ID: 955246916

View in Genome Browser
Species Human (GRCh38)
Location 3:57233704-57233726
Sequence TATAGTATAAAGAAGGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 371}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955246916_955246920 6 Left 955246916 3:57233704-57233726 CCTTTCCCCTTCTTTATACTATA 0: 1
1: 0
2: 4
3: 36
4: 371
Right 955246920 3:57233733-57233755 TAGCTTCCTCCTCTGAAAATAGG 0: 1
1: 0
2: 27
3: 257
4: 1812
955246916_955246923 15 Left 955246916 3:57233704-57233726 CCTTTCCCCTTCTTTATACTATA 0: 1
1: 0
2: 4
3: 36
4: 371
Right 955246923 3:57233742-57233764 CCTCTGAAAATAGGAAGCTAAGG 0: 1
1: 0
2: 2
3: 22
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955246916 Original CRISPR TATAGTATAAAGAAGGGGAA AGG (reversed) Intronic
902867964 1:19293138-19293160 TCTAGTATATAGAAGAGGAGAGG + Intergenic
902883425 1:19387905-19387927 TATTGTCTAAAGGAAGGGAAAGG - Intronic
903481325 1:23655420-23655442 TATGTTAAAAAGAAGGGGAGAGG - Intergenic
905032026 1:34891348-34891370 TATAATATCAAGAACAGGAAAGG + Intronic
905961289 1:42044647-42044669 AATAGTATGGAGAAGGGGAGGGG + Intergenic
906854520 1:49290537-49290559 AATTGTATTAAGAAGGGGAAAGG + Intronic
907133616 1:52118952-52118974 TAAAGTTCAGAGAAGGGGAAAGG - Intergenic
908440135 1:64145282-64145304 TATGGAACAAAGAAGGGGAAGGG + Intronic
908453943 1:64283655-64283677 TATATCATTAAGAAGGGCAATGG + Intergenic
908652769 1:66354032-66354054 CATAGTAAAATGAATGGGAATGG - Intronic
909235256 1:73144728-73144750 TATAGGAAAAAGAAAGGAAAAGG + Intergenic
909364382 1:74802252-74802274 TATTGGAGAAAGAAGGAGAAAGG - Intergenic
910811358 1:91240402-91240424 TAAAGTTTAAAGAAAGGAAAGGG - Intergenic
910840713 1:91558793-91558815 TAAAGAATGAATAAGGGGAAGGG - Intergenic
911861711 1:102959472-102959494 GAGAATATAAATAAGGGGAAGGG - Intronic
911922906 1:103789847-103789869 TATAGTCTAGAGAGGGAGAAAGG - Intergenic
912282633 1:108332373-108332395 AAAAGTAGAAAGCAGGGGAAAGG + Intergenic
912578018 1:110693486-110693508 TAGAGTCTGAAGAAGGAGAAGGG - Intergenic
913137033 1:115901410-115901432 TTTATTATGGAGAAGGGGAAAGG - Intergenic
913320690 1:117586548-117586570 TACAGTATGAAGAAGGAGAAGGG + Intergenic
914345092 1:146792126-146792148 TAAAGTAGAAAGAAGGGGCCAGG - Intergenic
914998829 1:152568621-152568643 AACAGTATACAGAAGGGGGAGGG - Intronic
915516525 1:156415948-156415970 GATAGGAGAGAGAAGGGGAAAGG - Intronic
916115740 1:161483762-161483784 TATATTAGAAAGGAAGGGAATGG - Intergenic
916908311 1:169314838-169314860 TAAAGTAAAAAGAATGGAAAAGG + Intronic
917904731 1:179577162-179577184 TATAGAAGAAAGTAGTGGAATGG - Intergenic
918179577 1:182074808-182074830 TATACTATATAAAAGGAGAAAGG + Intergenic
918976759 1:191498310-191498332 TTAAGCATAAAGAAGGGGAAGGG - Intergenic
921367741 1:214389777-214389799 TATACTCTAAAGAAGGGAAAAGG + Intronic
921616496 1:217273921-217273943 AATTGTCTAAAGAAGGGGAGAGG - Intergenic
922006593 1:221537133-221537155 TGCAGTATAAAGAAGGCAAAGGG + Intergenic
922954681 1:229589044-229589066 TATAGTTTAGAGAAGGAGACAGG - Intergenic
924937162 1:248781838-248781860 TTTAGTATAGAGATGGGGATGGG - Intergenic
1062785604 10:262181-262203 AATAGTCTAAAAGAGGGGAATGG - Intergenic
1063717989 10:8548025-8548047 TATAGCATAAAGATGGAGGAGGG - Intergenic
1063835816 10:10010563-10010585 TATATTCTGATGAAGGGGAAGGG - Intergenic
1064259549 10:13774238-13774260 TATTGTATAAAGTAGGGGGGTGG + Intronic
1064687046 10:17873642-17873664 AATAGGAGAAAGAAAGGGAAGGG + Intronic
1068848293 10:61706146-61706168 GAAAGTATAAAGAAATGGAAAGG - Intronic
1070902932 10:80046719-80046741 TGTAGAAGAAGGAAGGGGAAGGG + Intergenic
1071541948 10:86493392-86493414 TATATTATAGAGAGGGAGAAAGG + Intronic
1071745014 10:88407491-88407513 AATAGTACAAAGAAAGAGAAGGG + Intronic
1072028359 10:91489164-91489186 TCTACTTTAAAGAAGGAGAATGG + Intronic
1072181281 10:92983433-92983455 AATACTTTAAAAAAGGGGAAGGG - Intronic
1073400547 10:103253405-103253427 AATAGCACAAAGAAGGAGAAAGG - Intergenic
1073879411 10:107962638-107962660 TATAGAATCAAAAAGTGGAATGG + Intergenic
1074693164 10:116025360-116025382 GAAAGCATAGAGAAGGGGAAGGG + Intergenic
1074936831 10:118190283-118190305 AATAGGAAAAAGAAGGGCAAGGG + Intergenic
1075794147 10:125106928-125106950 TAAAGCAAAAAGAAGGGGAATGG + Intronic
1077345373 11:2046578-2046600 TGAAGTATAAAAACGGGGAATGG - Intergenic
1078148184 11:8736514-8736536 AGAAGAATAAAGAAGGGGAAAGG + Intronic
1078391444 11:10938665-10938687 AAGAGGAAAAAGAAGGGGAAGGG - Intergenic
1079986408 11:27204843-27204865 AATAGTAATAAAAAGGGGAAGGG + Intergenic
1080083620 11:28252235-28252257 GAAAATATAAAGAAGGGAAAGGG + Intronic
1081029767 11:38064471-38064493 TATAGTATACAGGATGTGAAAGG - Intergenic
1082193241 11:49272204-49272226 TATAGTAAAGAGAAGGGGTCCGG + Intergenic
1083777050 11:64899204-64899226 CATAGAATAGAGAAGGGGTAGGG - Intronic
1085550537 11:77366476-77366498 AATAGAATAAAGAAGGGGCAGGG + Intronic
1085719670 11:78902174-78902196 TACAGTTTAGAGAAAGGGAAAGG + Intronic
1086295546 11:85363339-85363361 GCTAGAATAATGAAGGGGAATGG + Intronic
1086772450 11:90784201-90784223 TTCAGTATAAAAAAGAGGAAAGG - Intergenic
1086991513 11:93308801-93308823 TACAGTATAAGGAAGGGGTCCGG - Intergenic
1087469634 11:98555804-98555826 AATAGCACAAAGGAGGGGAAGGG - Intergenic
1087526935 11:99326753-99326775 CAAAGTATAAAGAAGGGAAGGGG + Intronic
1087779711 11:102289413-102289435 TTTATTATAGAGAAGGAGAAGGG - Intergenic
1088021690 11:105127314-105127336 TATACAATAAAGAAAGAGAAAGG + Intergenic
1088063770 11:105690162-105690184 TACAGCATCAAGAAGGGGGAAGG - Intronic
1088170978 11:106996241-106996263 CATAGGAAAAAGAAGGGGAGGGG + Intronic
1088610153 11:111568961-111568983 TAAAATAAAAAGAATGGGAAGGG + Intergenic
1088713596 11:112529398-112529420 TAGAGAAAAAAGAAGGGGAAAGG + Intergenic
1089710293 11:120309714-120309736 TATAGTATAAAGAAGGGCGAGGG + Intronic
1091525335 12:1294250-1294272 TAAAATTTAAAGAAGGAGAAAGG - Intronic
1091529554 12:1340761-1340783 TATATTAAAAAAGAGGGGAAGGG - Intronic
1093709584 12:22314717-22314739 TAGAGTACAAACAATGGGAATGG - Intronic
1094678252 12:32643406-32643428 CAGAGTATAAGGAAGGGAAATGG + Exonic
1095091023 12:38105353-38105375 TATGGTGTAAAGAAGGGGTCTGG + Intergenic
1095351877 12:41223090-41223112 TCTAATATAAAGAATGGGTAAGG + Intronic
1096208913 12:49747137-49747159 TATAGTTTAAAAGAGGGGAAAGG - Intronic
1097922337 12:65089803-65089825 AATAGTATAAAGATGAGGAAGGG - Intronic
1098695067 12:73542145-73542167 TAAGGTATAAAGAAGGGGTCAGG - Intergenic
1099112276 12:78576312-78576334 TGTATTCTAAAGAAGGGAAATGG - Intergenic
1099122312 12:78706529-78706551 TATAGGAGAAAAAAGAGGAAAGG + Intergenic
1100301393 12:93311088-93311110 TATAGTATAAACTTGGGGGAGGG + Intergenic
1101101722 12:101400442-101400464 TAAAGAATAAAGAAGGGTAAAGG + Intronic
1101769383 12:107734836-107734858 AATAGTATACAGCAGTGGAAGGG - Intronic
1102344942 12:112153524-112153546 TAAAATAAAAACAAGGGGAAGGG - Exonic
1102947109 12:116999560-116999582 AAGAGTATAAAGGTGGGGAAAGG - Intronic
1103137981 12:118524182-118524204 TTTAGTAAAAAGGAGGGGACCGG + Intergenic
1103770959 12:123323679-123323701 AATAAAATAAAGAAGCGGAAAGG - Exonic
1105345462 13:19567218-19567240 TGTACTATAAAGAAAGGGAATGG + Intergenic
1106220080 13:27739468-27739490 TATGGAAGAAAGAAGGAGAATGG - Intergenic
1106372536 13:29149697-29149719 TATAGTGTAAAGAAGGGGCCTGG + Intronic
1106724083 13:32466646-32466668 TATGCTATAAAGAAAAGGAAGGG + Intronic
1107339353 13:39389403-39389425 AAACGTATAAAGAAGGGGTATGG + Intronic
1107464863 13:40640268-40640290 TAAAGGATAAGGAAAGGGAAAGG + Intronic
1108163943 13:47672308-47672330 TAGAGTAAAAACAAGGTGAAAGG + Intergenic
1109920313 13:69048931-69048953 TAAATTATAAAGAAGTTGAATGG - Intergenic
1110322054 13:74171671-74171693 TAGAGTATAATGAAATGGAATGG + Intergenic
1110374193 13:74774000-74774022 TATAGTATGAAGAATATGAAGGG + Intergenic
1110493865 13:76142133-76142155 TGTAGAATAAAAAAGTGGAATGG + Intergenic
1110689279 13:78413012-78413034 TATAGTATGAGGTAGGGGGAAGG + Intergenic
1110773884 13:79383769-79383791 TAAAGTGTAAAGGAGGAGAAAGG + Intronic
1112691155 13:101896142-101896164 AATAGTAAAAAGAAAGGGAAGGG - Intronic
1112746976 13:102537464-102537486 CAAAGAATAAATAAGGGGAATGG + Intergenic
1113113732 13:106852099-106852121 TATATTTTAAGGTAGGGGAAAGG + Intergenic
1113262957 13:108586369-108586391 TATAGTATAAAGATGAGGGAAGG - Intergenic
1113437170 13:110302165-110302187 CAGAGGATAAAGAAGAGGAAAGG + Intronic
1114391804 14:22317174-22317196 TAGAGAATAAAGAAGAGGTAGGG + Intergenic
1114426972 14:22631870-22631892 CATAGTAGAAAAAAAGGGAAAGG - Intergenic
1114553645 14:23549004-23549026 TATGGTACAAAGAAGGTAAATGG - Intronic
1114855390 14:26434100-26434122 AATAGTAGAAACATGGGGAAAGG - Intergenic
1115515396 14:34180165-34180187 TAGAATATAAACAAAGGGAAAGG + Intronic
1116157096 14:41219256-41219278 TATGGTATAAGGAAGGGGTCTGG - Intergenic
1116237675 14:42300185-42300207 TAGAGAATAAAGAAGGAGAGAGG + Intergenic
1116753319 14:48914431-48914453 TGTAGTATAGGGAAGGAGAAAGG + Intergenic
1117834341 14:59786624-59786646 TATAGGATAAAGAGGGAGGATGG + Intronic
1118094159 14:62517706-62517728 GTTAATATAAAGAAGGGGGAAGG - Intergenic
1118712566 14:68534443-68534465 TAAAGGATAAAGGAGGAGAAAGG + Intronic
1119362968 14:74067252-74067274 TACAGTATAAAGAGAGGAAATGG + Intronic
1119412587 14:74443118-74443140 CATAGTGTAAAGAGGGGGCAGGG + Intergenic
1120052082 14:79878424-79878446 TACAGTATAAGCAAGGGGAGAGG + Intergenic
1120181527 14:81347731-81347753 TATTTTATAGAGAAGGGGGAGGG - Intronic
1120854762 14:89203015-89203037 TAAAGTTTAAAAAAGGGAAATGG - Intronic
1121432036 14:93894331-93894353 TTTGGTAAAAAGGAGGGGAAGGG - Intergenic
1124932838 15:34138789-34138811 TATAGAATAAAAAAGGGGGGAGG + Intergenic
1126260923 15:46690183-46690205 TATAGTATAGATAAAGGGATAGG + Intergenic
1128118554 15:65128978-65129000 GCTAGAGTAAAGAAGGGGAAGGG + Intronic
1129201101 15:74000601-74000623 TAAAGTATACAGGAGGGGATGGG - Intronic
1130170774 15:81510735-81510757 TATAGTATAAAAGAGTGGATTGG + Intergenic
1130297519 15:82657574-82657596 TATAGAATAAAGGTGGGTAAGGG + Intergenic
1130832947 15:87620248-87620270 TAAAGAATAAAGAAGAGGAGAGG - Intergenic
1131216431 15:90539953-90539975 TATAGTATTTTGTAGGGGAACGG - Intronic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1134159707 16:11877280-11877302 CTTAGTGTAGAGAAGGGGAATGG - Intronic
1134806500 16:17130471-17130493 AAAAATATAAAGAAGGTGAAGGG - Intronic
1135646421 16:24166428-24166450 TATAAAAGAAAAAAGGGGAAAGG - Intronic
1137399624 16:48142650-48142672 TATAATATAAAGAATGGGGAAGG - Intronic
1139411913 16:66769156-66769178 TATAGGAGAAAGAAGGGTATGGG + Intronic
1139988902 16:70923170-70923192 TAAAGTAGAAAGAAGGGGCCAGG + Intronic
1140318400 16:73922357-73922379 TACAGTATAGAGTTGGGGAAAGG - Intergenic
1140791770 16:78398927-78398949 TCTAGTACAAGGAAGGGGATGGG + Intronic
1144082536 17:11777909-11777931 TATAGTATAATGAAATTGAAGGG + Intronic
1145782897 17:27575319-27575341 TATGGTCTAAAGAGGGGGAGGGG - Intronic
1146063848 17:29620722-29620744 TGAAGTAGAAAGAAAGGGAACGG - Intronic
1148096196 17:45053897-45053919 TACAGTTTAAGGAAAGGGAAGGG - Intronic
1149284697 17:55149575-55149597 TATAAAATAAGGAAGGGGAGGGG - Intronic
1150031324 17:61739105-61739127 TGTGGTCTAAAGAAGGGAAAAGG + Intronic
1151078616 17:71302957-71302979 TATAGAAAAAAGACTGGGAAGGG - Intergenic
1151962085 17:77410904-77410926 TTTAGGATGAAGAAAGGGAAAGG - Intronic
1153318222 18:3745487-3745509 TATAATCTAAACAAGGGAAAAGG + Intronic
1154472014 18:14712734-14712756 AATAGGCTAGAGAAGGGGAAGGG - Intergenic
1155608848 18:27639907-27639929 TATAATACCAAGGAGGGGAAAGG - Intergenic
1155705607 18:28807020-28807042 TATAGTAAAAAGAGAGAGAAAGG + Intergenic
1156343319 18:36232632-36232654 GGTAGGATAAAGAAGGGGATAGG - Intronic
1156807206 18:41199308-41199330 TTTTGTATAAATAAGGGCAAAGG - Intergenic
1157628997 18:49078459-49078481 TATAGTATATAGGAGAGGAGAGG - Intronic
1158057517 18:53299347-53299369 TATAGGATAAGGAAAAGGAAAGG - Intronic
1158204114 18:54972744-54972766 TATGGTACAAAGAAATGGAAAGG - Intergenic
1158365466 18:56729461-56729483 CATAGTATAAAGTGGGGGAAGGG - Intronic
1159041376 18:63325982-63326004 TATAGTTGCAAGAAGGGAAAAGG - Intergenic
1159155935 18:64581642-64581664 TATAGTTTAACTTAGGGGAAGGG + Intergenic
1159305536 18:66637086-66637108 TAAAGTATACAGAAGCAGAAGGG - Intergenic
1160483596 18:79265915-79265937 TATGGTGTAAAGAAGGGGTCCGG + Intronic
1161381821 19:3969576-3969598 TACAGGATAAAGAACAGGAAAGG + Intronic
1162682792 19:12359424-12359446 TATAGTTTAGAGAAGGGGGGAGG - Intronic
1166683029 19:44779515-44779537 TTTAATATAAAGAAGTGGCATGG - Intronic
925806545 2:7656009-7656031 TATTTTATAAAGAAGGGTGAAGG - Intergenic
925855382 2:8124237-8124259 TGTTTTATAAAGAAGGGAAATGG - Intergenic
926025850 2:9544091-9544113 TAGAGGATAAAGAAGGGGTTTGG - Intronic
926832996 2:16985126-16985148 AATAGCACAAAGAAGGGGAGAGG - Intergenic
926879662 2:17530159-17530181 AATAGTATGAATAAGCGGAAAGG - Intergenic
927614385 2:24576415-24576437 TGTAGTGTAAAGAAGGGAGATGG - Intronic
928312448 2:30222111-30222133 AACAGTAAAAAGAAGGGGTAGGG - Intergenic
928323026 2:30298442-30298464 TAGAGTTTAAAGAAAGGGGAAGG + Intronic
928925516 2:36575119-36575141 TATAGTCTAATGACGGAGAAAGG - Intronic
930173319 2:48274481-48274503 TAGAGTATAAAGAAGAGAACTGG - Intergenic
930466158 2:51752562-51752584 TCAAGTACAAAGAAGAGGAAAGG - Intergenic
930776313 2:55174655-55174677 TATAGTGGAAAGAAGATGAACGG - Intergenic
931192643 2:60020506-60020528 TACAGTTTAGAGAAGGGGACAGG + Intergenic
931534112 2:63252994-63253016 TATAGTTTAAAGTTGGGTAATGG - Intronic
933619350 2:84519593-84519615 AATAGGAAGAAGAAGGGGAAGGG - Intronic
935490145 2:103709493-103709515 AACAGTAAAAGGAAGGGGAAAGG + Intergenic
935521053 2:104105601-104105623 AAGAGTATTAAGTAGGGGAAAGG + Intergenic
937193156 2:120124017-120124039 TGAAGAATAAAGAAGAGGAAAGG + Intronic
937546198 2:123023995-123024017 AATAATAAAAATAAGGGGAAAGG + Intergenic
937547435 2:123039717-123039739 GATAGTATAAAGGCGGGGACAGG + Intergenic
939111142 2:138008739-138008761 TATAGTATAAGGAAGGAGACTGG - Intronic
940124397 2:150308698-150308720 TATAGTAGAGAGATGGGGACAGG + Intergenic
940438601 2:153685829-153685851 TAAGGTATAAGGAAGGGGACCGG + Intergenic
940508020 2:154580275-154580297 TATGGGAGAGAGAAGGGGAAGGG + Intergenic
942225925 2:173815987-173816009 GGTAGTACAAAGAAGGAGAAGGG + Intergenic
942422413 2:175821566-175821588 GTCAGTATAAAGAAGGGGACGGG - Intergenic
942551901 2:177128454-177128476 TATATTATAAAGTAAGAGAATGG + Intergenic
943298405 2:186166609-186166631 TCTAGTACAAACAGGGGGAAGGG + Intergenic
943535266 2:189140671-189140693 TTTAATAAAAAGAAGGGGAGGGG - Intronic
943638775 2:190336026-190336048 TCTAGAATAAGGAAGGTGAATGG - Intronic
944065974 2:195619219-195619241 TAGAGTAAAATAAAGGGGAAGGG + Intronic
944687105 2:202127236-202127258 AATAGTAGAATGAAGGGAAATGG - Intronic
946068427 2:217010195-217010217 GAGAGTGTAAAGAAGGTGAAAGG - Intergenic
946558357 2:220884944-220884966 TATAGTAGAAAGAGAGAGAAGGG + Intergenic
947407044 2:229789233-229789255 TATAGCATAGAGAAGAGTAAAGG - Intronic
947562033 2:231163263-231163285 TCTGGTACAAAGAAGGGAAATGG + Intronic
947707152 2:232285515-232285537 TAGAATCTAGAGAAGGGGAAAGG + Intronic
948224259 2:236296675-236296697 TTTAGTTAAAAGAAGGGAAAGGG + Intergenic
1170807473 20:19645425-19645447 TATAGAATAAATAAGTGGAGTGG + Intronic
1171930858 20:31227835-31227857 TATAATATAAAGGACTGGAATGG + Intergenic
1173171757 20:40731519-40731541 TATAATAAAAAAAAGGGGGAGGG - Intergenic
1174846320 20:53946784-53946806 TATAGTATATAGTATAGGAAAGG + Intronic
1176754146 21:10713265-10713287 TAGAGTAGAAAGGAGTGGAATGG - Intergenic
1176802481 21:13445168-13445190 AATAGGCTAGAGAAGGGGAAGGG + Intergenic
1177579214 21:22997598-22997620 AAAAATATAAAGTAGGGGAAAGG + Intergenic
1177758727 21:25378427-25378449 TATGGTATAAGGAAGGGGTCTGG - Intergenic
1178137297 21:29641927-29641949 TATAGTGTAAAGAAGAGGGAGGG - Intronic
1179341530 21:40514858-40514880 TAGAGTATAAAGATGTGGAATGG + Intronic
1179815300 21:43902295-43902317 TATAGCATAAAGTAGGGTGAAGG - Intronic
1182933802 22:34200903-34200925 TGTAATAAAGAGAAGGGGAATGG - Intergenic
1184284101 22:43457801-43457823 AATAGCATAAAGGAGGGGGAGGG - Intronic
1203302478 22_KI270736v1_random:86750-86772 TATAGTGGAAAGAAGTGGAGTGG + Intergenic
1203310463 22_KI270736v1_random:139102-139124 TGGAGTATATAGGAGGGGAATGG + Intergenic
1203310718 22_KI270736v1_random:140830-140852 TGGAGTGTAAAGAAGAGGAATGG + Intergenic
1203314819 22_KI270736v1_random:179385-179407 TATAGTAGAATGGAGTGGAATGG + Intergenic
949123455 3:416908-416930 TGAAGAAAAAAGAAGGGGAAAGG - Intergenic
949896414 3:8770139-8770161 TTTAGAATAGAGAAGGGGCAGGG - Intronic
950769855 3:15302612-15302634 AATAGGAAAAAGAAGAGGAATGG + Intronic
951142492 3:19181278-19181300 TATAGAACAAAGCAGGAGAAGGG - Intronic
951941725 3:28086826-28086848 TTTAGTCTAAAGAAGGAGAAAGG - Intergenic
953370224 3:42381232-42381254 AATAGTTTAAAGAACAGGAAAGG - Intergenic
953414917 3:42710057-42710079 TAAAGTATAAAGATGGAGACAGG - Intronic
953707844 3:45244734-45244756 TAAAAAATAAATAAGGGGAAAGG + Intergenic
955246916 3:57233704-57233726 TATAGTATAAAGAAGGGGAAAGG - Intronic
956272286 3:67460919-67460941 TAAGATATAAAGAAGGGGAGGGG + Intronic
957457394 3:80469686-80469708 TATTTTAAAAAGAAGGGAAAAGG - Intergenic
957578056 3:82034482-82034504 CAGAGTATAAAGCAGGGTAAGGG + Intergenic
957793347 3:84967891-84967913 AATGGCAAAAAGAAGGGGAAAGG + Intronic
957794192 3:84981682-84981704 TAAAGAAGAAAGAATGGGAAGGG - Intronic
958512917 3:95072167-95072189 TATAGAATCAAGGAGTGGAATGG + Intergenic
958700812 3:97586945-97586967 TCAAGTATAAAGAAAGGGCAGGG + Intronic
958832829 3:99110338-99110360 TATGGAATAAGGAAGGGGCATGG - Intergenic
959864352 3:111249215-111249237 TAAAGGATAAAGAAGTGTAATGG - Intronic
959966031 3:112356205-112356227 TATTGTATAAAAAAGGGAGAAGG - Intronic
960589624 3:119352931-119352953 AATAGTATAAACAAGGTGAAAGG - Intronic
960646429 3:119889407-119889429 TATAGCACAAAGAACAGGAAGGG + Intronic
961971654 3:130974640-130974662 TATATCATAAAGATGGGGAGGGG + Intronic
962139339 3:132772098-132772120 TGTAGTATAAAAAGGGGCAACGG + Intergenic
962184913 3:133247972-133247994 TATAGTATAATCAAGGAGAAAGG + Intronic
962267990 3:133957074-133957096 TAGAGCAGAAAGAAGGGCAATGG - Intronic
963337580 3:143994376-143994398 ATTATTATAAAGTAGGGGAAGGG + Intronic
964424065 3:156533629-156533651 TAAAGTAGAATGAAGGGCAAGGG + Intronic
964718673 3:159749848-159749870 TATAGTATAATAAAGTGGAAAGG + Intronic
965190571 3:165522666-165522688 TAGGGGATAAAGAAGTGGAATGG + Intergenic
966200627 3:177357288-177357310 TATCATATAATGAAGGAGAAAGG - Intergenic
967175731 3:186862427-186862449 TATACTAAAAAGAAGAGGATTGG - Intergenic
967481977 3:189983004-189983026 TACCCTATAAAGGAGGGGAAGGG - Intronic
967738568 3:192980588-192980610 TAAAGTATAATGAAGGGAAAAGG + Intergenic
968679519 4:1907283-1907305 TATAGAAGAAACCAGGGGAATGG - Intronic
968841933 4:3013748-3013770 AAAAGAATAAAGAAGAGGAAAGG + Exonic
970379678 4:15494245-15494267 TGAAGTATAAAGAAGAGCAAGGG + Intronic
970635724 4:18007454-18007476 TGTAGCATAAAGGAGGGGAATGG - Intronic
970969743 4:21968146-21968168 TATAGCATAAGGAAGGGGTTTGG - Intergenic
971219623 4:24692890-24692912 TATAGTCTAATGAAGGAGACAGG + Intergenic
971521282 4:27554848-27554870 TATGATATAAAGAAAGGAAAAGG - Intergenic
972102477 4:35439314-35439336 TATAGGAAAGAGAGGGGGAAAGG - Intergenic
972927821 4:44033698-44033720 TATAATAGAAAAAAGAGGAAGGG + Intergenic
973655600 4:53044533-53044555 TAAAGTATATAGAAGGAGAAAGG - Intronic
974656369 4:64828265-64828287 TAAACTATAAAGAGGGAGAAAGG - Intergenic
974666318 4:64967330-64967352 TAAAGCAGAAAGAAGGGAAAAGG + Intergenic
976603169 4:86957943-86957965 TAAAGTATGAAGAAGTGAAATGG - Intronic
976695657 4:87917460-87917482 TATAGGAAAAAGAAGGGGTTGGG + Intergenic
977255020 4:94731139-94731161 TAGAGTATAAAGAAGGAGTATGG + Intergenic
978653757 4:111041399-111041421 TATCGAATAGAGAAAGGGAATGG - Intergenic
978993774 4:115123354-115123376 GACAGTAGAATGAAGGGGAAGGG + Intergenic
980332683 4:131429863-131429885 TAAAGTAAAGAGAAGGGGTAGGG - Intergenic
981160471 4:141492145-141492167 TTAAGTATACAGAAGAGGAACGG - Intergenic
982050346 4:151495199-151495221 TATAGAAAAAAGAATGGAAAGGG + Intronic
986099099 5:4589220-4589242 TATATAATTAAGAATGGGAAAGG + Intergenic
986890438 5:12298276-12298298 TATGGCATAAAGGAGGGCAATGG - Intergenic
986966605 5:13280159-13280181 AATAGGATAAAAAAGAGGAATGG + Intergenic
987683388 5:21165976-21165998 TATAGTATAAAGAACGAGGCCGG + Intergenic
989169351 5:38459435-38459457 TATTATATAAAGAAGAGCAAAGG - Intronic
989543789 5:42648576-42648598 GATATAATAAAGAAGGGGAGGGG - Intronic
990703357 5:58499314-58499336 TATAATATAAAAAAGAGGATTGG + Intergenic
992142918 5:73817562-73817584 GGTAGAATAAAGAAGGAGAAGGG + Intronic
992418337 5:76574953-76574975 TATAGTATAATGAAGGGGATGGG + Intronic
993165514 5:84349057-84349079 TATAGTAAAGAGAAGAGAAAAGG - Intronic
993830292 5:92748428-92748450 GAAAGTAGAAAGAAGGAGAAAGG - Intergenic
994394894 5:99219473-99219495 TCTAATATCCAGAAGGGGAAAGG - Intergenic
994714440 5:103304912-103304934 TATTATCAAAAGAAGGGGAATGG + Intergenic
995786356 5:115833859-115833881 TACATTATAAATGAGGGGAAGGG + Intronic
1000786806 5:165555057-165555079 TATAGTGTAAGGAAGGGGTCCGG - Intergenic
1000937688 5:167322498-167322520 TATAGAAGAAAGAAAGGAAAAGG - Intronic
1001920518 5:175596135-175596157 TATGGGAAAAAGAAGAGGAAAGG - Intergenic
1002392345 5:178925015-178925037 AATAGTATAAAGAGAGGGAAAGG - Intronic
1002543361 5:179921264-179921286 TAGGGTAGAAAGAAGGGCAAGGG - Intronic
1004542279 6:16562397-16562419 GAAAGAAGAAAGAAGGGGAATGG + Intronic
1004965389 6:20843810-20843832 TATAGGACAAATAAGGGAAAGGG + Intronic
1005008248 6:21311511-21311533 TATAGTATTTAGGATGGGAATGG + Intergenic
1005229261 6:23681348-23681370 TATATTTTATAGAAGAGGAAGGG - Intergenic
1006205583 6:32338843-32338865 TAGGGAATAAACAAGGGGAAAGG + Intronic
1006305290 6:33214970-33214992 TATACTATAAAGAATGGCAAAGG + Intergenic
1006821176 6:36896830-36896852 TATAGTATAAAGAAAGGGACAGG + Intronic
1007492345 6:42233214-42233236 TAAAGTATACAGAAGGGAAATGG - Intronic
1008262663 6:49386649-49386671 CATAGTATTAAAAAGGGCAAGGG + Intergenic
1009367394 6:62866173-62866195 TGTAATATCAAGAAGAGGAAAGG - Intergenic
1009754336 6:67916807-67916829 AATAGTAAAAAGAATTGGAAAGG - Intergenic
1010191654 6:73202371-73202393 TATAGAGTAAAAAAGAGGAAGGG - Intergenic
1011051024 6:83149761-83149783 AACAGGATAAAGAAGGAGAAGGG + Intronic
1011231228 6:85164549-85164571 TATAGCAGAATGAAGGGGGATGG - Intergenic
1011542935 6:88452145-88452167 AACACTATAAAGAAGGGCAAGGG - Intergenic
1011582227 6:88881822-88881844 TATAGTATAGAGTAGGGCAGTGG - Intronic
1011962163 6:93104239-93104261 TATAGTCTAAACAAGGAGAGAGG + Intergenic
1012000654 6:93650517-93650539 TAAAGTATAAGGAGGGGAAAAGG + Intergenic
1012087128 6:94842325-94842347 TATAGTATGAATACGGTGAAAGG + Intergenic
1013348449 6:109284705-109284727 TATATTGTAAAGAAGTGAAAAGG + Intergenic
1014562227 6:122905218-122905240 TAGAGGATAGAGAAAGGGAAGGG - Intergenic
1014911521 6:127099809-127099831 TATAGTGTTAAGAAGGGACAAGG + Intergenic
1015086929 6:129306030-129306052 TATAGTACAAAGGATAGGAAAGG - Intronic
1015238935 6:131002351-131002373 GAGAGAAGAAAGAAGGGGAATGG + Intronic
1015282295 6:131446776-131446798 CATAGTATAAAACAGGGAAAGGG - Intergenic
1015698735 6:136011204-136011226 TCTGCTATAAAGAAAGGGAAAGG - Intronic
1015778217 6:136836370-136836392 TAAGGTAGAAAGCAGGGGAAGGG + Intronic
1016238019 6:141891169-141891191 TATGGTGTAAAGAAGGGGTCTGG - Intergenic
1016664969 6:146628564-146628586 TATAGTATAATGCAGGGAAGAGG - Intronic
1020155120 7:5716975-5716997 TGTAGAATAAATAAGGGAAAAGG + Intronic
1020957395 7:14758830-14758852 TACAATATAAAGAAAGGAAATGG - Intronic
1021604628 7:22397533-22397555 TTTATTAGAAAGATGGGGAAAGG + Intergenic
1021691318 7:23233368-23233390 TAAAATATAAAGCAAGGGAAGGG - Intergenic
1022559566 7:31335141-31335163 TATAGTATAAAGAACATGGAAGG - Intergenic
1022825902 7:34013426-34013448 TATAGTACAGAGAAGGAGACTGG - Intronic
1023148339 7:37175064-37175086 TATAGAAAAAAGGAGTGGAAGGG + Intronic
1023526528 7:41109356-41109378 TATAGCATAAGGCAGGGAAAAGG - Intergenic
1023954674 7:44874853-44874875 TAAGGTATAAAGAAGGGAAAAGG - Intergenic
1024845063 7:53633440-53633462 TATAGGAGACAGAAGGGAAACGG + Intergenic
1028138769 7:87248821-87248843 TGCAGAATACAGAAGGGGAAAGG + Intergenic
1028192563 7:87869671-87869693 AATAGTATTCAGAAGTGGAAAGG - Intronic
1028358188 7:89935177-89935199 GATAGGAACAAGAAGGGGAACGG - Intergenic
1028474399 7:91237914-91237936 TAGAAAAGAAAGAAGGGGAAAGG - Intergenic
1028980737 7:96965266-96965288 AATAGAATACAGAGGGGGAAAGG - Intergenic
1029023899 7:97393934-97393956 TAAAATATAAAGAAAAGGAATGG - Intergenic
1029339492 7:99931562-99931584 GATAGTATTAAGAGGTGGAAAGG + Intergenic
1029855784 7:103515443-103515465 TATAGGAAAATGATGGGGAAGGG + Intronic
1030499748 7:110344642-110344664 TATATTTTAACGAAGGAGAAGGG - Intergenic
1030664245 7:112256752-112256774 TACAGTTTAAAGCTGGGGAATGG + Intronic
1031253679 7:119420436-119420458 TAAACTATGAAGAAGGGAAAAGG + Intergenic
1032103135 7:128999912-128999934 TATAGTATAAGAAATGAGAAAGG - Intronic
1034963806 7:155378921-155378943 TATAGCTTAAAGATGGGGAGAGG + Intergenic
1035585718 8:771809-771831 TATAGAATAAACAATGGAAAGGG + Intergenic
1035654276 8:1293704-1293726 TGTATTATAAAGAATGGGGAAGG - Intergenic
1037602607 8:20410485-20410507 GATAGTATAAAAAACGTGAATGG + Intergenic
1037627023 8:20617241-20617263 TAGAGTGTAAAGAAGAGGCATGG - Intergenic
1038190996 8:25320600-25320622 TATTCCATAAAGAGGGGGAAAGG - Intronic
1039038085 8:33381333-33381355 TAAAGTATAAAAATGGGGGAAGG - Intronic
1039174827 8:34791958-34791980 TAAAAAATAAAGATGGGGAAGGG + Intergenic
1039709494 8:40041631-40041653 TTTTGTCTAAAGATGGGGAAGGG + Intergenic
1040983863 8:53272105-53272127 TTTAATATAAAGCAGGGAAAAGG - Intergenic
1042579131 8:70257279-70257301 TACAGTATATTGAAGGAGAAAGG + Intronic
1042774981 8:72420168-72420190 TTTAGTGGAAAGAAGGGGAGTGG - Intergenic
1042951518 8:74205013-74205035 AATAGTATAAAGCAGGGTAGTGG - Intergenic
1044042015 8:87381804-87381826 TATAGGATTAAAAAGTGGAATGG + Intronic
1045155778 8:99468962-99468984 TATAGTATATAGTAGGGAGAAGG - Intronic
1045578655 8:103453885-103453907 TAAAGCATAAAGAAGTGGAGGGG - Intergenic
1045593923 8:103631297-103631319 TACAGTGTAAGGAAGGGGTAAGG + Intronic
1046042570 8:108923805-108923827 TAAAGTAAAAAGTTGGGGAAGGG + Intergenic
1046279519 8:112007331-112007353 TATGGTATAATGAAGGGGTCTGG + Intergenic
1046342051 8:112871477-112871499 TATATTATAAAAAAGGGAAATGG + Intronic
1046979696 8:120323594-120323616 TATGGTATAAGGAAGGGGTCCGG + Intronic
1047155825 8:122317013-122317035 TGGAGTATAAAGAAAGAGAAAGG + Intergenic
1047291767 8:123538063-123538085 TATATAAAATAGAAGGGGAATGG - Intronic
1048134325 8:131732764-131732786 CAAAGTATAAAGAAGGGGCCAGG + Intergenic
1048688125 8:136927317-136927339 TAAAGCATAAAGAAAGGCAAAGG - Intergenic
1050713225 9:8489712-8489734 GATAGGATAAAAAAGGGAAAAGG + Intronic
1051471115 9:17443521-17443543 AAAAGTATAAAGAAAGGTAAGGG + Intronic
1052460249 9:28753637-28753659 TATGGTGTCAAGAATGGGAAAGG + Intergenic
1052709001 9:32029922-32029944 TATACTATAAAAAGGGGAAAAGG - Intergenic
1054948764 9:70825446-70825468 TAGAGTACAAAGGAGGGGAGAGG - Intronic
1056142371 9:83695492-83695514 AAAAGTATAAAAAAGGGGACTGG - Intronic
1056889012 9:90471847-90471869 AAGAGTATAAAGAGTGGGAAGGG + Intergenic
1057986864 9:99725866-99725888 TATAGTATATATAAAGAGAATGG - Intergenic
1058024333 9:100124313-100124335 TATATCAAAAAGAAGGGTAAAGG - Intronic
1058581371 9:106461914-106461936 TTATGTATAAAGAAGGGGAGTGG - Intergenic
1059033777 9:110731342-110731364 TACAATATAAACAAGGGTAAGGG + Intronic
1059341430 9:113599683-113599705 TAGAATATAAAGAACTGGAAAGG - Intergenic
1060833512 9:126736133-126736155 AATAGCACAAAGAAGGGGAAGGG + Intergenic
1203653270 Un_KI270751v1:150079-150101 TATAGTGGAATGAAGAGGAATGG - Intergenic
1187567145 X:20462231-20462253 TATAGTATAAATAATGATAAAGG - Intergenic
1187721559 X:22156171-22156193 TATTGTCTTAAGAAGGGGTAGGG + Intronic
1187967386 X:24625755-24625777 TATAGTAAAAAGAGAGAGAAGGG + Intronic
1189000704 X:36941405-36941427 TATAGTATAATGTAGGGTTAAGG - Intergenic
1189512973 X:41682249-41682271 TAAAGCAAAAAGAAGGTGAAGGG + Intronic
1189524329 X:41803706-41803728 AATATTATAAAAATGGGGAAGGG + Intronic
1189963359 X:46346583-46346605 TAAACTAAAAAGAAGAGGAAGGG + Intergenic
1192926955 X:75764819-75764841 TATAGTGTAAAGAAGGAGTCCGG - Intergenic
1193844447 X:86451235-86451257 TATGGTATAAGGAAGGGGCCTGG + Intronic
1195279125 X:103312179-103312201 TATAGTATAAATAAAAGGCAAGG - Intergenic
1196658059 X:118240652-118240674 TGCAGTTTGAAGAAGGGGAATGG - Intergenic
1196679964 X:118460634-118460656 TCCAGTACAAAGAATGGGAAGGG - Intergenic
1196809562 X:119618447-119618469 TGAAGTATTGAGAAGGGGAAGGG - Exonic
1197823269 X:130563108-130563130 TATAGCAGAAAGGAAGGGAAGGG + Intergenic
1198457569 X:136832153-136832175 AATAGCATAAAGAAGGAGATAGG - Intergenic
1198531887 X:137555997-137556019 TCTAGAAGAAAGAAGGGGAGTGG - Intergenic
1198662679 X:138987296-138987318 AATACTATAAGGAAAGGGAAAGG - Intronic
1198731684 X:139737478-139737500 TATAATTAAAGGAAGGGGAAAGG + Intronic
1198890308 X:141387384-141387406 TGTAATATAAAGAAGAGGAAGGG - Intergenic
1199568940 X:149247556-149247578 TATAGTATCAAGAAAGTGAAGGG - Intergenic
1199724505 X:150567921-150567943 TACAGTAAAAAGAAAGGGACAGG - Intergenic
1200394969 X:155980018-155980040 TATAGTATACGGAAAAGGAATGG + Intergenic
1201102377 Y:10687774-10687796 TGTAGTGGAAAGGAGGGGAATGG - Intergenic
1201105310 Y:10759050-10759072 TGGAGTGTAAAGAAGTGGAATGG - Intergenic
1201128133 Y:10932358-10932380 TAGAGTGTAAAGGAGTGGAATGG - Intergenic
1201128378 Y:10934105-10934127 TGTAGTAGAAAGGAGTGGAATGG - Intergenic
1201352281 Y:13057030-13057052 TATGGTATAAAGAAGGGGACCGG + Intergenic
1201769399 Y:17604390-17604412 TATGGTGTAAAGAAGGGGTCTGG - Intergenic
1201832155 Y:18301595-18301617 TATGGTGTAAAGAAGGGGTCTGG + Intergenic