ID: 955231020

View in Genome Browser
Species Human (GRCh38)
Location 3:57098729-57098751
Sequence AAGTTTTTGCAGAGGGACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955231020_955231026 5 Left 955231020 3:57098729-57098751 CCCTAGTCCCTCTGCAAAAACTT 0: 1
1: 0
2: 1
3: 8
4: 201
Right 955231026 3:57098757-57098779 CCATCCATTTTTGTATCACATGG 0: 1
1: 0
2: 3
3: 11
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955231020 Original CRISPR AAGTTTTTGCAGAGGGACTA GGG (reversed) Intronic
902665828 1:17937302-17937324 AAGGTTTTCCAGATGGACAAGGG - Intergenic
903468867 1:23571006-23571028 CAGTTTTTTCAGAGTGACTGTGG + Intergenic
904313071 1:29641847-29641869 CAGTTTCAGCAGAGGGACCAGGG + Intergenic
904688926 1:32279479-32279501 GTTTTTTTGCAGAGGGGCTAGGG - Intronic
907709580 1:56866706-56866728 AAGTTGTAGCAGTGGTACTATGG + Intronic
907952993 1:59202191-59202213 TAGTTTTAGCAAAAGGACTATGG + Intergenic
909501873 1:76343865-76343887 AAGTTTTAACAGAGGAATTATGG + Intronic
911727233 1:101255316-101255338 TCGTTTTTGCAGTGGGACTCTGG + Intergenic
911882028 1:103251934-103251956 AGGTTTTTGCAGAGGTAATCAGG - Intergenic
913175673 1:116270861-116270883 AAGTGTTTGCAGAGGAGCTGTGG - Intergenic
913487017 1:119341036-119341058 GAGTTTTTGTAGTGGGACTTTGG - Intergenic
915515980 1:156412995-156413017 AAGTGTTGGGGGAGGGACTAGGG - Intronic
915876349 1:159615433-159615455 AAGGTTTTTCAGAGGTACGAGGG - Intergenic
917078463 1:171231596-171231618 TTCTTATTGCAGAGGGACTAAGG - Intergenic
917254013 1:173095155-173095177 AAGTCTTTGCAGCCAGACTAAGG - Intergenic
917294914 1:173508558-173508580 AAATTTTAGCAGAGGGATAAGGG - Intronic
917556782 1:176098388-176098410 AAATTTTTGCCTAGGGTCTAAGG + Intronic
923309393 1:232721326-232721348 AAGATTTATCATAGGGACTAAGG + Intergenic
923868378 1:237964238-237964260 AAGATTTTGCAGTGGGAGAAAGG + Intergenic
924167626 1:241301547-241301569 AAGTGTTTGCTGAAGGACAATGG + Intronic
1063390264 10:5645708-5645730 AAGTTTGGGCAAAGGGACTGGGG + Intronic
1063390392 10:5646364-5646386 AAGTTTGGGCAAAGGGACTGGGG + Intronic
1065020800 10:21500445-21500467 ACGTTTTTGCCGAGCGACTCCGG - Intergenic
1065764935 10:29020045-29020067 AAGTTTGTGCCCAGGGACAAAGG + Intergenic
1066313890 10:34224310-34224332 AAGATTTTGCAGAGGTACATGGG + Intronic
1070990850 10:80730995-80731017 AAGTTTCTGCTGAGGAATTAGGG + Intergenic
1071246049 10:83764999-83765021 AAGTATATCCAGAGGGATTAAGG - Intergenic
1075698701 10:124454438-124454460 CAGTTTATGCAGAGGGAGTGGGG + Intergenic
1077590373 11:3486366-3486388 AAGTTCTTGCAGTGGGATGATGG + Intergenic
1078425713 11:11249323-11249345 AAGTTGTTGCAAAGGGGCTGTGG + Intergenic
1079623002 11:22577807-22577829 AAGTTTTTCCATAATGACTAAGG + Intergenic
1081581591 11:44356011-44356033 GAGTTGTGGCAGGGGGACTAGGG + Intergenic
1084617579 11:70246644-70246666 AAGTTTTGCAAGAGGGAGTAAGG - Intergenic
1087596337 11:100258820-100258842 ATGTTTTTGCAGAGGCTGTATGG - Intronic
1088101175 11:106157512-106157534 AACTTTTAGCAGAGGGATTGTGG - Intergenic
1089829007 11:121308493-121308515 ATCTTTTTGCAGAGGAAGTAGGG - Exonic
1090545938 11:127768340-127768362 AAGTTTTTGAAGACTTACTATGG + Intergenic
1097249772 12:57626164-57626186 AGGTGTTTGCACAGGGACTCTGG + Exonic
1099536288 12:83849135-83849157 AATTGTTTTCAGAGGGACTGTGG + Intergenic
1100858594 12:98780357-98780379 GAGTTTATGGAGAGGGACAATGG + Intronic
1101246545 12:102889118-102889140 AAGATTTTTCAAAGGGGCTATGG - Intronic
1102423618 12:112823602-112823624 AAGTTTCTGCAGTGGTCCTAGGG + Intronic
1107063650 13:36188433-36188455 AAGTATTTACAAAGGGACTGAGG - Intronic
1107068440 13:36243137-36243159 AGGTTTGGGCAGAGGGAGTAGGG - Intronic
1107287830 13:38815692-38815714 CAGTTTTTGATGAGGGACTCAGG + Intronic
1108160032 13:47629487-47629509 ATATTTTTGCAGTGGGACAAGGG - Intergenic
1108714758 13:53068192-53068214 ATGTTATTGCAGGGGGACTTAGG - Intergenic
1109162740 13:58996035-58996057 AAGTCTATGGAGATGGACTAGGG + Intergenic
1109872636 13:68354088-68354110 CAGTTTTTGCCTAGGGACCAAGG - Intergenic
1110265478 13:73532314-73532336 AAGTTATTGGATAGGGGCTAGGG + Intergenic
1114205012 14:20561982-20562004 AAGTTTTTACAGTGGCCCTAAGG - Intergenic
1115100021 14:29687519-29687541 AAGTTGTTGCAGAGAGAGTTAGG + Intronic
1115765719 14:36621555-36621577 ATTTTTTTACAGAGGTACTAAGG - Intergenic
1115789361 14:36861825-36861847 AAGTTTTTGGAGAGAGAATTTGG - Intronic
1116381372 14:44273223-44273245 CAGTATTAACAGAGGGACTAAGG - Intergenic
1116946748 14:50842582-50842604 CAGTTTTTGTAGAGGGGCTTTGG + Intergenic
1126689388 15:51276392-51276414 AAGTTTTTGCAGTGGTTCTTTGG - Intronic
1129092555 15:73166752-73166774 AAGTTCTTCCTGAGGGACTTGGG - Intronic
1129106213 15:73309078-73309100 AAGGTTTTGCAGAGGAACTAAGG + Intergenic
1130239607 15:82174725-82174747 AGGGTTTGGCAGTGGGACTAAGG - Intronic
1133355742 16:5135435-5135457 AAGTTTTCGCAGTGGGATGATGG + Intergenic
1137319660 16:47367734-47367756 ATGTTTCTGCACAGGGACAATGG - Intronic
1138292356 16:55858547-55858569 AATGTTTTGAAGTGGGACTAGGG - Intronic
1140927997 16:79601003-79601025 GAGTTTTTCCAGAGGGGCTTCGG + Intergenic
1142901667 17:3015966-3015988 AAGCTGATGCAGAAGGACTAAGG - Intronic
1143756868 17:9073693-9073715 CAGTTTTTGAAGAGAGAATATGG + Intronic
1146664126 17:34685530-34685552 AAGGTTTTGCAGTGGGAATGGGG - Intergenic
1148717427 17:49725774-49725796 ACGTTTTTGCAGATGTATTAAGG + Intronic
1150889575 17:69131991-69132013 AAGTTTTTGCAGTGGAACTTTGG - Intronic
1203171106 17_GL000205v2_random:148453-148475 CCGTGTCTGCAGAGGGACTAGGG + Intergenic
1153230409 18:2930027-2930049 AAGTTCTTGCAGAGTGAATGAGG + Intronic
1154025142 18:10699750-10699772 AGCTTTTGGCAGATGGACTAAGG + Intronic
1156734611 18:40239284-40239306 AAGTTTATGCAGAGAGAACATGG - Intergenic
1157149591 18:45203169-45203191 ACGTTAGTGCTGAGGGACTAAGG + Intergenic
1158152133 18:54385502-54385524 AAGTTTTTGCCTAGGGATAAAGG - Intergenic
1162657239 19:12140265-12140287 AAGTTGTGGCAGAGGGACCCGGG + Exonic
1163342364 19:16717350-16717372 AAGTTTTTGCAGTGTGACAATGG - Intergenic
1167775804 19:51553966-51553988 GAGTTTATGCAGAGGGGCTTTGG + Intergenic
926400155 2:12488644-12488666 AAATTGTTGCAGAAGGACAAGGG + Intergenic
927385742 2:22532056-22532078 AAGTTTATGTAGAGGGTATAGGG - Intergenic
929973965 2:46613398-46613420 AAGTTCTTTCAGAGGTTCTAAGG + Intronic
932862141 2:75305236-75305258 AACTTTTTCCAGAGGGACAGTGG + Intergenic
933349549 2:81136551-81136573 AAGTGTTTGCACAGGGAATGGGG - Intergenic
934604804 2:95686655-95686677 AAATATTTGCAGAGGGAGTATGG - Intergenic
936538254 2:113329187-113329209 AAATATTTGCAGAGGGAGTGTGG - Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
938038489 2:128056023-128056045 CAGTTTTTCCTGAGGGCCTAAGG + Intergenic
939319788 2:140604314-140604336 ATGTTTTTGCAGAAGAAATAAGG + Intronic
939603263 2:144220367-144220389 AAGTTTCTGCAGAGGAAGCACGG + Intronic
940827526 2:158429624-158429646 AAGGTTTTTCTGAGGGATTAAGG + Intronic
941244649 2:163081162-163081184 AAGTTTTTACAGAGAGAGAATGG - Intergenic
941725638 2:168857358-168857380 ACGTGGTTGCAGAGGGAATAGGG + Intronic
942995424 2:182254566-182254588 AAGTCTTTACAGGGGGACTTTGG + Intronic
944428338 2:199607006-199607028 AAATTTTTGCAAAGTGACTGTGG - Intergenic
944956438 2:204816620-204816642 ATTTTTTTGCAGAGGAACAAAGG - Intronic
945700925 2:213170177-213170199 AAGTTTATGCAGAGGGGCCAGGG - Intergenic
947896344 2:233676853-233676875 AAGTTTTTACAAAGGTACAAAGG - Intronic
1170256220 20:14347123-14347145 AAGTTTTTGAAGAGATAGTAAGG + Intronic
1170483839 20:16794783-16794805 AACTTTTTTCAGAGGGCCTGTGG + Intergenic
1170639561 20:18139443-18139465 AAGTTTTTACAATGTGACTAAGG + Intronic
1171303861 20:24088055-24088077 TAATTTTTGCAGAGGGTGTAAGG + Intergenic
1172549910 20:35790696-35790718 AAGCTTTAGCAGAGGGGCTGTGG - Intronic
1173896264 20:46553005-46553027 CAGTTTCTGCACAGGCACTAGGG + Intergenic
1176327090 21:5510284-5510306 CCGTGTCTGCAGAGGGACTAGGG + Intergenic
1176330622 21:5545927-5545949 CCGTGTCTGCAGAGGGACTAGGG - Intergenic
1176397135 21:6275024-6275046 CCGTGTCTGCAGAGGGACTAGGG + Intergenic
1176400667 21:6310667-6310689 CCGTGTCTGCAGAGGGACTAGGG - Intergenic
1176436490 21:6678437-6678459 CCGTGTCTGCAGAGGGACTAGGG + Intergenic
1176440022 21:6714080-6714102 CCGTGTCTGCAGAGGGACTAGGG - Intergenic
1176460752 21:7005507-7005529 CCGTGTCTGCAGAGGGACTAGGG + Intergenic
1176464284 21:7041149-7041171 CCGTGTCTGCAGAGGGACTAGGG - Intergenic
1176484313 21:7387285-7387307 CCGTGTCTGCAGAGGGACTAGGG + Intergenic
1176487845 21:7422928-7422950 CCGTGTCTGCAGAGGGACTAGGG - Intergenic
1177662981 21:24111853-24111875 AAGTATTTGCAAAGGGACAGAGG - Intergenic
1179279439 21:39921876-39921898 AAGTATCTGCTGATGGACTATGG + Intronic
1180630248 22:17224272-17224294 CAGGTTTTGGAGAGGAACTAAGG - Intergenic
1182102438 22:27667589-27667611 CAGTCTCTGCAGAGGGACTGTGG + Intergenic
1182790736 22:32950754-32950776 CAGATTTAGCAGAGGAACTAAGG + Intronic
1183064862 22:35355868-35355890 ATGTTTGTGCACAGGGACTTTGG + Intergenic
1184947840 22:47816793-47816815 AAGGGTTTGCAGAGGGACTGAGG + Intergenic
954873659 3:53786626-53786648 AAGGTTTTGCAAAGCAACTAAGG - Intronic
955100406 3:55843709-55843731 ACATTTTTGCAGTGGGATTAAGG - Intronic
955231020 3:57098729-57098751 AAGTTTTTGCAGAGGGACTAGGG - Intronic
956616749 3:71180068-71180090 AAATATTGGCAGAGAGACTATGG - Intronic
957060417 3:75476871-75476893 AAGTTCTTGCAGTGGGATGATGG + Intergenic
957346689 3:78970678-78970700 AAATCTTTGCAGAGGTAATAAGG + Intronic
957616178 3:82530441-82530463 AAGCTTTTCCAGAGTGACCAGGG + Intergenic
957922162 3:86759926-86759948 AAGAGTTTGCAAAGGGAGTAGGG + Intergenic
959022378 3:101202180-101202202 AAGTTTTTGCAGTGGTAGTTAGG + Intergenic
961292971 3:125862534-125862556 AAGTTCTTGCAGTGGGATGATGG - Intergenic
961894211 3:130153874-130153896 AAGTTCTTGCAGTGGGATGATGG + Intergenic
962843538 3:139255864-139255886 AAGTGTTTGCAGTGGGAGTGAGG + Intronic
962995199 3:140620505-140620527 AAGTTTTTGATGTGGGGCTATGG - Intergenic
964900379 3:161652190-161652212 AAGTTTTTGCAGGAAGAGTAAGG - Intergenic
965416366 3:168398687-168398709 TCCTTTTTGCAGAGGGAGTAAGG + Intergenic
967540996 3:190667677-190667699 AAGTTTTTGAAGATCGGCTAAGG - Intergenic
968289060 3:197524940-197524962 AAGTCTCTGCAGAGGCACCAGGG + Intronic
968710846 4:2116171-2116193 AAGTCTTTCCAGAGTGTCTAGGG - Intronic
969748556 4:9093202-9093224 AAGTTCTTGCAGTGGGATGATGG - Intergenic
972933121 4:44099861-44099883 AAGCTTTTGGGCAGGGACTATGG + Intergenic
978736979 4:112094611-112094633 AAGTGTTTGCAGGGGGAATAGGG + Intergenic
979754553 4:124324850-124324872 AAGAGTCTGCAGAGGGACAAAGG + Intergenic
980089397 4:128426542-128426564 CAGTTTCTGCAGAGGAATTATGG + Intergenic
980784380 4:137533058-137533080 AAGTATTTACAGAGGGAGTGGGG - Intergenic
981772600 4:148327573-148327595 AGGTCATTGCAGAGGGACTTTGG - Intronic
981977299 4:150746466-150746488 AAGTTATTGCAGAGGTAGAATGG - Intronic
986080371 5:4385692-4385714 AATATTTTCCAGAGGGACCATGG + Intergenic
990569062 5:57059638-57059660 AGGTTTTAGCTGAGGGAGTAAGG - Intergenic
990846313 5:60144036-60144058 GAGTGTTTGCAGAGTGACTAGGG - Intronic
992126708 5:73649869-73649891 ACTTTATTGCAGAGGGACGAAGG - Intronic
993785807 5:92134036-92134058 AAGCTTTTGTACAGAGACTATGG + Intergenic
995895723 5:117008164-117008186 AAGTTTTTGGACTGAGACTATGG + Intergenic
998755194 5:145370285-145370307 TAATTTTTGCATAGGGTCTAAGG + Intergenic
999649991 5:153756013-153756035 AACTTTCTGCAGAGGCACGAAGG - Intronic
1000091428 5:157932743-157932765 AAGTTGTTGCAGAAGGAGTGAGG - Intergenic
1001722626 5:173869018-173869040 AAGTTTTACCTGAGGAACTAAGG - Intergenic
1001884365 5:175275739-175275761 AAGATTTTGTAGAGAGACAAGGG - Intergenic
1003809039 6:9759068-9759090 AAGATTTTGCAGAGGTAATTAGG + Intronic
1004291139 6:14368554-14368576 AAGGTTTTGCAGTGGGAGAAAGG + Intergenic
1009869556 6:69436281-69436303 AAGATTTTGCAGATGTATTAAGG + Intergenic
1012659310 6:101866347-101866369 AAGCTTTTGCATAGGTGCTATGG - Intronic
1020324438 7:6963448-6963470 AAGTTCTTGCAGTGGGATGATGG + Intergenic
1024429341 7:49268065-49268087 AAGTTTTTTAAAAGGGACTCTGG + Intergenic
1024445707 7:49476002-49476024 GAGCTTTTGGACAGGGACTAAGG + Intergenic
1027285648 7:76643181-76643203 AAGTTTTTGCAGAGCTCCTCTGG - Intergenic
1027729468 7:81851909-81851931 CAGTTTTTGCAGAGGATATAAGG - Intergenic
1028557858 7:92142483-92142505 ATCTTTTTGCAGAGCTACTATGG - Intronic
1028677332 7:93480798-93480820 AAGTTTCTGCATAGGCACAAGGG + Intronic
1033758986 7:144420646-144420668 AATCTTTTCCAGAGGGACCAGGG - Intergenic
1034999255 7:155598692-155598714 AAGTTGTTGCAGAGCCAATATGG + Intergenic
1036371624 8:8167503-8167525 AAGTTCTTGCAGTGGGATGATGG - Intergenic
1036479338 8:9124360-9124382 TGGTTTTTGCAGCGGGAATAAGG + Intergenic
1036879279 8:12498141-12498163 AAGTTCTTGCAGTGGGATGATGG + Intergenic
1037155208 8:15691398-15691420 AAGCTTTTGGACAGAGACTATGG + Intronic
1037746147 8:21646526-21646548 GGGTTTTAGCAGGGGGACTATGG - Intergenic
1038082691 8:24157618-24157640 AAGTTCTTGTAGAGGATCTAAGG + Intergenic
1038375607 8:27037318-27037340 AAGTTTTGGTAGAGGGACAAAGG + Intergenic
1039424150 8:37471812-37471834 AATGTTTTGGAGAGGGAGTAGGG - Intergenic
1040068827 8:43172627-43172649 AAGTTTCTGCTGTGGGACTGAGG + Intronic
1042449572 8:68928987-68929009 AAGTTTGTGCAGACAGAATAAGG + Intergenic
1043917111 8:85935930-85935952 AAGTGATTGCACATGGACTAGGG - Intergenic
1043936257 8:86146081-86146103 AATTTAATGCAGAGGCACTATGG - Intronic
1044222523 8:89686082-89686104 AAGATTTTATACAGGGACTAAGG + Intergenic
1046137168 8:110042829-110042851 GAGTTTTTGGACAGAGACTATGG - Intergenic
1049821501 8:144636389-144636411 TTGTTTTTACTGAGGGACTAGGG + Intergenic
1050918337 9:11165961-11165983 AAGGTTTTGCAGAGGTAGAAAGG + Intergenic
1052694446 9:31858112-31858134 AAGCTTTTGGACAGAGACTATGG - Intergenic
1052914892 9:33917309-33917331 AGGTTTTTGCTGAGGGGCCATGG - Exonic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054971035 9:71087132-71087154 AAGTTCTTGCTGAGGGATGAGGG - Intronic
1055296752 9:74841095-74841117 AAGTGTTTTCAGAGGGATAATGG - Intronic
1055650377 9:78401122-78401144 AAGGTTTTGCAGAGAGAAAAAGG - Intergenic
1057097416 9:92325007-92325029 AAACTTTTCCAGAGGTACTAGGG + Exonic
1057672801 9:97109553-97109575 AAGTATATGGAGAGTGACTAGGG - Intergenic
1058187534 9:101872643-101872665 AAGCTTTTGCATTGAGACTATGG - Intergenic
1061377685 9:130235864-130235886 GAGGCTCTGCAGAGGGACTATGG - Exonic
1203431473 Un_GL000195v1:94399-94421 CCGTGTCTGCAGAGGGACTAGGG + Intergenic
1186388721 X:9136733-9136755 AAGTCTTTGCAGAACGAGTAGGG - Intronic
1190561826 X:51694136-51694158 AAGATTTTGCAGATGGAATGAGG + Intergenic
1192607134 X:72529968-72529990 CAGTCTTGGCAGAGGGACAAAGG - Intronic
1192866546 X:75139176-75139198 AATTTTGAGCAGAGGGAATAAGG - Intronic
1193240483 X:79163452-79163474 ATGTTCTTGCAGAAAGACTATGG - Intergenic
1193520506 X:82523816-82523838 AAGGTTGTGCAGAGAGACAAAGG + Intergenic
1196533928 X:116818334-116818356 AAGTGTTTTCAGAGGGATAATGG + Intergenic
1199641107 X:149862737-149862759 AAGTTTTTGGGCAGAGACTATGG - Intergenic
1201782770 Y:17741672-17741694 AAGTTTCTGCAGAGGAAACAAGG + Intergenic
1201818783 Y:18164316-18164338 AAGTTTCTGCAGAGGAAACAAGG - Intergenic