ID: 955226784

View in Genome Browser
Species Human (GRCh38)
Location 3:57066836-57066858
Sequence AGTGAGCCCAAAGGCTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955226784_955226787 -8 Left 955226784 3:57066836-57066858 CCCAGAGAGCCTTTGGGCTCACT 0: 1
1: 0
2: 0
3: 13
4: 139
Right 955226787 3:57066851-57066873 GGCTCACTGCAACTCTTCCCTGG 0: 1
1: 2
2: 5
3: 66
4: 361
955226784_955226789 0 Left 955226784 3:57066836-57066858 CCCAGAGAGCCTTTGGGCTCACT 0: 1
1: 0
2: 0
3: 13
4: 139
Right 955226789 3:57066859-57066881 GCAACTCTTCCCTGGGTCTCCGG 0: 2
1: 0
2: 12
3: 32
4: 270
955226784_955226788 -7 Left 955226784 3:57066836-57066858 CCCAGAGAGCCTTTGGGCTCACT 0: 1
1: 0
2: 0
3: 13
4: 139
Right 955226788 3:57066852-57066874 GCTCACTGCAACTCTTCCCTGGG 0: 1
1: 0
2: 6
3: 50
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955226784 Original CRISPR AGTGAGCCCAAAGGCTCTCT GGG (reversed) Intronic