ID: 955239678

View in Genome Browser
Species Human (GRCh38)
Location 3:57167500-57167522
Sequence CTGTTTCACCAAAACCCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 4, 3: 6, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955239678_955239682 -7 Left 955239678 3:57167500-57167522 CCATATGGGTTTTGGTGAAACAG 0: 1
1: 0
2: 4
3: 6
4: 146
Right 955239682 3:57167516-57167538 GAAACAGGGAGGAAACAATGAGG 0: 1
1: 0
2: 2
3: 41
4: 535

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955239678 Original CRISPR CTGTTTCACCAAAACCCATA TGG (reversed) Intronic
904673314 1:32181770-32181792 CAGTTGCTCCAAAACCCAGAAGG - Intronic
906473618 1:46151756-46151778 CTCTTTCCCCAAAACCTAAAGGG + Intronic
906608504 1:47187052-47187074 CCGTTTCCCCAAAACTCACAGGG + Intronic
906666586 1:47626440-47626462 CTGTTGCCAGAAAACCCATATGG + Intergenic
907182591 1:52583921-52583943 ATCTTTCACCAAAACCCATAAGG - Intergenic
909351810 1:74662390-74662412 ATATTTCACCACAACTCATAGGG - Intronic
911233828 1:95388172-95388194 CTGCTACAGCAGAACCCATATGG + Intergenic
911413594 1:97542235-97542257 TTATTTCACCAAAAAGCATAGGG - Intronic
911624807 1:100110741-100110763 CTGTTGCACCTAAACATATATGG - Intronic
913560877 1:120018206-120018228 CTGTTTCTCCAGATCCCATTAGG - Intronic
913637251 1:120775396-120775418 CTGTTTCTCCAGATCCCATTAGG + Intergenic
914281461 1:146177618-146177640 CTGTTTCTCCAGATCCCATTAGG - Intronic
914542506 1:148628554-148628576 CTGTTTCTCCAGATCCCATTAGG - Intronic
914624127 1:149442690-149442712 CTGTTTCTCCAGATCCCATTAGG + Intergenic
917630910 1:176890535-176890557 CTGCCTCACCATAACCCACAAGG - Intronic
918141647 1:181724913-181724935 CTCTCCCACCAAAACCCAAAAGG - Intronic
919070135 1:192744701-192744723 TTGTTCCACCAAAGCCCACAAGG + Intergenic
919101386 1:193101368-193101390 TTGTTTCACTAAAACCAAAAAGG + Intronic
921138239 1:212282323-212282345 CTGTTTCACCAAAGCCCAGATGG + Intergenic
922134152 1:222808293-222808315 CTTTTTCACCTAAACACAAAGGG - Intergenic
923537807 1:234866496-234866518 TTGTGTCACCAAAAACCATGGGG + Intergenic
1065457583 10:25923174-25923196 CTTTTTCACCCAAACCCACCAGG - Intergenic
1066306176 10:34143372-34143394 TTGTGTCATCAAAACCCATCAGG - Intronic
1066935543 10:41827865-41827887 CTATTTCACCATAGGCCATAAGG + Intergenic
1068033524 10:51732062-51732084 CTGTTTCAACAAAAACAAAAGGG - Intronic
1069432010 10:68345825-68345847 CTTCTTCACCAAAACCAGTACGG - Exonic
1069479814 10:68771372-68771394 CTGATGAACCAAAACCCAAACGG + Exonic
1070640427 10:78164969-78164991 CTGTTTCATGAATACCCATCGGG - Intergenic
1073909473 10:108324622-108324644 CAGTCTCACCAAAACCCTTTAGG - Intergenic
1082153936 11:48779075-48779097 CTATTTCACCATAGTCCATAAGG + Intergenic
1082581965 11:54882130-54882152 CTTTTTCACCAAAAGCCTCAAGG - Intergenic
1085292787 11:75411868-75411890 CTGCTTCACCAAGAGCCACAAGG - Intronic
1087577583 11:100009388-100009410 GTGTTTCAAGAGAACCCATAGGG + Intronic
1088469900 11:110180316-110180338 CTATTTCCCCAACCCCCATATGG + Intronic
1089077414 11:115749423-115749445 ATGTTTCACCAGAAGACATAGGG - Intergenic
1090122201 11:124042411-124042433 CTGTTTCACTAAAACCCAGTGGG + Intergenic
1090662667 11:128892721-128892743 CGTTTTCATCAAAAGCCATATGG + Intronic
1092451466 12:8606236-8606258 CTTCTTCACCAAAATCCAGATGG - Intronic
1094314276 12:29120773-29120795 TTCTTTCACCAAAACCTATTAGG + Intergenic
1094630255 12:32166856-32166878 AATTTTCACCAAAACCTATAAGG - Intronic
1094863317 12:34496771-34496793 CTTTTTCACCAAAATCCTCAAGG + Intergenic
1095627697 12:44336688-44336710 CTGTTTTAAAAAAAACCATAGGG + Intronic
1098195050 12:67990950-67990972 GTGCTTCACCAAACCACATAGGG - Intergenic
1102479301 12:113210161-113210183 CTGTTTCAGAAAAATCTATAGGG + Intronic
1105074979 13:16003859-16003881 CTGTTTCACCACAGTCCAGAAGG - Intergenic
1105075274 13:16009495-16009517 CTGTTTCACCATAGTCCAGAAGG - Intergenic
1105075573 13:16015137-16015159 CTGTTTCACCATAGTCCAGAAGG - Intergenic
1106740857 13:32639392-32639414 CTGTTTTACCAGAACAAATAAGG + Intronic
1108785384 13:53894598-53894620 CTGTTTCAAGAAAACTCTTATGG - Intergenic
1109143033 13:58740151-58740173 GTGTTTCCCCAAAATTCATATGG - Intergenic
1114682903 14:24501878-24501900 CTCTTTCACCAAAATCAATTCGG + Intronic
1115473865 14:33795830-33795852 CTATTCCATCAAATCCCATATGG + Intronic
1118465402 14:66026004-66026026 CTATGTCAACAAAACCCAAAGGG + Intergenic
1120420687 14:84282262-84282284 CAGTTTCACCAAAGACCATGAGG + Intergenic
1121749952 14:96343766-96343788 CAGTTTAAACAAAACACATAAGG + Intronic
1123578916 15:21698710-21698732 ATGTTGCACCAGAACCCACAAGG + Intergenic
1123615543 15:22141192-22141214 ATGTTGCACCAGAACCCACAAGG + Intergenic
1125542497 15:40478164-40478186 CTGTGTCAACAAAACCCCTGGGG - Intergenic
1126329225 15:47513914-47513936 CTGTTTCAACAAATCATATAGGG + Intronic
1129064643 15:72890559-72890581 CTGTTGCACCAGAACCCCTCAGG + Intergenic
1131635215 15:94225949-94225971 CACTTTCACCAAAAACCATCAGG + Intergenic
1132377488 15:101339390-101339412 CTGGTTCACCAAATCTCAGAAGG - Intronic
1202987786 15_KI270727v1_random:432955-432977 ATGTTGCACCAGAACCCACAAGG + Intergenic
1134354135 16:13465258-13465280 CTGTGTCCCCAAAACACATCTGG - Intergenic
1135650374 16:24201219-24201241 CTGTATCAACAAAACTCCTATGG + Intronic
1139751534 16:69111895-69111917 CTGATCCACCAGAACCCAGATGG - Intronic
1145283961 17:21489930-21489952 GTGGCTCACCAAAACCAATAAGG - Intergenic
1146003357 17:29145223-29145245 GTGTTCCACGAAAATCCATATGG + Intronic
1146029657 17:29354503-29354525 CTGTTTCATTAAAATCCATTAGG - Intergenic
1146590182 17:34122025-34122047 CTGTATGACCAAAGCCCATATGG + Intronic
1147858274 17:43499944-43499966 CTGTTGCACCAGAACCCAGACGG + Exonic
1148495532 17:48051428-48051450 CTGGTTCACCGAGACCCAGAGGG + Exonic
1150943937 17:69724009-69724031 CTATATCAGAAAAACCCATATGG + Intergenic
1152605663 17:81288410-81288432 AGTTTTCACCAAAACCCACAGGG + Intronic
1153253857 18:3150711-3150733 TTGTTTCATGGAAACCCATATGG - Intronic
1156511114 18:37637629-37637651 TTGCTTCTCCAATACCCATATGG - Intergenic
1157496529 18:48161198-48161220 CTCCTTCACCAAGACCCAGAGGG + Intronic
1160293831 18:77619740-77619762 CTGTTTCACCAAATAACATCTGG + Intergenic
1163167935 19:15510310-15510332 CTGATTCTCCAAACCCCAGATGG + Intronic
1168061841 19:53897516-53897538 CTGTTTTACCAAACCCTCTAGGG + Intronic
925225711 2:2182717-2182739 CTCCTTCCCCAAAACCCAAAGGG - Intronic
936655881 2:114486282-114486304 TTTTTTCAACAAGACCCATATGG - Intronic
937338750 2:121077569-121077591 CAGTTTCACCATACCCCACATGG + Intergenic
937570713 2:123355894-123355916 ATGTTTTACCAAAACCCATAAGG - Intergenic
937621362 2:123991540-123991562 CTGTTTCATCCCAACCGATATGG + Intergenic
938598620 2:132814195-132814217 CTGTAGCAACAAAGCCCATAAGG - Intronic
940603792 2:155894179-155894201 CTGTCTCCACAAAACACATAAGG + Intergenic
948029618 2:234806502-234806524 ATGTCTCTCCAAAACTCATATGG + Intergenic
948803363 2:240442694-240442716 CTGTACCCCCAAAACCCACATGG - Intronic
1171200427 20:23236583-23236605 CTGTTTCAGAAAAACACATCTGG + Intergenic
1174348977 20:49953398-49953420 CTGATTGACCAAAAGGCATATGG + Exonic
1175568566 20:60000613-60000635 AATTTTCACCAGAACCCATAGGG + Intronic
1180953328 22:19730505-19730527 CTGTGTCCCCAAGACCCATCTGG + Intergenic
1181033485 22:20159126-20159148 CTGCTTCCCCACAACCCAAACGG + Intergenic
1181509820 22:23384118-23384140 CTGCTTCCCCACAACCCAAACGG - Intergenic
1182526586 22:30924151-30924173 CTGCTTCAGAATAACCCATATGG - Intergenic
950036739 3:9891168-9891190 ATCTTTCACCAAAACCTAAAAGG - Intronic
951119775 3:18912391-18912413 CCATTTCACCAAAACTCTTAGGG + Intergenic
955239678 3:57167500-57167522 CTGTTTCACCAAAACCCATATGG - Intronic
955883912 3:63577371-63577393 TTGGTTCACCAAGACCCACATGG + Intronic
956932646 3:74062743-74062765 TTGTTCCACCAAATCCCAAAAGG + Intergenic
957965627 3:87319688-87319710 GTGTTTCCCCAAAATTCATATGG - Intergenic
960479727 3:118172909-118172931 GTGTTCCTCCAAAACTCATATGG + Intergenic
965916166 3:173848904-173848926 CTTTTTAAACAAAACTCATAAGG + Intronic
966668896 3:182505374-182505396 CTCTTTGATCAAAACCCAAAGGG + Intergenic
969115443 4:4868119-4868141 CTGTGTCACCAGAACCCCTGTGG - Intergenic
970144589 4:13021726-13021748 CTCTTCCACCAAATTCCATAAGG + Intergenic
973191548 4:47391261-47391283 TTGTTTAACTAAAACCCATTAGG - Intronic
974961289 4:68704342-68704364 GTATTTCACATAAACCCATATGG + Intergenic
976122665 4:81800163-81800185 CTGTTTGACCCAGACCCATTTGG - Intronic
978469676 4:109050333-109050355 GTGTTTCAGCAAAACTCTTAAGG + Intronic
978973766 4:114843553-114843575 TTTTTTCACCAAAATCCATCTGG + Intronic
979761862 4:124415964-124415986 GTGTTTTAACAAACCCCATAGGG + Intergenic
982421580 4:155205020-155205042 CTTTTTCACCCAAACACAAATGG - Intergenic
984833461 4:183997966-183997988 TTGTTTCAGCTAAACCCATAAGG + Intronic
988024569 5:25668600-25668622 CTATTTCAGCAAAGCCCATCTGG + Intergenic
991078978 5:62574482-62574504 CTATCTCAGCAAAACCCAGAAGG + Intronic
991085792 5:62647309-62647331 CTGTTTAGGCAAAACCCAAAAGG + Intergenic
996388701 5:122936606-122936628 CTGATCCCCCAAAACCCAGAAGG - Intronic
999426241 5:151489954-151489976 GTGTTTCGCCAAAGCTCATAAGG + Exonic
999873962 5:155781911-155781933 CTGTTTCAAGACAAACCATAAGG - Intergenic
1000528759 5:162391920-162391942 CTGGTTCACAAAAAGACATAGGG + Intergenic
1001140847 5:169142619-169142641 CTGGGTCAACAGAACCCATAGGG + Intronic
1002876746 6:1217445-1217467 CTGTATCTCCAAAGCCCACAGGG + Intergenic
1007846560 6:44762765-44762787 GTGACTCACCAAAACCAATAAGG + Intergenic
1009654850 6:66529176-66529198 CTCTTTTTCCAAAACTCATATGG + Intergenic
1009840101 6:69060268-69060290 CTCTCTCAGCAAAAGCCATAGGG + Intronic
1011895094 6:92215761-92215783 CTCTTTCACCAACACCCTCATGG + Intergenic
1016598040 6:145823539-145823561 CTATGTCACCACAACCCAAATGG + Intergenic
1017423884 6:154300728-154300750 CTGTTTCTTCAAAGCCCATGGGG - Intronic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1024125260 7:46288448-46288470 CTGTTTCAACAAAAAGCAAAGGG + Intergenic
1025571679 7:62579979-62580001 CTATTTCACCATAGGCCATAAGG + Intergenic
1029409140 7:100397741-100397763 CTGCTCCACCCAAACCCATCAGG - Intronic
1031949014 7:127872313-127872335 CTGTTTCACAAAACCCCACATGG - Intronic
1033307774 7:140237812-140237834 CTTTTTCAAGAAAAGCCATAAGG + Intergenic
1034760560 7:153668414-153668436 CAGTGTCACCCAAACCCATCAGG + Intergenic
1038036997 8:23694771-23694793 CTGGCTCTCCAAAACACATAAGG - Intergenic
1039243605 8:35583628-35583650 ATGTTCCACCAAAAGCTATAGGG - Intronic
1041803216 8:61822428-61822450 CTGATTCACCAAAACCCATGGGG - Intergenic
1042885543 8:73545945-73545967 CTGTTTCAAAAAAATCAATAGGG - Intronic
1052113914 9:24625331-24625353 CTCTTTCCCCAAAAGCCATAGGG + Intergenic
1052249235 9:26377855-26377877 ATGTTACACCTAAAACCATAAGG - Intergenic
1055665997 9:78553710-78553732 CTGTTTCCCCAAAAGCCTTCCGG + Intergenic
1057922452 9:99108412-99108434 ATGTTTAACCAAAACACACATGG - Intronic
1058417372 9:104802767-104802789 CTGTTCCTTCAAAACCCAGAAGG + Intronic
1060142291 9:121220619-121220641 CTGTTTCACACAAACACATTAGG + Intronic
1203401781 Un_KI270519v1:110862-110884 CTGTTTCACCATAGTCCAGAAGG - Intergenic
1203683247 Un_KI270757v1:7294-7316 CTATTTCACCTTAAGCCATAAGG + Intergenic
1185460574 X:331212-331234 CTGTTTCACCGAGACCCGAACGG + Intergenic
1186165957 X:6825997-6826019 TTTTTTAACAAAAACCCATAGGG + Intergenic
1188080591 X:25834922-25834944 CTTTGTGACCAAAACCCATCAGG - Intergenic
1189730268 X:44012820-44012842 CTGTGTCACCAACCCCCAGATGG - Intergenic
1190015529 X:46823752-46823774 CTGCTTCATCAAAATCCAGATGG + Intergenic
1193418166 X:81249720-81249742 CTTTTTCACAAAAACACAAACGG - Intronic
1197230050 X:123993987-123994009 CTGTTACAGCAAAACACAAATGG - Intronic
1198021962 X:132667706-132667728 CTGTCACACCAAAAACCACAGGG - Intronic