGCTGTTGG + Intronic
1060105402 9:120869919-120869941 TGGGGATGTGGCACTGCTGGTGG + Exonic
1060434398 9:123581265-123581287 TATAAGTGGAGCACTGCTGTAGG + Intronic
1062128590 9:134880386-134880408 TGGTCATGGGCCACTGGTGTGGG - Intergenic
1186244061 X:7601782-7601804 TGGAAATGGGACACAGCCATAGG + Intergenic
1186511110 X:10130349-10130371 TGTAAAATGGGCACTGCTGTTGG + Intronic
1186791863 X:13007443-13007465 TGGAAATGGGTTGCTGCAGTAGG + Intergenic
1188180676 X:27051174-27051196 AGTAAATGGGGCACCTCTGTTGG + Intergenic
1196231947 X:113233957-113233979 AGGAACTGGATCACTGCTGTAGG - Intergenic
1197272351 X:124438573-124438595 TGGAAAGAGGACACTGCTGAGGG + Intronic
1198122566 X:133608363-133608385 TGGAAATGGAGCAGGGCTGTGGG - Intronic
1199501494 X:148511744-148511766 TGGACTTGGGGCTCTGCTGTTGG - Intronic
1199656767 X:150004054-150004076 TGGAAATGGGGAGCTGTTGCTGG + Intergenic