ID: 955221332

View in Genome Browser
Species Human (GRCh38)
Location 3:57025785-57025807
Sequence GATACATTGGTGAGTAGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955221332_955221336 0 Left 955221332 3:57025785-57025807 CCTGTCCTACTCACCAATGTATC 0: 1
1: 0
2: 1
3: 11
4: 120
Right 955221336 3:57025808-57025830 CATGAGCCCAGCACAGTGCCTGG 0: 1
1: 2
2: 31
3: 328
4: 2214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955221332 Original CRISPR GATACATTGGTGAGTAGGAC AGG (reversed) Intronic
905702747 1:40030886-40030908 GATACAATGGTGAATAAAACAGG - Intergenic
907506410 1:54921849-54921871 GATGCAATGGTGAGTAAGTCAGG + Intergenic
909357777 1:74728966-74728988 GTGAGATTGCTGAGTAGGACTGG - Intronic
910028265 1:82684424-82684446 GATATTATGGTGAGTAAGACAGG - Intergenic
910054030 1:83009985-83010007 GATGCATGGGGGAGTAGGAAAGG - Intergenic
910734928 1:90443125-90443147 GATAGATAGGTGTGTAGGAGGGG + Intergenic
913117697 1:115712022-115712044 GACACAAGGGTGAATAGGACAGG + Intronic
921828174 1:219697695-219697717 GCTACAGTGGTGAGGAGGAAGGG + Intronic
922027170 1:221761081-221761103 GATACATGAGTGAGTAAAACTGG - Intergenic
1063730029 10:8686146-8686168 TATACATTGGTGTGTTGGATTGG - Intergenic
1070771167 10:79083045-79083067 GATACATTGGTGAATTTGACAGG + Intronic
1073152966 10:101324214-101324236 GATATAATGGTGAGTAAAACAGG - Intergenic
1073993286 10:109288168-109288190 GATACACTGGAGAGTATGGCAGG - Intergenic
1079179076 11:18172855-18172877 GACACACTCGTGACTAGGACTGG - Exonic
1079268342 11:18957393-18957415 GACACACTCGTGACTAGGACTGG + Intergenic
1079448740 11:20580941-20580963 GATACATAGGTGAGTAGAAGAGG - Intergenic
1082222933 11:49663599-49663621 GATACATTTGGGACAAGGACAGG + Intergenic
1085130757 11:74036329-74036351 GATACAGTGGTGGATATGACAGG - Intronic
1088517335 11:110652349-110652371 GATACTATGTTGAATAGGACTGG - Intronic
1089357857 11:117866934-117866956 GATACATTTTTGAGTAGGGGTGG - Intronic
1093857573 12:24124876-24124898 GATACATTCGTGTGTAAAACAGG + Intergenic
1098295776 12:69002592-69002614 AATACAATGGTGATTAAGACAGG + Intergenic
1098529568 12:71526473-71526495 GAAACATTGGTTAGTAGGAGTGG - Intronic
1098695003 12:73541296-73541318 AATACTGTGTTGAGTAGGACTGG - Intergenic
1098779122 12:74662420-74662442 GATATATTGTTGAGTAAGAAAGG - Intergenic
1099396846 12:82150783-82150805 GATACTATGGTGAGCAAGACTGG - Intergenic
1099845423 12:88022466-88022488 AATACTATGGTGAGTAGGAGTGG - Intronic
1100113238 12:91271223-91271245 GATACAATAGTAAGTAGGAGAGG + Intergenic
1102363293 12:112308170-112308192 GATACACAGATGAGTAGGACAGG + Intronic
1104090570 12:125513284-125513306 GATACATTCGTGAGCAAAACAGG + Intronic
1105327998 13:19387629-19387651 GATACGCTGGTGTGTGGGACTGG - Intergenic
1105969766 13:25417623-25417645 GAAACTTCGGTGCGTAGGACTGG + Intronic
1107299821 13:38953978-38954000 GATACATTGGTGATTAAGCCAGG + Intergenic
1110960755 13:81621953-81621975 GATACATTGGTGAATTAGGCAGG + Intergenic
1111239468 13:85456114-85456136 GAACCATTGGTGAGTGGGTCAGG - Intergenic
1115488110 14:33932183-33932205 AATACATCAGTGAGTAGAACAGG - Intronic
1120229214 14:81824506-81824528 GATCCATTGGTGAGTAAGAAAGG - Intergenic
1121241956 14:92437363-92437385 GATACAGTGGTGAGGAAGCCAGG - Intronic
1126416378 15:48421938-48421960 CCTGCATTGGTGAGTAGGAGAGG - Exonic
1127607647 15:60604578-60604600 AATACAATGGCGAGTAAGACAGG - Intronic
1128182851 15:65620176-65620198 GATTCAGTGGTGAATAAGACAGG + Intronic
1128534706 15:68481693-68481715 GACAATTTGGTGAGTAAGACAGG - Intergenic
1130684472 15:86024674-86024696 AAGAGATTGGTGAGTGGGACTGG + Intergenic
1130899341 15:88195340-88195362 GATACAATAGTGAATAAGACAGG - Intronic
1131364768 15:91829005-91829027 CATACATAAGTGAGTAGAACTGG + Intergenic
1131468278 15:92673251-92673273 GAAACATGGGTGAGGAGGGCAGG + Intronic
1143352733 17:6300558-6300580 GATAGAGTGGTGAATAAGACAGG - Intergenic
1144084815 17:11799037-11799059 GAGACATGGGTGAGGAGGAAGGG - Intronic
1148877532 17:50699486-50699508 GAGACATTGGTGGCTTGGACGGG + Exonic
1150517869 17:65833318-65833340 AATACAGTGGTGAATAGGAGTGG - Intronic
1167256871 19:48435805-48435827 GATACAGTGGTGAATCAGACGGG + Intronic
1167522448 19:49963570-49963592 GATGCATGGGTGAGTAGGTGGGG - Intergenic
925884522 2:8383124-8383146 GATACAAAGGTGAATAGGACAGG + Intergenic
931827672 2:66018397-66018419 GATAGAGTGGTGGATAGGACAGG + Intergenic
937281388 2:120719706-120719728 GATACAGTGGTGAGCAGCCCAGG + Intergenic
940237342 2:151525672-151525694 GAAACATTGTTGATTAGGAGTGG - Intronic
941761125 2:169244757-169244779 GATACACTGGTGATTATCACAGG + Exonic
942839445 2:180341374-180341396 GAAAACTTGGTGAGTAAGACAGG - Intergenic
945116120 2:206409730-206409752 GACACATTAGTGAGGAGGAGGGG + Intergenic
946704801 2:222447792-222447814 AATACAGTGGTGAGTAAAACAGG + Intronic
948051613 2:234983111-234983133 GATACAGAAGTGAGCAGGACAGG + Intronic
1170015628 20:11778609-11778631 AACACATTGGGGATTAGGACAGG - Intergenic
1173351689 20:42251386-42251408 GATACAGTGGTGAGCAAAACAGG + Intronic
1173961144 20:47073600-47073622 GATACAATAGTGACCAGGACAGG + Intronic
1174579023 20:51557836-51557858 GATACAGTGGTGACCAAGACAGG + Intronic
1174980493 20:55388903-55388925 GATACAGTGGTGACTAAAACAGG - Intergenic
1175965281 20:62657242-62657264 TCTACATTGGTGAGTGGGGCTGG + Exonic
1176179913 20:63744922-63744944 GAGACATTGGTGGGTAGCAAAGG + Exonic
1182376981 22:29855826-29855848 GATACATTGGTCAGAACCACAGG - Intergenic
952583631 3:34864967-34864989 GAGACATTGGTGAATTGGCCAGG + Intergenic
955221332 3:57025785-57025807 GATACATTGGTGAGTAGGACAGG - Intronic
955263101 3:57414591-57414613 GATACATTGTTGAGTACGGATGG - Intronic
956218771 3:66879540-66879562 GATGCAGTGCTGAGTAAGACTGG - Intergenic
956484944 3:69712033-69712055 GAGACATTGGAGAGTGGGCCAGG + Intergenic
957641624 3:82861139-82861161 GACACATTGATGGGTAGCACAGG + Intergenic
959397765 3:105862771-105862793 GATAGATTGTTGAGTAAGAGAGG - Intronic
963322866 3:143828389-143828411 GATACATTGGTCAGTAAAAAAGG + Intronic
970355584 4:15248508-15248530 GATACAAAGGCGAGAAGGACAGG + Intergenic
971092845 4:23364969-23364991 AATACAATGGTGAAGAGGACAGG - Intergenic
971337146 4:25733843-25733865 AGTACAATGCTGAGTAGGACTGG + Intergenic
971360560 4:25934414-25934436 GATACAGTGGTGCACAGGACAGG - Intergenic
979097322 4:116567157-116567179 AATACAATGGTGAATAGGATTGG - Intergenic
980615464 4:135216833-135216855 GATACATTGATGAATATAACTGG - Intergenic
983774033 4:171584073-171584095 GATACATTACTGGGTAGGATAGG - Intergenic
984004369 4:174291411-174291433 CATACATTGGTGAGGAAGAGGGG - Intronic
986753073 5:10807741-10807763 GATACAGTGGTGAGCAAGACAGG + Intergenic
987540156 5:19244701-19244723 AATACAATGTTGAGTAGGAGTGG - Intergenic
990940358 5:61196866-61196888 GATACTATGTTGAGTAGGAGTGG + Intergenic
991154432 5:63414879-63414901 GATACAATGGTGAACAAGACAGG - Intergenic
992813561 5:80413520-80413542 GATTCAGGGGTGAGAAGGACTGG - Intronic
993114149 5:83699645-83699667 GGCATATTGGTGAGCAGGACAGG - Intronic
995168265 5:109074007-109074029 AATACATTTTTGAGTAAGACAGG - Intronic
1000308433 5:160017902-160017924 GATACAGTGGTGAACAAGACAGG + Intronic
1000921994 5:167149255-167149277 GATACATAAGTGAACAGGACAGG - Intergenic
1001583912 5:172820007-172820029 GATACATCAGTGAGCAGGACAGG - Intergenic
1005577994 6:27208097-27208119 GACAATTTGGTGAGTAAGACAGG + Intergenic
1008590687 6:52990627-52990649 GACTCATAGGTGAGTAGGAGGGG + Intronic
1011147774 6:84237618-84237640 AATACTATGTTGAGTAGGACTGG - Intergenic
1012090980 6:94896501-94896523 GATACAAAGATGAGTAAGACAGG - Intergenic
1014249044 6:119097294-119097316 AAGAAATTGGAGAGTAGGACAGG - Intronic
1015425912 6:133067072-133067094 GATACAATGGTGAGTAAAAGCGG + Intergenic
1019106498 6:169671852-169671874 GACACAGTGGTGAATAGGAAGGG - Intronic
1020483487 7:8691737-8691759 GGTACAATGGTGAGTAAGATAGG + Intronic
1023052340 7:36263889-36263911 GATACATTTGCGAGTAAGAGGGG + Intronic
1023626164 7:42117181-42117203 AATAGATTGGTCAGAAGGACAGG + Intronic
1023855646 7:44181987-44182009 GATTCCTTGGTTAGCAGGACAGG - Intronic
1027359838 7:77396404-77396426 GATACAATGGTGTGTAAGAGAGG - Intronic
1034932012 7:155169991-155170013 GACGCAGTGGTGAGGAGGACAGG + Intergenic
1039518068 8:38149531-38149553 GAGACATAGGGGAGTAAGACAGG - Intronic
1040593971 8:48820092-48820114 GAGACCTTGGTGAGTAGCAGAGG + Intergenic
1040594087 8:48821060-48821082 GATACATTGTTGAGAAGTGCAGG - Intergenic
1043745855 8:83872498-83872520 GATATAATGGTGAGTTAGACTGG - Intergenic
1045749613 8:105467537-105467559 GATACAGTGGTCAGTAGGACAGG + Intronic
1047350285 8:124067078-124067100 GAGACAGTGGGGAGTAGGCCTGG + Intronic
1047802268 8:128322402-128322424 GATACACTGGTGACCAGGACAGG - Intergenic
1049381861 8:142320135-142320157 GATGCAGTGGTGAGTGGGCCGGG - Intronic
1049958623 9:716481-716503 GATACAATGGTTAGTTGGAGAGG - Intronic
1051753472 9:20369063-20369085 GGGACATGGGTGAGTGGGACAGG + Intronic
1057941950 9:99292828-99292850 GAGACATTGATGAGCAGGGCAGG + Intergenic
1060150652 9:121286177-121286199 GACCCATGGGTGAGTAGCACGGG + Intronic
1186364929 X:8881644-8881666 GATTCAGTGGTGAGTAAAACAGG + Intergenic
1187596637 X:20779953-20779975 AATACATTGGTTAGTAGAAATGG - Intergenic
1190458718 X:50649549-50649571 TATACATTGGTGGGTGGGAATGG + Intronic
1192636057 X:72819435-72819457 AATACATTGTTGAGTAGTAGTGG + Intronic
1192645657 X:72901370-72901392 AATACATTGTTGAGTAGTAGTGG - Intronic
1193147780 X:78095024-78095046 TCTAGATTGGTGAGTGGGACAGG + Intronic
1195606318 X:106809570-106809592 TATACAGTGGTGAATAAGACAGG + Intronic
1196040582 X:111198667-111198689 GACACATAGATGAATAGGACAGG - Intronic
1197254875 X:124252320-124252342 GATACATTGATGAATAAAACAGG + Intronic
1197764028 X:130047814-130047836 GAGACAATGGTGAACAGGACAGG + Intronic
1198126289 X:133647290-133647312 GATACGGTGGTGAGTGGGACAGG + Intronic
1200225197 X:154413244-154413266 GATGCGTTGGTGAGGAGGAATGG + Exonic
1200373466 X:155753483-155753505 GAAAGATTGTTCAGTAGGACAGG - Intergenic