ID: 955244629

View in Genome Browser
Species Human (GRCh38)
Location 3:57212984-57213006
Sequence CCCCATGTGCATGTGTGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955244629_955244632 4 Left 955244629 3:57212984-57213006 CCCTGGCACACATGCACATGGGG 0: 1
1: 0
2: 2
3: 17
4: 174
Right 955244632 3:57213011-57213033 ACGTGTACTGTTCTGTAATGTGG 0: 1
1: 0
2: 1
3: 1
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955244629 Original CRISPR CCCCATGTGCATGTGTGCCA GGG (reversed) Intronic
900745429 1:4357474-4357496 CCCAATGGGCGTGTGTTCCAGGG - Intergenic
902325939 1:15700802-15700824 CCCCATTTTCATGTGATCCAAGG - Intronic
902694831 1:18133245-18133267 CCCCCAGAGCATGTGAGCCAGGG + Intronic
905474391 1:38215659-38215681 CCCCTGCTTCATGTGTGCCAGGG + Intergenic
905480358 1:38257705-38257727 CCCCATGTGCCTGGCAGCCATGG + Intergenic
906271361 1:44481594-44481616 CCATAGGTGTATGTGTGCCATGG - Intronic
907256021 1:53179787-53179809 ACCCATGTGCATGTGTGCAATGG + Intergenic
907273971 1:53306770-53306792 GCCCAAGTTCATGTGTCCCAGGG - Intronic
908842682 1:68295050-68295072 CCCAGTGTGCATGTGTTACAGGG + Intergenic
912482190 1:109991673-109991695 CCCTCTGAGCCTGTGTGCCAAGG + Intronic
915225707 1:154409857-154409879 CCCCATGTGTGTTTGTGGCAGGG + Intronic
920584874 1:207148351-207148373 ACACATGTAAATGTGTGCCATGG + Intergenic
921989081 1:221344810-221344832 CCCAATGAGCATGTGTGCAAGGG + Intergenic
1064633845 10:17344169-17344191 CCCTCTGTGCATCTTTGCCATGG - Intronic
1066457507 10:35585070-35585092 CCCCATCTGCCTGGGTGCCTGGG + Intergenic
1067541552 10:47158714-47158736 CTCCATGTGCATGTGTGGGTAGG + Intergenic
1068718391 10:60214444-60214466 ACACAGGTACATGTGTGCCATGG + Intronic
1070383393 10:75902105-75902127 GCCCATGTGGATGTGTGCAAAGG - Intronic
1071316855 10:84409809-84409831 ACACATGTAAATGTGTGCCATGG + Intronic
1072205887 10:93204997-93205019 CCCCATGGACGAGTGTGCCAGGG + Intergenic
1075590931 10:123691180-123691202 GTCCATTTGCATGTGTGCCCTGG + Exonic
1076055911 10:127372748-127372770 CGCCATGGGCATGTATGCAAGGG - Intronic
1077433614 11:2527864-2527886 CCCCAGGTGCATCTGTGGGATGG + Intronic
1083263313 11:61534804-61534826 CCACATGTCCATGTGTGCCATGG - Intronic
1083683167 11:64360573-64360595 CACCTTGTGCAGGTGTTCCAGGG - Exonic
1084166251 11:67376024-67376046 CCCCAGGTGGATGTGTGCTGGGG - Intronic
1084399180 11:68933774-68933796 CCCTCTCTGCCTGTGTGCCAGGG + Exonic
1086145280 11:83544786-83544808 CCACATGTGTATGTGTGACCTGG - Intronic
1087426534 11:97994357-97994379 CACCCTGTGCATGCGTGCCTTGG + Intergenic
1089010025 11:115124565-115124587 TCCCAGGTGCCTGTGTGTCAAGG - Intergenic
1091116712 11:133019925-133019947 CAGCATGTGCATGTGTGCACTGG - Intronic
1094870875 12:34598640-34598662 CACCCTGTGCATGTGTGGCTAGG - Intergenic
1095235399 12:39789517-39789539 CTCCAGGTACATGTGTGCAAGGG + Intronic
1096673854 12:53215869-53215891 CCCCATGTGCATTTGTTCCTTGG + Intronic
1102012053 12:109624796-109624818 TCACATGTGCATGTGTGGCCAGG - Intergenic
1102392171 12:112558047-112558069 CCCCATGTGCTTCTATTCCAAGG + Intergenic
1102457743 12:113081482-113081504 CCCCATCTGTCTGTGTGCCCCGG - Intronic
1105427258 13:20304586-20304608 TCCCATGAGAATGTGTGACATGG + Intergenic
1105972097 13:25438834-25438856 CCCCATATGCCTATGTGACACGG + Intronic
1106373367 13:29159306-29159328 CTCTATGTGCATGTGTGTCTAGG + Intronic
1107434974 13:40374093-40374115 CTCCAGCTGCATGTGTGCCCAGG - Intergenic
1109670793 13:65604149-65604171 CTTCAAGTGAATGTGTGCCATGG + Intergenic
1111003810 13:82222136-82222158 CAGCATGAGCATGTGTGCCAAGG + Intergenic
1111028042 13:82559873-82559895 ACCCATGTGGATATGTGGCATGG + Intergenic
1113764293 13:112871125-112871147 CCCCCTCTGCATGGGTGCCTGGG + Intronic
1113863729 13:113507986-113508008 CCCCATCTGCAGGTGCGCCCAGG - Intronic
1119061062 14:71475107-71475129 TTCCTTGTGCATGTGAGCCAAGG + Intronic
1119608379 14:76040886-76040908 CTGCCTGTGCATGTGTGCCAGGG + Intronic
1121233863 14:92378157-92378179 TCACATGTGTATTTGTGCCATGG - Intronic
1124236088 15:27990310-27990332 CCTCATGGGCATGTTTGCCTAGG - Intronic
1125679634 15:41522777-41522799 CCCCTTGTGGATCTGGGCCAGGG + Exonic
1126799911 15:52289194-52289216 CCCCATGTCCGTGTCTCCCAAGG + Intronic
1126840428 15:52712273-52712295 CACCATGTGAAGGTGTGCCTAGG - Intergenic
1128561935 15:68674411-68674433 CCCCAGGTGATTGTGTGCCCTGG + Intronic
1130099130 15:80878786-80878808 CACCATGTGCATATCGGCCAGGG + Exonic
1131342933 15:91619662-91619684 CCACATGTGTGGGTGTGCCATGG + Intergenic
1133042019 16:3065903-3065925 CCCGAGGTGCCTGTGTGTCAGGG + Intronic
1136029881 16:27495179-27495201 CCCCAGGTGCAGGAGTGGCAGGG + Intronic
1138073307 16:54015505-54015527 TGCCATGGGCATTTGTGCCATGG - Intronic
1138073310 16:54015520-54015542 TGCCATGGGCATTTGTGCCATGG - Intronic
1139373947 16:66485220-66485242 CTACATGTGAGTGTGTGCCAGGG - Intronic
1141851715 16:86650620-86650642 GTTCATGTGCATATGTGCCAAGG + Intergenic
1142190329 16:88714449-88714471 CCTCCTCTGCATGTGTGCCCTGG + Exonic
1142226112 16:88878370-88878392 CCCTGTGTGCATCTGTGCCTGGG - Intronic
1145001046 17:19304823-19304845 CACCCTGTGCATGTCAGCCAAGG - Intronic
1146372746 17:32275526-32275548 CCCCAGCTGCATGCGTTCCAGGG + Intronic
1147142544 17:38467396-38467418 CCCCATCTGCCTGTCTGCCATGG + Intronic
1147767179 17:42844940-42844962 CCCCCTGTCCAGGTGGGCCAGGG - Exonic
1147768374 17:42851669-42851691 CCCCCTGTCCAAGTGAGCCAGGG - Exonic
1147770964 17:42867601-42867623 CCCCCTGTCCAAGTGAGCCAGGG - Intergenic
1150644199 17:66968089-66968111 CCCCATCTGCAGATGAGCCAGGG + Intronic
1151913184 17:77098015-77098037 CTCCTTTTGCTTGTGTGCCAGGG - Intronic
1154377265 18:13820672-13820694 CCCAATGTTCATGTGTGACATGG + Intergenic
1157916412 18:51668150-51668172 CCCCAATTCCCTGTGTGCCAAGG + Intergenic
1160566473 18:79789460-79789482 CCGTATGTGCCTGTGTGCCCAGG - Intergenic
1161724160 19:5918802-5918824 CCCCGGGAGCAGGTGTGCCAGGG - Intronic
1165138649 19:33686303-33686325 ACCCATGTGCCTGGGAGCCAGGG - Intronic
1165352247 19:35282150-35282172 CCCCGTGTGCATGTAGGCGATGG + Intronic
925409779 2:3633236-3633258 CCCCAAGTGCATCTGTGCCCAGG - Intronic
929112989 2:38420915-38420937 CCCCATCTGGGTGAGTGCCATGG - Intergenic
931659801 2:64548609-64548631 AGCAATGTGCATGTGTGCAAGGG + Intronic
932060628 2:68494547-68494569 ACCTAGGTGAATGTGTGCCATGG + Intronic
932432019 2:71681848-71681870 CACCGTGTGCCTGAGTGCCATGG + Intronic
933292245 2:80451091-80451113 TCCCATGTGATTTTGTGCCACGG + Intronic
935135253 2:100294350-100294372 CCCCATCTTTGTGTGTGCCATGG - Exonic
937225303 2:120365414-120365436 CCCCCTGTGCCTCTGTGCCTTGG + Intergenic
938069678 2:128301810-128301832 CCCGATGTCCATGAGTGCCGGGG - Intronic
938082239 2:128376413-128376435 ACCCATGGGCAAGTGGGCCAGGG + Intergenic
938184126 2:129213037-129213059 CCCAATGTACATCTGTGCGAGGG + Intergenic
939216949 2:139250745-139250767 ACACAGGTGAATGTGTGCCATGG - Intergenic
939587283 2:144020556-144020578 CCCAATGGGCATGTGTTACAGGG - Intronic
947331272 2:229032102-229032124 CCCCCTGTGTATTTGGGCCATGG + Intronic
947940544 2:234050949-234050971 CCCCATGTGCTTGCGTGTCCAGG + Exonic
948808738 2:240464398-240464420 CCACGTGTGCACCTGTGCCACGG - Intronic
948972960 2:241443488-241443510 TCCCAGGGGCAGGTGTGCCAAGG + Intronic
1172040529 20:32041474-32041496 TACCATGTGCATTTCTGCCAAGG - Intergenic
1172186560 20:33034719-33034741 CACCATGGGCATCTCTGCCATGG - Intronic
1174822534 20:53739370-53739392 CCCCAGGAGCATGTATGACATGG - Intergenic
1180096607 21:45558256-45558278 CCCCAAGTCCAGGTGGGCCACGG + Intergenic
1180713359 22:17855069-17855091 CCTCCTGGGCATGTGTGGCACGG - Intronic
1180987101 22:19911549-19911571 AGCCCTGTGCATGTGTGCCCTGG - Intronic
1181536518 22:23549122-23549144 CCCCATGTGCAGGCCTGCCCTGG - Intergenic
1181949633 22:26544635-26544657 GCCCTTGTGCCTGTGTGCCAAGG + Exonic
1182896448 22:33863110-33863132 TCCCGTGTTCCTGTGTGCCACGG - Intronic
1183457185 22:37929294-37929316 TCCCATGTGCATGGCTGCCTGGG + Intronic
1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG + Intronic
1184630441 22:45774106-45774128 CAGCATGTGCATGTGTGCGCTGG + Intronic
1184650129 22:45915837-45915859 CTCCATGACCAAGTGTGCCATGG - Intergenic
1184992460 22:48180168-48180190 AAACAAGTGCATGTGTGCCACGG + Intergenic
1185097649 22:48820523-48820545 CTGCATGTGCATGTGTGTCGTGG + Intronic
950479212 3:13234365-13234387 CACCATGTCCATGTGAGCCTGGG + Intergenic
950707689 3:14793168-14793190 CCACCTGTGTATGTGTGTCAGGG + Intergenic
953563588 3:44013096-44013118 CCCTATGTGGATGTGTGCAGAGG + Intergenic
953935136 3:47035000-47035022 CCATAGGTGCATGTGTGCCTGGG - Intronic
955244629 3:57212984-57213006 CCCCATGTGCATGTGTGCCAGGG - Intronic
955801539 3:62691868-62691890 CCACAGGTAAATGTGTGCCATGG - Intronic
956816695 3:72914589-72914611 GCCCATGTGCGTGTGTGTGAGGG + Intronic
961449896 3:126997970-126997992 CCCCATGTGCCTGTGGGGGAAGG - Intronic
962231404 3:133668670-133668692 CCTAATGTGCATGAGTGCTAAGG - Intergenic
962852570 3:139318948-139318970 CCACATGTGGATGTGGGCCCGGG + Intronic
965452976 3:168861247-168861269 CCCCTTGTGCACGTGTGGTAGGG + Intergenic
968208238 3:196823837-196823859 GCCCATATGCCTGTGGGCCAAGG - Intronic
968954078 4:3709348-3709370 CCCTCTGTGAATGTGTGGCATGG + Intergenic
974568697 4:63613579-63613601 ACACAGGTACATGTGTGCCATGG - Intergenic
975499543 4:75069594-75069616 TCCCATGTGCCTGGGTGCAAAGG + Intergenic
976464220 4:85349338-85349360 CACCATGTGAATGTGAACCATGG - Intergenic
979666054 4:123312049-123312071 CCAGATGAGCATGTGTACCATGG - Intronic
980866986 4:138563477-138563499 CCCCAGGTGCTTGAGTGCAATGG + Intergenic
981310768 4:143295905-143295927 CCCCATATGAAAGTTTGCCAAGG + Intergenic
981638101 4:146903563-146903585 ACCCATATGCATGTGTGCCTCGG + Exonic
982205719 4:152995896-152995918 CCCCATGTGTGGGTGTCCCATGG - Intergenic
984840677 4:184064737-184064759 CCCCATCTGAATGTGTGTCTTGG - Intergenic
985879404 5:2627304-2627326 CGCCATTTCCATGTGTGCCCAGG + Intergenic
989095635 5:37778803-37778825 CCAAATGTGCAAGTGTGCCATGG - Intergenic
992348878 5:75909225-75909247 ACACCTGTGCATGTGTGTCAGGG + Intergenic
992465271 5:76998152-76998174 CCCCATGTGAACTTGTGCAATGG + Intergenic
993878961 5:93341136-93341158 CACCATGTGCATTGGGGCCAGGG - Intergenic
996533013 5:124545765-124545787 GCCCATATGCATTTGTGGCATGG + Intergenic
997347064 5:133199665-133199687 GCCCAGGTGGGTGTGTGCCATGG + Exonic
998832229 5:146172174-146172196 CCATATGTGTATGTGTGCAAGGG - Intronic
998890547 5:146741241-146741263 CTCCATGTACATATGTGCCTTGG + Intronic
1000581235 5:163037161-163037183 GCCTATGTGCCTGTGTGCCTTGG - Intergenic
1002103945 5:176870678-176870700 GCCCATGTGCAGGTATGCTAAGG - Intronic
1002559595 5:180072195-180072217 CCCCGAGCGCATGCGTGCCAGGG + Intergenic
1004156309 6:13171279-13171301 CCCACTGTCCATGTGTGCCCTGG + Intronic
1004417222 6:15436092-15436114 CCCAGTGTGCATGTGTTACAGGG + Intronic
1004426281 6:15509468-15509490 CCACATGGGTCTGTGTGCCATGG + Intronic
1004811071 6:19263783-19263805 TCCCATGTGCATGAGTGACATGG + Intergenic
1004970381 6:20903698-20903720 GCCCATGTGCATTTGTATCACGG + Intronic
1005400435 6:25427230-25427252 ACCCAGGTAAATGTGTGCCATGG + Intronic
1005885131 6:30091862-30091884 CCCCATGTGCCTCTGTGTCTTGG + Intergenic
1008707301 6:54178141-54178163 CCCCATGTAAATGTGTGCTTTGG - Intronic
1010150381 6:72724692-72724714 GCCACTGTGCATGAGTGCCATGG + Intronic
1010655072 6:78502733-78502755 CTCCATGTGCATGTGCACCATGG + Intergenic
1011401497 6:86967034-86967056 CCCCATGTACCCATGTGCCATGG + Intronic
1012336106 6:98060270-98060292 CCCCATTTGCAAGTGTGTGAAGG - Intergenic
1015076353 6:129163183-129163205 CTCCAGCTGCATGTGTGCTAGGG + Intronic
1017152990 6:151297687-151297709 CCCCGTGTGAATGTGTGTCCTGG + Intronic
1017807173 6:157955824-157955846 CTCCACATGCATGTGTGGCAGGG - Intergenic
1018271703 6:162086393-162086415 TACAATGTGCTTGTGTGCCATGG - Intronic
1019927964 7:4205800-4205822 CCCCATGGGCATGTGGGCGAGGG + Intronic
1021482002 7:21128444-21128466 CCCCCTGTGCAAGTGTGCTGGGG - Intergenic
1023043198 7:36190612-36190634 CCCCCTCTGCAAGTCTGCCAAGG - Intronic
1023761744 7:43470499-43470521 CATCATCTGCATGTGTGCCATGG - Intronic
1024449289 7:49520558-49520580 GCTCATTTGCATGTGTGCTAAGG + Intergenic
1030649629 7:112103409-112103431 CCCCATGTTCCTGAGAGCCAGGG + Intronic
1031425930 7:121605838-121605860 AGCCATGAGCATGTGTTCCAGGG + Intergenic
1031814652 7:126418336-126418358 ACCCATAAGCATGTGTGCCCTGG - Intergenic
1033882580 7:145903271-145903293 CACCATGCGCATGTGTGCTTGGG + Intergenic
1034074881 7:148222031-148222053 CCCCTTCTTCATGTCTGCCACGG + Intronic
1035343584 7:158182406-158182428 ACCTATGTATATGTGTGCCATGG + Intronic
1035732705 8:1864057-1864079 CCACATGTGCATGGGAGCCACGG - Intronic
1035758718 8:2053864-2053886 ACCCATGTGCATGTCTTCCATGG + Intronic
1042510793 8:69608930-69608952 GCACATGTGCATGTGTGTGATGG - Intronic
1048096409 8:131300253-131300275 CCCCTTGTGCCAGTGTGCCCTGG - Intergenic
1049013021 8:139900194-139900216 GCCCGTGTGCGTGTGTGCCTGGG + Intronic
1050312702 9:4369640-4369662 CTCCATGTGCATGTGAGGAATGG - Intergenic
1051118803 9:13729154-13729176 CCCCTTGTGCATGTGAGAGAGGG + Intergenic
1051587485 9:18742050-18742072 CCCTCTGTGCATGTCTGTCATGG + Intronic
1054141288 9:61531934-61531956 ACCCATGTGCCTGTGTGCTTGGG + Intergenic
1054460980 9:65462372-65462394 ACCCATGTGCCTGTGTGCTTGGG + Intergenic
1055697237 9:78899277-78899299 GCCTGTGTGCAAGTGTGCCATGG + Intergenic
1056015434 9:82381257-82381279 ACACAGGTACATGTGTGCCATGG - Intergenic
1056591575 9:87969428-87969450 CCCCATGTGAGTGTGTGTTAGGG - Intronic
1057570379 9:96199883-96199905 ACACATGTGCATGTGTGCATGGG - Intergenic
1061466689 9:130786074-130786096 CCCCATGTGCCTGTGTGGTGTGG - Intronic
1061539704 9:131271563-131271585 CCCCATGCCCATGTATGGCAGGG - Intronic
1062115408 9:134805747-134805769 CCCCATGGGCATGGGGGCCCTGG + Intronic
1062600814 9:137317908-137317930 CCCTCTGTGCCTGTGTGACATGG + Intronic
1192169801 X:68847123-68847145 TCCCAGGAGCATCTGTGCCAGGG - Intergenic
1192856126 X:75014266-75014288 ACCTATGTAAATGTGTGCCATGG + Intergenic
1199431208 X:147762073-147762095 CCCCAAGTACATGTCTTCCATGG - Intergenic
1200101261 X:153689986-153690008 GCATGTGTGCATGTGTGCCAAGG - Intronic
1200135886 X:153874484-153874506 GTCCATGTGCATCTGTACCAAGG + Intronic