ID: 955228416

View in Genome Browser
Species Human (GRCh38)
Location 3:57079262-57079284
Sequence AAAACTCACCGCGGCGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 93}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955228400_955228416 24 Left 955228400 3:57079215-57079237 CCCGCACTCACCTCGACCCCCGC 0: 1
1: 0
2: 0
3: 21
4: 207
Right 955228416 3:57079262-57079284 AAAACTCACCGCGGCGGCGGCGG 0: 1
1: 0
2: 1
3: 9
4: 93
955228408_955228416 5 Left 955228408 3:57079234-57079256 CCGCGCTGGTTCGGCCTCTCCAG 0: 1
1: 0
2: 1
3: 7
4: 157
Right 955228416 3:57079262-57079284 AAAACTCACCGCGGCGGCGGCGG 0: 1
1: 0
2: 1
3: 9
4: 93
955228405_955228416 8 Left 955228405 3:57079231-57079253 CCCCCGCGCTGGTTCGGCCTCTC 0: 1
1: 0
2: 0
3: 3
4: 71
Right 955228416 3:57079262-57079284 AAAACTCACCGCGGCGGCGGCGG 0: 1
1: 0
2: 1
3: 9
4: 93
955228401_955228416 23 Left 955228401 3:57079216-57079238 CCGCACTCACCTCGACCCCCGCG 0: 1
1: 0
2: 0
3: 16
4: 147
Right 955228416 3:57079262-57079284 AAAACTCACCGCGGCGGCGGCGG 0: 1
1: 0
2: 1
3: 9
4: 93
955228411_955228416 -9 Left 955228411 3:57079248-57079270 CCTCTCCAGGCTGGAAAACTCAC 0: 1
1: 0
2: 0
3: 11
4: 239
Right 955228416 3:57079262-57079284 AAAACTCACCGCGGCGGCGGCGG 0: 1
1: 0
2: 1
3: 9
4: 93
955228406_955228416 7 Left 955228406 3:57079232-57079254 CCCCGCGCTGGTTCGGCCTCTCC 0: 1
1: 0
2: 0
3: 8
4: 85
Right 955228416 3:57079262-57079284 AAAACTCACCGCGGCGGCGGCGG 0: 1
1: 0
2: 1
3: 9
4: 93
955228407_955228416 6 Left 955228407 3:57079233-57079255 CCCGCGCTGGTTCGGCCTCTCCA 0: 1
1: 0
2: 1
3: 11
4: 96
Right 955228416 3:57079262-57079284 AAAACTCACCGCGGCGGCGGCGG 0: 1
1: 0
2: 1
3: 9
4: 93
955228403_955228416 14 Left 955228403 3:57079225-57079247 CCTCGACCCCCGCGCTGGTTCGG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 955228416 3:57079262-57079284 AAAACTCACCGCGGCGGCGGCGG 0: 1
1: 0
2: 1
3: 9
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955228416 Original CRISPR AAAACTCACCGCGGCGGCGG CGG Exonic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
903413734 1:23167935-23167957 AAAGTTCACCGCGGCGGGCGGGG + Intronic
914073872 1:144322742-144322764 AAAAGCCGCGGCGGCGGCGGAGG - Intergenic
914105282 1:144643618-144643640 AAAAGCCGCGGCGGCGGCGGAGG + Intergenic
921017616 1:211207068-211207090 ACAACTCATGGCGGCGGTGGCGG + Intergenic
1065101968 10:22340605-22340627 AAAACTCGCTGCGGCCGCGCCGG - Intergenic
1066745037 10:38600377-38600399 AAAAGCCACGGCGGCGGGGGGGG - Intergenic
1066950383 10:42111539-42111561 AAAAGCCACGGCAGCGGCGGGGG + Intergenic
1066954302 10:42150127-42150149 AAAAGTCACGGCGGCGGCGGGGG + Intergenic
1066963942 10:42243603-42243625 AAAAGTCGCGGCGGCGGGGGGGG - Intergenic
1073060448 10:100730550-100730572 ATAAATCACTGCGGCGGCGGGGG - Intergenic
1075050142 10:119177504-119177526 AAAACTTAGCCAGGCGGCGGTGG + Intronic
1076638907 10:131901010-131901032 AAATCCCTCCCCGGCGGCGGCGG + Exonic
1083623646 11:64060928-64060950 CATGCGCACCGCGGCGGCGGCGG + Intronic
1083861426 11:65422338-65422360 AAAATTCCAGGCGGCGGCGGAGG - Intergenic
1084483627 11:69435765-69435787 AAACGTCACTGCGGTGGCGGAGG - Intergenic
1100260579 12:92929081-92929103 GAGAGTCACCGCGGCGGCGCCGG - Exonic
1102453265 12:113056803-113056825 AAAGCTCGGCGCGGCGGCCGAGG + Intronic
1113378404 13:109783942-109783964 AGAAGGCACGGCGGCGGCGGCGG + Exonic
1119303652 14:73590563-73590585 GAAGCTCACGGCGGGGGCGGGGG + Intergenic
1123396646 15:19944007-19944029 AAAAGTCGCGGCGGCGGCGGCGG - Intergenic
1123964043 15:25438364-25438386 AACACTCGCCTCGGCGGCGGGGG + Intronic
1132055673 15:98648976-98648998 GGAGCTCGCCGCGGCGGCGGCGG + Exonic
1133021605 16:2969368-2969390 ACAGCTCGCGGCGGCGGCGGCGG - Exonic
1136957369 16:34802691-34802713 AAAAGCCGCGGCGGCGGCGGGGG - Intergenic
1137218997 16:46428233-46428255 AAAAGCCGCAGCGGCGGCGGGGG + Intergenic
1137388514 16:48061777-48061799 AAAACCCACTGTGGAGGCGGGGG + Intergenic
1137531579 16:49281781-49281803 ATAATTCAGAGCGGCGGCGGCGG - Exonic
1203104368 16_KI270728v1_random:1345633-1345655 AAAAACCGCGGCGGCGGCGGGGG + Intergenic
1203129146 16_KI270728v1_random:1616735-1616757 AAAAACCGCGGCGGCGGCGGGGG - Intergenic
1143571291 17:7760275-7760297 AAGAATCACCCCGGAGGCGGAGG + Intronic
1145327377 17:21843080-21843102 ACAAAAAACCGCGGCGGCGGGGG - Intergenic
1150003996 17:61458285-61458307 AAGACTCACGGCGGGGGTGGGGG + Intronic
1154503664 18:15010456-15010478 AAAAGGCGCGGCGGCGGCGGCGG + Intergenic
1164693592 19:30227750-30227772 AAATTGCACAGCGGCGGCGGCGG - Intergenic
1166706040 19:44908590-44908612 ACAACTGACCCCGGTGGCGGAGG + Exonic
1166802816 19:45468699-45468721 AAAACTTACCTGGGAGGCGGCGG - Exonic
1202683467 1_KI270712v1_random:29991-30013 AAAAGCCACGGCGGCGGGGGGGG - Intergenic
926854574 2:17240562-17240584 AAAACTCACCGGGCCGGGCGCGG - Intergenic
928744289 2:34393584-34393606 AAAACCCACAGCAGGGGCGGGGG - Intergenic
932209440 2:69915081-69915103 TAAACACTCCGCGGCGGTGGCGG + Exonic
934247888 2:90323630-90323652 AAAAGCCACGGCGGCGGGGGGGG + Intergenic
934248013 2:90324083-90324105 AAAAGCCGCGGCGGCGGCGGCGG + Intergenic
934248167 2:90324627-90324649 AAAAGCCGCGGCGGCGGCGGCGG + Intergenic
934304467 2:91809927-91809949 AAAAGCCGCGGCGGCGGCGGCGG - Intergenic
934328790 2:92042823-92042845 AAAAGCCGCGGCGGCGGCGGCGG + Intergenic
934467041 2:94272869-94272891 AAAAGCCGCGGCGGCGGCGGGGG + Intergenic
935645443 2:105330019-105330041 GAAGCTCCCCGCAGCGGCGGGGG - Exonic
938518339 2:132038447-132038469 AAAAGCCGCGGCGGCGGCGGGGG + Intergenic
939629763 2:144517180-144517202 AAAAGGAACCGAGGCGGCGGCGG - Intronic
948046910 2:234952062-234952084 GGGACTCACGGCGGCGGCGGCGG - Intronic
1168965408 20:1895277-1895299 AAAAACCGCGGCGGCGGCGGCGG + Intronic
1176583076 21:8549491-8549513 AAAAGCCGCTGCGGCGGCGGGGG - Intergenic
1176586598 21:8594675-8594697 AAAAGTCGCGGCGGCGGCGGGGG - Intergenic
1180265875 22:10526399-10526421 AAAAGCCGCTGCGGCGGCGGGGG - Intergenic
1180269405 22:10571580-10571602 AAAAGTCGCGGCGGCGGCGGGGG - Intergenic
955228416 3:57079262-57079284 AAAACTCACCGCGGCGGCGGCGG + Exonic
955954558 3:64275293-64275315 AAAATGCACTGGGGCGGCGGGGG + Intronic
958711224 3:97719101-97719123 ACTACTTACCGCGGCGGGGGGGG - Intronic
967150677 3:186646336-186646358 AAAACTCACCACAGAGTCGGAGG - Exonic
984823601 4:183905675-183905697 AAAACACCCGGCGGCGGCGCGGG - Exonic
985376199 4:189341560-189341582 AAAATTCCCCGGGGCGGGGGTGG + Intergenic
989102756 5:37836921-37836943 AAAACTCCCCGCGTCGCCAGAGG + Intronic
991466696 5:66920991-66921013 AAAAATCACAGCGGCTGCAGTGG + Intronic
995623753 5:114055481-114055503 AGAACGCGCCGCGGCGGCGGAGG - Intergenic
997297523 5:132777263-132777285 GAAACTCCCCTTGGCGGCGGCGG + Exonic
997869858 5:137497975-137497997 AAACCTCCCCGGGGCAGCGGTGG - Intronic
1002045142 5:176537259-176537281 AGAACTGTCCGCGGCGGCAGCGG + Exonic
1002158970 5:177303809-177303831 ACAACTCATGGCGGCGGCGGCGG + Exonic
1002591077 5:180291986-180292008 CACACCCACTGCGGCGGCGGCGG - Exonic
1002666777 5:180831192-180831214 AAAGGTCCCCGAGGCGGCGGCGG - Intergenic
1007432876 6:41786624-41786646 AGGACTCTCGGCGGCGGCGGCGG + Intronic
1007630305 6:43269745-43269767 TACCCTCACCCCGGCGGCGGCGG + Intronic
1008673316 6:53794981-53795003 GAAGCTCCGCGCGGCGGCGGGGG + Exonic
1014874687 6:126643466-126643488 ACAACTCATGGCGGCGGCGGCGG + Intergenic
1015525781 6:134174893-134174915 AAAAGGCACCGCCGCGGGGGCGG + Intronic
1018613077 6:165662255-165662277 AGTAGTCACCGCGGCGGCGGTGG - Intronic
1021451055 7:20784435-20784457 AAGACGCACAGTGGCGGCGGCGG - Exonic
1023605355 7:41926363-41926385 AAAATTCACCGTGGCTGCAGTGG - Intergenic
1025301434 7:57821926-57821948 AAAGAACGCCGCGGCGGCGGCGG - Intergenic
1025561822 7:62380068-62380090 AAAAGCCGCGGCGGCGGCGGGGG - Intergenic
1026933728 7:74239727-74239749 AAAAGTCACCCCGGAGGCTGAGG - Intronic
1028477273 7:91265628-91265650 AACCCTCAGCACGGCGGCGGAGG + Exonic
1039454277 8:37697225-37697247 CAAACTCAACTCGGTGGCGGCGG + Exonic
1046547206 8:115667925-115667947 AAAACTTGCAGTGGCGGCGGCGG + Intronic
1053697454 9:40650918-40650940 AAAAGCCGCGGCGGCGGCGGGGG + Intergenic
1053697499 9:40651081-40651103 AAAAGCCGCGGCGGCGGCGGCGG + Intergenic
1053697561 9:40651310-40651332 AAAAGCCGCGGCGGCGGCGGGGG + Intergenic
1053697633 9:40651546-40651568 AAAAGCCGCGGCGGCGGCGGGGG + Intergenic
1053946040 9:43311282-43311304 AAAACCCGCGGCGACGGCGGGGG - Intergenic
1054308743 9:63450318-63450340 AAAAGCCGCGGCGGCGGCGGGGG + Intergenic
1054308788 9:63450481-63450503 AAAAGCCGCGGCGGCGGCGGCGG + Intergenic
1054308853 9:63450719-63450741 AAAAGCCGCGGCGGCGGCGGGGG + Intergenic
1054308925 9:63450954-63450976 AAAAGCCGCGGCGGCGGCGGGGG + Intergenic
1054407429 9:64774078-64774100 AAAAGCCGCGGCGGCGGCGGGGG + Intergenic
1054407484 9:64774278-64774300 AAAAGCCGCGGCGGCGGCGGGGG + Intergenic
1054407677 9:64774931-64774953 AAAAGCCTCGGCGGCGGCGGGGG + Intergenic
1054440854 9:65258891-65258913 AAAAGCCGCGGCGGCGGCGGGGG + Intergenic
1054489423 9:65762596-65762618 AAAAGCCGCGGCGGCGGCGGGGG - Intergenic
1202779805 9_KI270717v1_random:24231-24253 AAAAGCCGCGGCGGCGGCGGGGG + Intergenic
1202779844 9_KI270717v1_random:24369-24391 AAAAGCCGCGGCGGCGGCGGCGG + Intergenic
1202779909 9_KI270717v1_random:24607-24629 AAAAGCCGCGGCGGCGGCGGGGG + Intergenic
1203589175 Un_KI270747v1:39862-39884 AAAACCCGCGGCGACGGCGGGGG - Intergenic
1200240455 X:154490480-154490502 CAAACGCGCGGCGGCGGCGGCGG + Exonic