ID: 955249847

View in Genome Browser
Species Human (GRCh38)
Location 3:57269184-57269206
Sequence ATGGAGAAAAGGGCTGGAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 807
Summary {0: 1, 1: 0, 2: 6, 3: 75, 4: 725}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955249838_955249847 7 Left 955249838 3:57269154-57269176 CCTGATTTAGCAAAGATGAATTG 0: 1
1: 0
2: 2
3: 33
4: 278
Right 955249847 3:57269184-57269206 ATGGAGAAAAGGGCTGGAGAGGG 0: 1
1: 0
2: 6
3: 75
4: 725

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955249847 Original CRISPR ATGGAGAAAAGGGCTGGAGA GGG Exonic
900317712 1:2067675-2067697 ATGGAGAAACAAGCGGGAGAGGG - Intronic
900555795 1:3279749-3279771 ATGGGGAAAGGGGCAGGAGGCGG - Intronic
900982129 1:6051811-6051833 ATGTATAAAAGGGCTGGGCACGG + Intronic
900987771 1:6083115-6083137 AGGGCCAAAAGGGCTGCAGATGG - Intronic
901280523 1:8030574-8030596 ATGGAAAAATGGGCTGGGCATGG - Intergenic
901624118 1:10613942-10613964 ATAAAGACAAGGGCAGGAGATGG - Intronic
902069304 1:13720344-13720366 ATGGAGAGAAGGGCTGGGTAGGG + Intronic
902200643 1:14830967-14830989 AGGTAGAGAAGGGCTGGAGCTGG - Intronic
902713835 1:18258963-18258985 AGGGAAAAAAGGGCTGGACCTGG - Intronic
902764855 1:18607274-18607296 AGGGAGGGAAAGGCTGGAGAAGG + Intergenic
903021359 1:20397542-20397564 AAGGAGAAGGGGGCTGGAAATGG + Intergenic
903439283 1:23375323-23375345 ATGGAGATAAGGGTTGGTCAAGG + Intergenic
903548653 1:24142724-24142746 ATGGAGAATTGGCCTGGAGGAGG - Intronic
903565361 1:24261331-24261353 ATGGGGGAAAGGGCTAGAGAAGG - Intergenic
903861625 1:26368020-26368042 AGGGAGAACAGGGCTAGAGAGGG - Intronic
905045520 1:34997094-34997116 ATTGATAAAAGTGCTGCAGAGGG - Intronic
905160734 1:36031621-36031643 ATGGAAAAAAGTTCTGGAAATGG - Intronic
905484844 1:38288221-38288243 ATGGAGTAGAGTCCTGGAGAGGG + Intergenic
905572639 1:39017895-39017917 CTGGAGGAAAGGGCGGGAGGGGG - Intergenic
906220276 1:44072826-44072848 CTGGAGAGAAGAGCTGGAGAAGG + Intergenic
906348710 1:45038577-45038599 AGGGAGAAAAGGGCTGACGAGGG + Intronic
906399787 1:45496442-45496464 ATGAAGACAGGGGCAGGAGAGGG + Exonic
906514331 1:46429920-46429942 GTGCAGTAAAGGGCTTGAGAGGG + Intergenic
906562023 1:46765314-46765336 ATGGAGAGAAGGAATGAAGAGGG - Intronic
906662782 1:47594300-47594322 ATGGAGTATTGGGCTGTAGAGGG - Intergenic
906667848 1:47634116-47634138 ATGGAGTAAAGGGCAGGGAAAGG - Intergenic
906714258 1:47955291-47955313 AAGGAGAAAGGGACTGGGGAAGG - Intronic
906728015 1:48058147-48058169 AGGGAGAAACAGGCAGGAGAGGG + Intergenic
906781770 1:48579149-48579171 TTGGAGAAAAGGGTTGGAGAGGG - Intronic
906929641 1:50156451-50156473 ATGGATAAAGGGGGAGGAGAGGG + Intronic
907319827 1:53595197-53595219 AGGAAGAGAAGGGCTGGGGAGGG + Intronic
907336732 1:53704567-53704589 AGGGAGAGAAGGGGTGGGGAGGG + Intronic
907484027 1:54764545-54764567 TTGGCGAAAAGGGCAGGAGGCGG - Intergenic
907588822 1:55646248-55646270 ATGGAGAAGAGGGGTGGTGTTGG - Intergenic
907620489 1:55972993-55973015 AGTGAGAAAAAGGCTGGAGAGGG + Intergenic
907724650 1:57007888-57007910 ATGGGGGAATGGGATGGAGATGG + Intronic
907903522 1:58763260-58763282 GTAGAGACAAGGGCTGAAGAAGG + Intergenic
908429025 1:64037910-64037932 ATGGAGAGCAAGGCTGCAGAGGG - Intronic
908561341 1:65309667-65309689 AAGGTGGAAAGGGCTGAAGAAGG - Exonic
909088567 1:71197071-71197093 ATGGATAAAAAAGCTGCAGATGG - Intergenic
909394224 1:75151459-75151481 CTGGAGATAAGGCCAGGAGATGG + Intronic
909724412 1:78816775-78816797 ATGGAGAAGAGGGAGAGAGAAGG - Intergenic
910336606 1:86139171-86139193 AAGGAGAAAGGGGGGGGAGAGGG + Intronic
910500663 1:87886533-87886555 ATAGAAAAGTGGGCTGGAGAAGG + Intergenic
910728963 1:90370109-90370131 ATGGAGAAAAGGGGATGAGAAGG - Intergenic
910929518 1:92429040-92429062 ATGTTGAAAAGTTCTGGAGATGG + Intergenic
911036571 1:93556408-93556430 ATGGAGAAAAGGGAGAAAGACGG - Intergenic
911151121 1:94597629-94597651 GTGGAGAAAGGGGCTGGAAGAGG + Intergenic
911154396 1:94624260-94624282 GTTGAGAAAAGAGCAGGAGATGG + Intergenic
913705174 1:121413843-121413865 AAGGAGAAGAGGACTGTAGAAGG + Intergenic
915444297 1:155966200-155966222 ATGGGGATGAGGGCTGGGGATGG - Intronic
915914980 1:159935456-159935478 AGGGAGCAAAGGCATGGAGATGG - Intronic
917327518 1:173848141-173848163 ATGAAGAAAAGGGCCGGGCACGG - Intronic
917412384 1:174772672-174772694 ATGAAAAAAAGATCTGGAGATGG - Intronic
917660604 1:177173540-177173562 GAGGAGAAAAGGGCTGGGGAAGG + Intronic
918144261 1:181741991-181742013 AAAGAGAAAATGGATGGAGAAGG - Intronic
919941350 1:202288707-202288729 TTGGAGAAATGGCCTGGATATGG + Intronic
919988919 1:202695391-202695413 CTAGAAACAAGGGCTGGAGATGG - Intronic
921934282 1:220782120-220782142 ATGGGAAATAGGGGTGGAGAAGG - Intronic
922367911 1:224883179-224883201 AGACAGAAAAGGGCTGAAGAAGG + Intergenic
922470137 1:225871633-225871655 CTGGGAAACAGGGCTGGAGAGGG + Intronic
922824815 1:228510431-228510453 AGGGAGGAGGGGGCTGGAGATGG + Intergenic
923163151 1:231335659-231335681 GTGGAGAAAAGGTTTGAAGAAGG - Exonic
923238464 1:232057659-232057681 CTGGGGAAAGAGGCTGGAGAAGG + Intergenic
923421350 1:233818520-233818542 ATGGAGAAAAGTGTGTGAGAAGG + Intergenic
923524066 1:234758871-234758893 ATGGAGCAGAGAGCTGGAAAGGG - Intergenic
924046939 1:240041535-240041557 AGGGAGAAATGGGCTTAAGAAGG - Intronic
924054548 1:240112562-240112584 ATAAAGATAAGGGCAGGAGACGG - Intronic
924217572 1:241839849-241839871 CTGGAAAACAGGGCTGGGGAAGG - Intergenic
924263034 1:242251618-242251640 ATGGAGAAAAGGGCAGGCATTGG + Intronic
924479914 1:244420404-244420426 AAGTAGAAAAGGGCTGGTGACGG + Intronic
924946955 1:248853010-248853032 AGGGAGAAATGGGCTTGGGAAGG - Intronic
1063659277 10:8022465-8022487 ATGGAGAAAAGGCCAGGGGTAGG + Intergenic
1063802712 10:9598785-9598807 ATGGAGAAATGGACAGGTGAAGG - Intergenic
1063944600 10:11164786-11164808 CTGGAGAAAAAGGCCGGAGCTGG - Intronic
1064304571 10:14153689-14153711 ATGCAGAGCAGAGCTGGAGACGG - Intronic
1064624417 10:17247695-17247717 GTGGAGAAAGGGCCTGGAAAAGG - Intergenic
1064721554 10:18234765-18234787 ATGCTGAAAAGTCCTGGAGATGG + Intronic
1064779284 10:18816686-18816708 ATGTAGAAAGTGGCTGGAGATGG + Intergenic
1064973857 10:21093357-21093379 AAAAAGAAATGGGCTGGAGAAGG + Intronic
1065236867 10:23660769-23660791 ATTGAGAATGGTGCTGGAGAGGG + Intergenic
1065276555 10:24092070-24092092 ATGGAGATAAGGGAAAGAGAAGG - Intronic
1065370519 10:24980330-24980352 AAGAAGAAAAGGGTTGCAGAGGG - Intergenic
1066317016 10:34258260-34258282 GTGGAGAACAAGACTGGAGATGG + Intronic
1066721751 10:38346831-38346853 ATGGAGAAAAGGGCAGGAATTGG - Intergenic
1067196395 10:44123242-44123264 CTGGAGAAAAAGCCTGGAGAGGG + Intergenic
1067461372 10:46460898-46460920 ATAGAGAAAAGGGATGGAGTAGG + Intergenic
1067560977 10:47304209-47304231 AAGGAGAGAAAGGCAGGAGATGG + Intronic
1067625822 10:47923703-47923725 ATAGAGAAAAGGGATGGAGTAGG - Intergenic
1068605234 10:58998194-58998216 AGGGAGAAAAGGGGCAGAGACGG - Intergenic
1068610912 10:59058971-59058993 AAGGAGAAATTGCCTGGAGAAGG - Intergenic
1069597505 10:69681914-69681936 CAGGTGAAAAGGCCTGGAGATGG + Intergenic
1069704284 10:70448059-70448081 CTGGACAACAGGGCTGGAGATGG - Intergenic
1069850545 10:71401455-71401477 CTTAAGAATAGGGCTGGAGAAGG - Intronic
1069921403 10:71817939-71817961 CTGGAGGAAAGAGCTGGACATGG + Intronic
1069977982 10:72231121-72231143 ATGGAGAAATGGTCTGGAGGGGG - Intronic
1069979354 10:72241551-72241573 ATTGAGACAAGGGATGGAGAAGG + Intergenic
1070070409 10:73083601-73083623 AAAGAGAAAAGGGGTGGAGGAGG - Intronic
1070676689 10:78416646-78416668 ATGGAAGAAAGGAATGGAGAAGG - Intergenic
1070922153 10:80194755-80194777 AGGGAGGAAAGGGCTGCAAAAGG + Intronic
1071570972 10:86696775-86696797 TTGGGGTAAAGGGGTGGAGATGG - Intronic
1072930277 10:99656435-99656457 ATGGAGAATATGGATGGAGGAGG + Intergenic
1073179794 10:101576877-101576899 ATGAAGAACTGGGCTGGAGCAGG + Intronic
1073293158 10:102423306-102423328 ATGGAGCAAAGGAGTAGAGAAGG + Exonic
1073394342 10:103205922-103205944 ATGGAGCAAAGAGCAGGACAGGG - Intergenic
1073528356 10:104207258-104207280 CTGGAGAAAAGGGTTGGGGTGGG + Intronic
1073677576 10:105665713-105665735 GTGGAGAGAAGGGCAGGAGCTGG + Intergenic
1073709650 10:106022141-106022163 ATAGAGAAAAGGGGTGGGGGTGG + Intergenic
1073961996 10:108942647-108942669 ATTGAGAAAGAGGCTGAAGACGG - Intergenic
1074181522 10:111069212-111069234 AAAGAGAAAAGAGCTGGAGAAGG - Intergenic
1074263872 10:111881738-111881760 ATAGAGAAGTGGGCTGGGGACGG + Intergenic
1074874269 10:117602179-117602201 ATGGAGAAAAGGGAAGGGGGTGG + Intergenic
1075683915 10:124350870-124350892 ATGGAGAAGGGAGCTGGAGGAGG - Intergenic
1076114607 10:127886584-127886606 AGAGAGAAAAGGGCAGGAGGAGG + Intronic
1076309696 10:129496533-129496555 ATGGAAATAATGGCTAGAGACGG - Intronic
1076789655 10:132770063-132770085 ATGTAGAACAGGGCTGGCGAGGG + Intronic
1077652316 11:3984154-3984176 AAGGAGAAAGAGGCTGGACACGG - Intronic
1077954378 11:6999089-6999111 ATGGACAAAAGTGCTAGAAATGG - Intergenic
1078421070 11:11213444-11213466 CTGGAGTAAAGGCATGGAGAGGG - Intergenic
1078585057 11:12577999-12578021 GAGGAGAAGAGAGCTGGAGAAGG - Intergenic
1079014561 11:16857519-16857541 CTGGAGAAAGGGGATGGACAAGG - Intronic
1079924749 11:26480080-26480102 TGGGAGAAATGGGCTGTAGAAGG + Intronic
1080774393 11:35372127-35372149 AAGTAGAGAAGGGATGGAGAGGG + Intronic
1081109869 11:39121475-39121497 GTGGAGAGGAGAGCTGGAGAAGG + Intergenic
1081230774 11:40583351-40583373 GTTGAGAAATGGGCTGCAGAAGG + Intronic
1081779322 11:45699079-45699101 CTGGAGAAGTGAGCTGGAGAAGG - Intergenic
1082697125 11:56382033-56382055 ATAGAGTAAAGGGTTGCAGATGG - Intergenic
1082697978 11:56394098-56394120 ATAGAGTAAAGGGTTGCAGATGG - Intergenic
1083014922 11:59443551-59443573 GTAGAGAAGGGGGCTGGAGATGG - Exonic
1083059672 11:59856712-59856734 GTGGAAAAACAGGCTGGAGAAGG + Intronic
1083206446 11:61152491-61152513 GTGTAGAAGAGGGCTGGAGAGGG - Intronic
1085050079 11:73375914-73375936 TTGGCGAAAAGGCCTGGTGAAGG - Intergenic
1085448033 11:76614475-76614497 GAGGAGAATAGGGCAGGAGAAGG - Intergenic
1085693649 11:78686021-78686043 TTGGAGAGGAGGGCAGGAGAAGG - Intronic
1085705678 11:78785139-78785161 ATGCAGAAAAGGGAAGGTGAGGG + Intronic
1086109806 11:83187589-83187611 GTGGAGAAATGGGTTGAAGATGG + Intergenic
1086361999 11:86069154-86069176 AAGGGGAAAGGGGCGGGAGAAGG - Intronic
1086493414 11:87378054-87378076 ATGGAGAGGAGAGCTGGAGAGGG + Intergenic
1086902588 11:92384508-92384530 ATGGGGCAAAGGGCTGGGGGAGG - Intronic
1086975279 11:93125173-93125195 GTGGTGAAAAGTTCTGGAGATGG - Intergenic
1087261473 11:96017369-96017391 AGGGAGAAAAGAGGTGGGGAGGG - Intronic
1087772113 11:102222160-102222182 GTGGAGGTGAGGGCTGGAGATGG + Intronic
1088113381 11:106287767-106287789 ATGCAGAAAAGGTCTTCAGAAGG - Intergenic
1088423611 11:109675832-109675854 ATGGAGAAGAAGTCTGGGGAGGG + Intergenic
1088668204 11:112115801-112115823 AGGGAGAAAGGGGCTGGGGATGG + Intronic
1088688279 11:112303516-112303538 AAGGAGAAAAGGAGAGGAGAGGG + Intergenic
1088741821 11:112773814-112773836 AAGGAGAAAAGGGGTCCAGAAGG + Intergenic
1089076879 11:115745506-115745528 AGGGAGAAAGGCACTGGAGAGGG - Intergenic
1089098100 11:115936573-115936595 GTGGGGAAAATGTCTGGAGAAGG + Intergenic
1089242709 11:117096631-117096653 ACGGACAAAAAGGCTGAAGAGGG + Intronic
1089726011 11:120480949-120480971 AGGGAGACAATGGCAGGAGATGG + Intronic
1089833992 11:121353857-121353879 ATGAAGAATTGGGCTTGAGAAGG - Intergenic
1089855614 11:121541789-121541811 AAGGAGAAGAGGGACGGAGAGGG - Intronic
1089982060 11:122780698-122780720 ATGGAGGAAAGGCCTGCAGGCGG + Intronic
1089982115 11:122780991-122781013 ATGGAACAAAGGGCCTGAGATGG - Intronic
1090042697 11:123304556-123304578 ATGGAGGAGAAGGATGGAGAGGG + Intergenic
1090057513 11:123436271-123436293 CTGGGGAAATGGGATGGAGAGGG - Intergenic
1090097412 11:123756587-123756609 ATGGAGGAAGGGGCTGCAGGTGG + Intergenic
1090401433 11:126452021-126452043 ATGGAGGGAAGGGCAGGAGACGG - Intronic
1090666100 11:128916061-128916083 ATGGAAAAAAAGGCAGGAAAGGG - Intronic
1090666118 11:128916157-128916179 ATGGAAAAAAAGGCAGGAAAGGG - Intronic
1091207206 11:133830016-133830038 TTGGAGAAAAGGGGTGCAGCAGG + Intergenic
1091338407 11:134791794-134791816 AGGGAGAAATGGGCTGCAAAGGG + Intergenic
1091448936 12:560857-560879 ATGCACAAAAGGCCTGGGGAGGG + Intronic
1092275224 12:7055714-7055736 ATGGGGACAAGGTCAGGAGATGG + Intronic
1092279449 12:7088780-7088802 ATGGGGAAAAGGGGGGAAGAAGG - Intronic
1092672610 12:10881179-10881201 AAGGAGAAGGGGGCTGTAGAAGG - Intronic
1092974215 12:13728563-13728585 ATGGAGAAAAAGGCCAAAGAGGG + Intronic
1093175433 12:15908325-15908347 ATGGAGAAAAGTGTAGGAGCAGG - Intergenic
1093423278 12:18999266-18999288 ATGTTGCAAAGGGCTGGAGCTGG - Intergenic
1093617064 12:21238570-21238592 ATGGTGTAAGGTGCTGGAGAAGG + Intronic
1093657749 12:21716575-21716597 ATGGAAAAGATGTCTGGAGAAGG + Intronic
1093703838 12:22253392-22253414 GTGGGGAAAATGGCTTGAGATGG - Intronic
1093865797 12:24226220-24226242 ATGAATAAAAGGGATGGGGATGG - Intergenic
1094532916 12:31294408-31294430 ATGGGTAAGAGGGGTGGAGAGGG + Intronic
1095222768 12:39637090-39637112 AAGGAGAGAAGGGAGGGAGAAGG - Intronic
1095425878 12:42074315-42074337 ATGAAGAAAATGGCTTTAGATGG + Intergenic
1095508154 12:42920512-42920534 ATGGAGCTAGGGGCAGGAGATGG + Intergenic
1095791962 12:46177230-46177252 ATGGAAAACAGGGCTGGGGCTGG + Intergenic
1096334414 12:50742518-50742540 ATGGGGAAAAGTGGTGAAGAAGG - Intronic
1096613119 12:52816071-52816093 AGGGAGGAAGTGGCTGGAGAAGG - Intergenic
1096689156 12:53308824-53308846 AGGGAGCAAAAGGCAGGAGAAGG + Intronic
1096803336 12:54126145-54126167 ATGGCGAAAAGGGAGGGTGAAGG - Intergenic
1097276100 12:57814529-57814551 ATCCAGCAAAGGGCTGGAGGTGG - Intronic
1097282177 12:57851924-57851946 GTGGGGGAAAGTGCTGGAGATGG - Intergenic
1098059154 12:66541415-66541437 ATGGGGAAAAGTGCCAGAGAGGG - Intronic
1098280078 12:68853799-68853821 AGGGAGAGAAGGGGAGGAGAGGG + Exonic
1098488373 12:71047447-71047469 GTGGAGAGGAGAGCTGGAGAGGG + Exonic
1099068302 12:78012240-78012262 TAGGAGACAAGGGCTGGAAATGG - Intronic
1099189268 12:79546075-79546097 ATGGAGACAAAAGGTGGAGAAGG + Intergenic
1099329290 12:81262047-81262069 ATGGAGAAAAGGGCTTTAGAGGG + Intronic
1101562423 12:105870290-105870312 ATGGACAAAGAGGTTGGAGAAGG - Intergenic
1101761585 12:107663105-107663127 ATGGAGAAGAGGCCTGGCCAAGG - Intergenic
1101918454 12:108913939-108913961 ATGAAGAAATGGGCTGGGCATGG - Intronic
1102007395 12:109597305-109597327 ATGGAGGAAACAGCTGGAGAGGG - Exonic
1102477324 12:113196934-113196956 ATGCAGAAACGGGCTTGGGAAGG + Intronic
1102478247 12:113202649-113202671 AAGGAGGAAAGGGGAGGAGAGGG - Intronic
1102500309 12:113347568-113347590 AAGGAGAAAGGGGCTGGTCATGG + Intronic
1103293678 12:119867887-119867909 ATGGAGGAAGGGGCTGAGGAAGG - Intronic
1103793818 12:123490031-123490053 AAGGAGAAAGGGGATGGAAAAGG - Intronic
1104002105 12:124866320-124866342 ATGGGGGAGAGGGCAGGAGATGG - Intronic
1104165083 12:126219949-126219971 ATGGAGACAGGAGCTGGAGTGGG + Intergenic
1104491480 12:129197341-129197363 AGATAGAAAAGGGCTGGAAATGG + Intronic
1104994560 12:132645347-132645369 CTGGAGAGGAGAGCTGGAGAGGG + Intronic
1105356612 13:19664914-19664936 AAGGAGAAAAGGGCCATAGATGG + Intronic
1106319914 13:28627556-28627578 GTGGAGTACATGGCTGGAGAAGG - Intergenic
1106506757 13:30377149-30377171 ATGATGTCAAGGGCTGGAGAGGG - Intergenic
1106588880 13:31081159-31081181 ATGGGGAGGAGGGATGGAGAAGG + Intergenic
1106806423 13:33312429-33312451 CCGGAGAAAAGGGGTGGAGCAGG - Intronic
1106986193 13:35354234-35354256 AGGGAGACAAGGTCTGTAGATGG - Intronic
1107258931 13:38467578-38467600 CTGAAGAAACGTGCTGGAGAAGG - Intergenic
1107666794 13:42699204-42699226 AAGGGGAAAATGGCTTGAGATGG - Intergenic
1107885430 13:44871096-44871118 ATGGAGAATAGGGGCGCAGAAGG - Intergenic
1108419893 13:50237945-50237967 ATGTAGAAAGGGGATGGGGAAGG + Intronic
1108950247 13:56083649-56083671 CAGGAGAGAAGGGCAGGAGAAGG - Intergenic
1109256854 13:60093881-60093903 AGAGAGAAAAGAGGTGGAGAGGG + Intronic
1109273903 13:60283356-60283378 TAGGAGAAAAAGGCTGAAGAAGG - Intergenic
1109335023 13:60982636-60982658 ATGGTGCCTAGGGCTGGAGAGGG + Intergenic
1109822715 13:67679561-67679583 AAGCAGAAAAGGACTGGGGAGGG - Intergenic
1110113744 13:71784643-71784665 ATAAAGAAAAGGGTAGGAGAGGG - Intronic
1110228237 13:73142175-73142197 AGGGATTTAAGGGCTGGAGATGG + Intergenic
1110268643 13:73568371-73568393 ATGGAGAGAAGAGATGAAGAAGG - Intergenic
1110301240 13:73929813-73929835 ATGCATAAAAGGGATGCAGAAGG - Intronic
1111683875 13:91477637-91477659 GTTGGGAAAAGGGCTGCAGATGG + Intronic
1113136656 13:107097975-107097997 ATGAAGCAAAGAGCTGGAAAAGG - Intergenic
1114499137 14:23155132-23155154 GAGATGAAAAGGGCTGGAGAAGG - Intronic
1114849734 14:26369478-26369500 GAGGAGAAAAGAGTTGGAGATGG + Intergenic
1115864471 14:37728902-37728924 AGGGAGAAGAGAACTGGAGAAGG - Intronic
1116347566 14:43814410-43814432 ATGGATAAGAGGGTTGTAGAAGG + Intergenic
1117702167 14:58425084-58425106 ATAAAGAAAAGGGGTTGAGAGGG + Intronic
1119509228 14:75198080-75198102 GAGGAGAAAAGGGCTGGAAGAGG + Intergenic
1119635900 14:76273246-76273268 ATGATGCAAAGAGCTGGAGAGGG + Intergenic
1120072583 14:80120723-80120745 ATGGAGAAGTGGGCTCCAGAAGG - Intergenic
1120625968 14:86827036-86827058 AGGCAGAAGAGGGCAGGAGAGGG + Intergenic
1120965293 14:90161886-90161908 AAGGAGAACAGGGCTGGACGTGG + Intronic
1122011324 14:98751370-98751392 GTGCAGAAAAGGCCTGGAGAAGG + Intergenic
1122542258 14:102505096-102505118 ATAGAGAACAGAGCTGGAGCTGG + Exonic
1202855931 14_GL000225v1_random:52379-52401 AGGGAGAAACCGGCTAGAGAGGG - Intergenic
1124042153 15:26115641-26115663 ATGGAGAAAAGTGCTGGGAAAGG - Intergenic
1124432713 15:29620820-29620842 GTGGGGAAAAGGGCAGGAAATGG + Intergenic
1125680647 15:41528150-41528172 AGAGTGAAAAGGGCAGGAGATGG + Intronic
1125736792 15:41932716-41932738 GTGCAGACAAGGGCTGGAGGTGG - Intronic
1126208577 15:46074267-46074289 GTGGATACCAGGGCTGGAGAGGG + Intergenic
1126911440 15:53421332-53421354 ATGGAGAAAAGTGGAGAAGATGG - Intergenic
1127152244 15:56087993-56088015 ATGGAGAGAAGGGAGGGAAAAGG + Exonic
1127205658 15:56715358-56715380 ATTGGGAATAGGGCAGGAGAGGG - Intronic
1127421919 15:58814659-58814681 ATGGGGAAAAGGGCTGGACATGG - Intronic
1127803710 15:62499458-62499480 ATAGAGAAATGGCCTGGATATGG + Intronic
1127936442 15:63644140-63644162 ATGGGGAGAAAGGGTGGAGAGGG - Intronic
1128320498 15:66690450-66690472 GTGGAGAAAGGGGGTGGAAATGG - Intergenic
1128870406 15:71151054-71151076 ATGGAGAAAAGGGCTGGGCTGGG + Intronic
1129005733 15:72371888-72371910 CAGAATAAAAGGGCTGGAGAAGG + Intronic
1129088643 15:73124499-73124521 AGGGAGAAAAGAGTAGGAGATGG - Intronic
1129972691 15:79793915-79793937 TTGGAGAAAAGGGATGGATTTGG - Intergenic
1130567394 15:85008417-85008439 ATGGAGGAAGGGTCTGGTGAGGG - Intronic
1130983664 15:88830286-88830308 ATAAAGAAACGGGCTGGGGAAGG - Intronic
1130991235 15:88877274-88877296 ACACAGAAAAGGGCTGGGGATGG + Exonic
1131076573 15:89499112-89499134 AGGGAGACAAGGGCTGGGGTGGG + Intergenic
1131233995 15:90680877-90680899 AGGCAGACACGGGCTGGAGAAGG + Intergenic
1131392326 15:92059455-92059477 CTGGGGAAAAGTGCTGGACAAGG - Intronic
1131439526 15:92448402-92448424 GTGGAGGAATGGGCTGGGGAGGG + Intronic
1133477748 16:6139785-6139807 ATGGGGAACAGGACAGGAGAAGG - Intronic
1133732203 16:8587606-8587628 GCGGAGAATGGGGCTGGAGAGGG + Intronic
1134955722 16:18381410-18381432 ATGGAGAAAAGGGAGGGATGAGG + Intergenic
1135083428 16:19455535-19455557 GTAGAGAAAAAGGCTGCAGAAGG - Intronic
1135132101 16:19861657-19861679 GTGGAGAAAAGGGGTAGAAAGGG + Intronic
1135568172 16:23528064-23528086 ATGCAGCGAAGGGCTGGAAAAGG + Intronic
1135711995 16:24725536-24725558 ATGGAGAGAGGAGCTGGGGAGGG - Intergenic
1136292031 16:29279872-29279894 ATGGACAAAAGGGCTGGGCGCGG - Intergenic
1138090178 16:54167545-54167567 GTGGAGAGAAGGGTTGGAGAGGG + Intergenic
1138110084 16:54316777-54316799 ATGGAGAGAGGTGCTGGGGATGG - Intergenic
1138448648 16:57079844-57079866 ATGGGGAAAAAGGCAGAAGAAGG - Intronic
1139062302 16:63267215-63267237 ATGGGGAAAAGGGGTTGGGAGGG - Intergenic
1139687399 16:68615135-68615157 ATGGAAAGAAGGGCTGGCCATGG + Intergenic
1140077644 16:71716611-71716633 ATGGAGTAAAGGGCAGTAGTAGG - Intronic
1140683638 16:77411612-77411634 ATGGTGAAAAGGCCTTGTGATGG + Intronic
1140808396 16:78554140-78554162 ATGCAGAAAAGTGCTGAAGGTGG + Intronic
1142097922 16:88253827-88253849 ATGGACAAAAGGGCTGGGCGCGG - Intergenic
1142495823 17:305820-305842 AGGAAGAAAGGGGCTGGGGAGGG - Intronic
1143254728 17:5547469-5547491 ATAAAGAAATGGGCTGGGGAAGG - Intronic
1143637481 17:8174433-8174455 ATGGAGGAAAGGGCTGGGTAGGG + Intronic
1143850763 17:9810016-9810038 ATGGAGAAAAGGGACAGAAAAGG + Intronic
1143900336 17:10169699-10169721 ATGGAGAAGAGGTCTGGGGATGG - Intronic
1144111934 17:12043879-12043901 AAGGTGAAAAGGACTAGAGACGG - Intronic
1144325704 17:14177784-14177806 CTGGAGAAAAGTGCTCCAGAGGG + Intronic
1144461844 17:15464622-15464644 ATTTGGAAAAGTGCTGGAGAGGG - Intronic
1144474578 17:15574672-15574694 CTGGAGAAAAGTGCTCCAGAGGG + Intronic
1144552734 17:16255734-16255756 TTGGAGAAAAGGACTGCAGGAGG - Intronic
1145296398 17:21595971-21595993 AGGGAGAAAAGGGGAGGAGAGGG + Intergenic
1145367387 17:22276095-22276117 AGGGAGAAAAGGGGAGGAGAGGG - Intergenic
1145753883 17:27375923-27375945 TTGGACAAAAGGGATGGAGCTGG - Intergenic
1146409573 17:32570997-32571019 ATGAGGAAAAGTGCTGGAGGGGG + Intronic
1146480379 17:33200499-33200521 ATGAAGAGAAGGACTGGAGAAGG - Intronic
1147985335 17:44303772-44303794 AGAGAGAAACGGGCTGGGGACGG - Intergenic
1148338279 17:46856285-46856307 ATGAATGAAAGGGCTGGATAGGG + Intronic
1148781032 17:50122099-50122121 ATGGAGCATAGGGATGGAGGTGG - Intronic
1149020991 17:51964047-51964069 TTAAAGTAAAGGGCTGGAGAAGG + Intronic
1149480043 17:56996022-56996044 AGGGAGAACAGAGCTGCAGAGGG - Intronic
1149621437 17:58048213-58048235 AGAGAGCAAAGGCCTGGAGAAGG + Intergenic
1149965360 17:61157502-61157524 AGGGAGAAAAGAGCCGGAGAGGG - Intronic
1151069667 17:71194392-71194414 ATAGAGAAAAGTGATGGAGGGGG + Intergenic
1151356022 17:73559056-73559078 AGAGAGAAAAGGGGAGGAGATGG - Intronic
1151748117 17:76022358-76022380 CTGGAGAAACGGGCTGGGGCTGG + Intronic
1152021381 17:77781691-77781713 AGGGAGAGAAGGAGTGGAGAGGG - Intergenic
1152256403 17:79242577-79242599 AGGGAGCATAGGGCAGGAGAGGG + Intronic
1152442573 17:80317968-80317990 ATGGAGAGGGGAGCTGGAGAGGG + Intronic
1152499767 17:80700063-80700085 ATGGAGAAAAGGTAGGAAGAAGG + Intronic
1152732417 17:81978764-81978786 ATGGAGAAGAGGGGCGGAGGCGG + Intronic
1153021889 18:636915-636937 AAGGAGAAAGGGGCTGGGCATGG - Intronic
1153174035 18:2350837-2350859 CTGGAGACTAGCGCTGGAGAGGG + Intergenic
1153348753 18:4056138-4056160 ATGGGGAAGGGGGCAGGAGAAGG + Intronic
1153378061 18:4403918-4403940 GTGGGAAAAAGGGCTGCAGAAGG - Intronic
1153651240 18:7242126-7242148 AGGGAGAATAGGGCTGGAGGGGG + Intergenic
1154052539 18:10974691-10974713 ATGAAGAAACGGGCTCTAGAGGG - Intronic
1154073141 18:11173509-11173531 ATAGAGAAAAAGGCTGGGCACGG + Intergenic
1154138253 18:11799955-11799977 ATAGGGAAAAGGAATGGAGAGGG - Intronic
1155218171 18:23661812-23661834 TTGGAGAAGAGGGTTGGAGCTGG - Intronic
1155219488 18:23671422-23671444 AAGTAGAATGGGGCTGGAGAAGG + Intergenic
1155355927 18:24954140-24954162 ATCTAGATAAGGGCTGGGGAAGG + Intergenic
1155519692 18:26656450-26656472 AGGGGGAGGAGGGCTGGAGATGG + Intronic
1155616876 18:27732042-27732064 AGACAGAAAAGGGCTGAAGAAGG + Intergenic
1156281240 18:35641152-35641174 ATTGGGAAAAGGGCTTGGGATGG + Intronic
1156546108 18:37965210-37965232 AGAGAGAAAAGGGATGGAAAGGG - Intergenic
1156913494 18:42438823-42438845 ATGGTGATGAGGGCTGGGGAGGG - Intergenic
1157618759 18:49003306-49003328 ATGGAGAGAAGGGAAGGAGGAGG - Intergenic
1157632637 18:49114028-49114050 AGGGAGAGCAGGGCTAGAGAAGG - Intronic
1157660539 18:49438453-49438475 AAGTAGAAAACAGCTGGAGATGG + Intronic
1157974571 18:52312447-52312469 TTGTAGCAAAGGGCTGCAGAAGG + Intergenic
1158258817 18:55586382-55586404 AGGAAGCAAAGGGATGGAGAAGG + Intronic
1158348599 18:56541073-56541095 ATGGAGCAAAGGGTTAGATAAGG - Intergenic
1158488976 18:57893178-57893200 AAGGAGCAAGGGGCTGGAGATGG + Intergenic
1158793634 18:60813961-60813983 AAGGGGAAAAGTTCTGGAGATGG - Intergenic
1159409790 18:68056634-68056656 GTGGAAAGAAGGGCAGGAGATGG - Intergenic
1160198903 18:76779897-76779919 ATGGAGGAAGGGGCTGCAGGCGG + Intergenic
1160200969 18:76795161-76795183 AAGGACCACAGGGCTGGAGAAGG + Exonic
1160305704 18:77733746-77733768 TTGGAGACAAGGGCTGGAGAGGG + Intergenic
1160676883 19:395700-395722 ATGGAGAAGGGTGATGGAGAAGG + Intergenic
1160972231 19:1774726-1774748 ATGGAGAAGGGGGCTGGAGGGGG + Intronic
1163174857 19:15557128-15557150 ATGGAGAAGAGGGATGGGGAAGG - Intergenic
1163322486 19:16582801-16582823 AAGCAGAAAAGAGCTGGAGAAGG + Intronic
1163359640 19:16837606-16837628 ATGGTAACAAGGACTGGAGAGGG + Intronic
1163543562 19:17926879-17926901 GAGGAGAAAAGGGATGGAGAAGG + Intergenic
1163885668 19:19962586-19962608 ATGGAAAACAGGGCTGCACATGG - Intergenic
1164561291 19:29293956-29293978 AGGGAAAAGAGGGCAGGAGAGGG + Intergenic
1164937202 19:32224052-32224074 CTTTAGAAAAGGGCAGGAGATGG - Intergenic
1165317805 19:35067197-35067219 ATGGAGAAAGGGGTTGGGGGAGG - Intergenic
1165762413 19:38329446-38329468 AAGTAGAAAAGGCATGGAGAGGG + Intergenic
1165844993 19:38812520-38812542 CTGGAGAAGAGGCCTGGTGAGGG + Intronic
1165887080 19:39085763-39085785 GAGGAGAAGAGGGATGGAGAAGG - Intronic
1166258123 19:41620177-41620199 CAGTAGAAAAGGGCTGGGGAGGG + Intronic
1166546048 19:43635471-43635493 AGGGAGGAAGGGGCTGGAGGCGG - Intronic
1167424010 19:49420417-49420439 ATGGCGAAAGGGGCAGGACAAGG + Intergenic
1167622305 19:50566989-50567011 CTGGACAGAAGGTCTGGAGAGGG + Intronic
1167723080 19:51192270-51192292 AAGGAGGGAGGGGCTGGAGATGG + Intergenic
1167734135 19:51281459-51281481 AGGGAGAACTGGGCTGGAAAAGG + Intergenic
1167749525 19:51371416-51371438 AGGAAGAAAAGTGCTGGAGAAGG + Intergenic
1168031242 19:53681680-53681702 TTGAAGCAAAGGACTGGAGATGG + Intergenic
1168255514 19:55162429-55162451 ATGAAGAACAGGGCCGGACATGG + Intronic
1168397937 19:56064893-56064915 AAGCAGAAAAGAGCTGGGGATGG - Intergenic
1168588278 19:57612222-57612244 ATGGAGAAAAGAGAAGGTGAAGG - Intronic
925642349 2:5998271-5998293 ATGAAGAGAAAGACTGGAGAGGG + Intergenic
925751846 2:7096290-7096312 ATGGGGCACAGGGCTGGAAAAGG + Intergenic
925917905 2:8619780-8619802 AGAGAGAAGAGGGCTGGAGCAGG - Intergenic
926309799 2:11667276-11667298 AAGGGGAAAGAGGCTGGAGAGGG - Intronic
927797388 2:26062014-26062036 TTGGGGAAAAGGGGTGGAGTTGG + Intronic
928752357 2:34485727-34485749 CTGGAGCAAAGGCCTGGAGTAGG - Intergenic
929378886 2:41325400-41325422 ATGGAGTAAAGAGATTGAGAAGG - Intergenic
930123197 2:47776541-47776563 ATGGAGAAGATAGCTGGAGTGGG + Intronic
930571720 2:53094515-53094537 AAGGAGAAAAGAGATGGAGAAGG + Intergenic
930650995 2:53965176-53965198 CTGGAGGAAAGGGCGGGAAAAGG - Intronic
930776274 2:55174079-55174101 ATGGAAAAAAGGAATGGAAAGGG - Intergenic
930837201 2:55807072-55807094 ATGGAGAAAAGGGAAGAAAAGGG - Intergenic
930934813 2:56935791-56935813 ATGGAGAAAAGGAAAGGAGCAGG + Intergenic
931019511 2:58027539-58027561 GTGGTGAAAAGGGTTGGAAAGGG + Intronic
931196541 2:60057479-60057501 AGGGACAACAGGGGTGGAGAGGG - Intergenic
931805301 2:65798081-65798103 GTGGAGGAAAGGGGTGGAGGAGG + Intergenic
932009395 2:67960217-67960239 ATGGAAAACAGGGCTGGATAAGG - Intergenic
932099636 2:68886172-68886194 ACTGACAAAAGGGGTGGAGATGG + Intergenic
932623758 2:73282984-73283006 ATGCAGAAAAGGGGCTGAGAAGG + Intronic
932647718 2:73522030-73522052 AAGGAAAAAAGCACTGGAGAGGG - Intronic
932860212 2:75283790-75283812 ATAGTGAAAAGATCTGGAGATGG - Intergenic
933794797 2:85911012-85911034 ATTGTGAAGAGGTCTGGAGAGGG + Intergenic
934618136 2:95787894-95787916 CTGGAGAAAAGGACTTGAGCTGG - Intergenic
934642757 2:96036665-96036687 CTGGAGAAAAGGACTTGAGCTGG + Intronic
935414166 2:102797947-102797969 GTAGAGAAAATGGCTGGCGAAGG - Exonic
935975416 2:108573754-108573776 ATGGAGGAATGAGCTAGAGAAGG + Intronic
937088376 2:119187252-119187274 GAGGAGAAAGGGGCTGGAAATGG - Intergenic
937705683 2:124918182-124918204 ACTGAGAAAAGGGAAGGAGAGGG - Intergenic
937818214 2:126276433-126276455 AAGGAGAAAAGGAAGGGAGAAGG + Intergenic
938302048 2:130222824-130222846 GTGAAGAATAAGGCTGGAGATGG + Intergenic
938454652 2:131451628-131451650 GTGAAGAATAAGGCTGGAGATGG - Intergenic
938754651 2:134368583-134368605 AAGTAGAAAAGGGCAGGAGCAGG - Intronic
939881722 2:147639267-147639289 ATGCAGAATAGGGCAGCAGAGGG - Intergenic
940240826 2:151561530-151561552 ATGGAGAATAGGCATGGAAAAGG - Intronic
941158891 2:162012814-162012836 GTGGAGAGATGGGCTGGGGAGGG - Intronic
941765788 2:169294861-169294883 ATGGAGAGTAAGGCTGGACATGG + Intronic
942031064 2:171959985-171960007 ATGGAGAGAGGGGTAGGAGATGG + Intronic
942929313 2:181470629-181470651 AGGGAGAAAAGCTTTGGAGAAGG + Intronic
943024351 2:182609375-182609397 ATGCAGAAAAGGACTCTAGAGGG - Intergenic
943239502 2:185364887-185364909 CTGGAGAAAAGGCATGGGGATGG - Intergenic
943970581 2:194400352-194400374 AGGGAGAAAAGAGCTAGAGTTGG + Intergenic
944234714 2:197431408-197431430 AAGAAGAAAAGGGCTGGGCATGG - Intronic
944290695 2:198001219-198001241 ATGGAGACAATGGTTGGAAAAGG + Intronic
944353587 2:198758680-198758702 ATGCAGCCAAGGGCTGGGGATGG + Intergenic
944630552 2:201619443-201619465 AGGGAGAAAAGGACTCGTGAGGG - Intergenic
944652182 2:201842082-201842104 ATGATGAAAAGTTCTGGAGATGG - Intronic
945122284 2:206469268-206469290 ATGGGGAAAATTGCAGGAGAAGG - Intronic
945189890 2:207176872-207176894 ATAGAGAAAAGAGGTGGAGGAGG + Intergenic
945708360 2:213264726-213264748 ATGGACAAAATGGATGAAGAAGG + Intergenic
946090556 2:217219008-217219030 GTAGAGACAAGGGCTGGGGAGGG + Intergenic
946188393 2:217994535-217994557 TTTGGGAAAAGGGCTGGATATGG - Intronic
946341311 2:219071155-219071177 ATGGTGAAAGGGGTTGGAGCTGG - Intergenic
946904860 2:224406342-224406364 TTGGAGAAAAGGTGTGGAGAAGG + Intergenic
947846699 2:233250606-233250628 ATGGAGAAGAGAACTGGAAACGG - Intronic
948493282 2:238327679-238327701 AAGGAGAAGAGTCCTGGAGATGG - Intronic
948610616 2:239164002-239164024 AGGGAGGGAAGGGCTGGGGACGG + Intronic
948908676 2:240992149-240992171 ATGGAGACGAGGGGTGCAGATGG - Intronic
1168840548 20:907329-907351 GTGGCGGAAAGGGCTGCAGAGGG + Intronic
1168906603 20:1408976-1408998 AAGGGGAAAAGTTCTGGAGATGG - Intergenic
1169284654 20:4297840-4297862 AAGGAGAAAAAGTCAGGAGAGGG - Intergenic
1169891018 20:10452159-10452181 ATGGAGGAAAGGGGTTGAGGAGG - Intronic
1170306476 20:14944231-14944253 AGGGAGAGGAGGGCTGGGGAAGG + Intronic
1170354435 20:15477071-15477093 ATAGAGAAAAGGAATGGAAAAGG - Intronic
1170448443 20:16455881-16455903 ATGGAGGAAAGGGCTGGAAAGGG - Intronic
1170712911 20:18808215-18808237 ATGGAGAAGTGAGATGGAGAAGG - Intergenic
1171071506 20:22073181-22073203 ATGGGGAAATGGGATGGAAATGG + Intergenic
1171147460 20:22797861-22797883 ATGGAGACAACCGCTGGAGAAGG - Intergenic
1173149978 20:40558681-40558703 AAGGAAAAAAGGGATGGAGGAGG + Intergenic
1173418239 20:42877526-42877548 AAAGAGAAAAGGGCAGGAGGGGG + Intronic
1173617677 20:44413645-44413667 AGGGAGAACAGGGATGGAGTAGG - Intronic
1173626578 20:44477161-44477183 ATGGAAAATGAGGCTGGAGAGGG + Intronic
1174110620 20:48195484-48195506 ATGGAGTCAAGGGCAAGAGAAGG - Intergenic
1174160875 20:48549555-48549577 ATGGAGAACAGGAGTGGAGTTGG - Intergenic
1174416901 20:50373423-50373445 ATGGAGGAAAGGGCTGGGTGTGG + Intergenic
1174486012 20:50861695-50861717 CTGGGGAAAGGGGCTGGAGCGGG - Intronic
1174515741 20:51091152-51091174 GTGGAAAAATGGGCTGGAAATGG - Intergenic
1174964684 20:55199160-55199182 GTTGAGCAAAGGGCTGAAGAAGG + Intergenic
1174975555 20:55329205-55329227 ATGGAAAACAGGGCTGGAAGAGG - Intergenic
1175150665 20:56931426-56931448 GTGGCGGAAAGGGCTGGACATGG + Intergenic
1175600552 20:60269114-60269136 TTGGAGCAACTGGCTGGAGATGG + Intergenic
1175616641 20:60405365-60405387 ATGGAGAAGGGGGAAGGAGAAGG + Intergenic
1175921336 20:62451808-62451830 ATGGAGAAGAGAGAGGGAGAGGG + Intergenic
1175964907 20:62655559-62655581 GTGGGGAACAGGGCTGGTGAGGG + Intronic
1176249364 20:64112924-64112946 ATGTAGGAGAGGGCTGGAGGGGG + Intergenic
1176256484 20:64155749-64155771 AAGGAGACAAAGGATGGAGAGGG - Intronic
1176889208 21:14293952-14293974 GGAGACAAAAGGGCTGGAGAGGG + Intergenic
1176945270 21:14972717-14972739 ATGGAGTAGCGGGGTGGAGATGG + Intronic
1178340509 21:31782151-31782173 ATGGACAGAGGGGCTGGAGTGGG - Intergenic
1178341889 21:31792783-31792805 ATGGAAACGAGGGCTGCAGATGG - Intergenic
1178370062 21:32020179-32020201 ATGGAAAAAAGGTCTGGAGATGG - Intronic
1178692599 21:34761825-34761847 ATGGAGACAAGGTCTGCAGAAGG - Intergenic
1178930076 21:36810418-36810440 TAGAAGAAAAGGGCTGGAGAGGG - Intronic
1179028873 21:37702837-37702859 AAGGAAGAAAGTGCTGGAGAGGG + Intronic
1181628730 22:24138971-24138993 GTGGAAAGAAGGGCAGGAGAAGG + Intronic
1182487303 22:30647105-30647127 ATGGAGAACAGGGCTGGGCATGG + Exonic
1183007604 22:34916509-34916531 AGGGAGGAAAGGGAGGGAGACGG + Intergenic
1183124126 22:35759141-35759163 ATGGGGAAAAGGAGTGAAGATGG - Intronic
1183284435 22:36953296-36953318 CTGGAGCAAAGGTCTGGAGGTGG + Intergenic
1183368149 22:37417952-37417974 AGGGAGAGAAGGGGAGGAGAGGG + Intronic
1183714766 22:39527234-39527256 GTGGGGAAAAGGGCTGGGGTGGG - Intergenic
1184137835 22:42559778-42559800 ATGGAGACAAGGGCAGCAAAAGG - Intronic
1184368418 22:44067564-44067586 ATGGAGCACTGGGCTGGCGAGGG + Intronic
1185051599 22:48556990-48557012 AAGGAGAAGAGGGCTGCAGCCGG + Intronic
1185102606 22:48849746-48849768 ATGGAGAAAGCAGGTGGAGAGGG + Intronic
1185105931 22:48869842-48869864 CTGCAGAATAGGCCTGGAGATGG - Intergenic
949098997 3:120392-120414 AGGGGGAAAAGGGATGAAGAAGG + Intergenic
949295767 3:2520562-2520584 AAGGAAAAAAGGGCTGGATGTGG - Intronic
950265443 3:11569614-11569636 GAGGACGAAAGGGCTGGAGATGG - Intronic
950284494 3:11733970-11733992 ATGGAGAAAGAGCATGGAGAAGG + Intergenic
950526725 3:13528754-13528776 ACGGAGTAAAGGGGTGGGGAGGG - Intergenic
950648392 3:14392238-14392260 ATGCAGGAAAGGGCTGGTCATGG - Intergenic
952669399 3:35948013-35948035 ATGGAGAGGAGGGATGGAAAGGG + Intergenic
952970303 3:38646570-38646592 ATGGAGATCTGGGCTGGAAATGG - Intronic
953828756 3:46277424-46277446 AAGGGGAAAAGGGTGGGAGAAGG - Intergenic
954005315 3:47585940-47585962 ATGGAGAAAATGAATGAAGAAGG - Exonic
954342641 3:49967822-49967844 ATGGACTATAGGGGTGGAGATGG + Exonic
954390765 3:50267038-50267060 AGGGAGAGGAGGGCAGGAGAGGG - Intergenic
954864190 3:53715090-53715112 AGGGAGTAAGTGGCTGGAGAAGG + Intronic
955061684 3:55497855-55497877 ATGGAAGAAAAGGATGGAGAAGG + Intergenic
955249847 3:57269184-57269206 ATGGAGAAAAGGGCTGGAGAGGG + Exonic
955579457 3:60403462-60403484 AGAGAGAGGAGGGCTGGAGAAGG - Intronic
955965150 3:64381591-64381613 ATTGAGAGAAGGGAAGGAGAAGG - Intronic
956160797 3:66350226-66350248 AGGGAGTAAGGGGCTGGAGGTGG + Intronic
956399474 3:68861757-68861779 AGGGAGAAAAGGGAAGTAGAAGG + Intronic
956962194 3:74416027-74416049 TTAGAGAAAAGGAATGGAGATGG - Intronic
957261392 3:77906519-77906541 ATGGAGAAGGAGGCTGAAGAAGG + Intergenic
957395835 3:79636563-79636585 ATGGAGTAAAGGAATGGTGAGGG - Intronic
958933622 3:100233962-100233984 ATGAATAGAAGGGCTGAAGACGG + Intergenic
959166544 3:102786816-102786838 ATGGAGAATAGCACTGGAGAGGG - Intergenic
959627927 3:108473464-108473486 AAGCAGAAAAGGGGTGGAAAAGG - Intronic
960441016 3:117689037-117689059 ATTTAGAAAAGGGATGGATAAGG + Intergenic
960801141 3:121541832-121541854 TTGAAGAAAAGGGCTGGGCATGG + Intronic
961104869 3:124232436-124232458 ATGGAGATACGTGGTGGAGAGGG - Intronic
961474188 3:127136580-127136602 ATGGGGAACTGAGCTGGAGAGGG + Intergenic
961586059 3:127926051-127926073 ATGGAGATAAGTGAAGGAGATGG - Intronic
962583344 3:136818244-136818266 CTGGAGAAAACTGCAGGAGAGGG + Intergenic
962710748 3:138083739-138083761 ATGGTGAAATAAGCTGGAGAAGG - Intronic
962976539 3:140451000-140451022 ATGGAGGAGAGGACTGGAGGTGG - Intronic
963049263 3:141127714-141127736 ATGGAGACACAGGCTGGAGAAGG + Intronic
963238317 3:142976919-142976941 ATGTAGAATTGGGCTGGAAAAGG + Intronic
963359174 3:144248738-144248760 ATGGGGAAAATGGCTGTTGATGG - Intergenic
964394128 3:156227872-156227894 ATGGCAGAAAGGGCTGGAGGAGG - Intronic
964941122 3:162158691-162158713 ATGGAGAGAAGGGGTGGGGGAGG + Intergenic
964966940 3:162506094-162506116 ATGGAAAAATGGGCTGGGCATGG + Intergenic
965447715 3:168796339-168796361 ATTGAGAGAAGGGCCAGAGATGG - Intergenic
965747257 3:171938392-171938414 ATGGAGTAAAGGGAAGGAGCAGG + Intronic
966285492 3:178290240-178290262 ATAGAGAAAAGGATTGAAGAGGG + Intergenic
966506750 3:180711764-180711786 AAGGAGAGAAGGGTTGTAGAAGG + Intronic
966676913 3:182599572-182599594 GAGGAGAGAAGGCCTGGAGAAGG - Intergenic
967031272 3:185609700-185609722 ATGGAGAGAGGGGCAGGAGTGGG - Intronic
967335999 3:188345421-188345443 ATTCAGAAAAGGGCAGGAGGCGG - Intronic
968131355 3:196194566-196194588 ATGGAGGAAAGGCGTGGAGATGG + Intergenic
968195491 3:196703035-196703057 AGGTTGAAAAAGGCTGGAGAAGG - Intronic
968541140 4:1169021-1169043 ATGGAGAGAAGGGTGGGAGACGG - Intronic
969491898 4:7504200-7504222 CAGGAGAAAAGGGCTTGAGCTGG - Intronic
969909649 4:10431777-10431799 TTGGAGAGGAGGGCTGTAGAGGG + Intergenic
970318578 4:14853435-14853457 ATGGAAAAAAGGTGTGGGGAAGG - Intergenic
970386669 4:15563409-15563431 AAGGAGAAAAGGTCGGAAGAAGG + Exonic
970947627 4:21713768-21713790 ATGGGAAAAAAGGCTGGAGAGGG - Intronic
971234549 4:24829422-24829444 ATGGAGAAAAAAGATGGAGTGGG + Intronic
971264024 4:25082436-25082458 AAGGAGAACAGGCCTGCAGAAGG + Intergenic
971642132 4:29147726-29147748 ATGGAGGAGAGGATTGGAGATGG - Intergenic
971751628 4:30656910-30656932 ATGGAGAAGAGGGTGGGAGCTGG + Intergenic
971918032 4:32899547-32899569 ATAGAGAAAGAGGCAGGAGATGG - Intergenic
972263634 4:37437611-37437633 ATGAAGGAAAGGGATGGTGAAGG + Intronic
972687861 4:41368596-41368618 ATTGAGAAAAGGGCTTGCGTTGG + Intronic
972726290 4:41748664-41748686 ATGGAGAAGGTGGCTGGAGTGGG + Exonic
973835310 4:54803552-54803574 ACAGACAAGAGGGCTGGAGAAGG + Intergenic
973885735 4:55319110-55319132 AAGGAGCAGAGAGCTGGAGATGG - Intergenic
975208790 4:71675086-71675108 ATAGTGAAAAGTTCTGGAGATGG + Intergenic
975267659 4:72389995-72390017 GTGGAGAAGAGGGCAGGAAAAGG + Intronic
975399420 4:73917435-73917457 ATGGAGAAATTGCCTAGAGAGGG - Intergenic
975485110 4:74927149-74927171 AAGGAGAAAATGGCTGGGTATGG - Intergenic
975512713 4:75211335-75211357 AAGGAGAAAAGGGCTAGTGAGGG + Intergenic
975708063 4:77130267-77130289 ATGGGCAAAAGGGCTGGGCATGG - Intergenic
975850314 4:78565315-78565337 ATGTGGGAAATGGCTGGAGATGG + Intronic
975949997 4:79758883-79758905 ATGGTGAAGAGGACTGGAAAGGG - Intergenic
976516926 4:85979423-85979445 ATGTAAAAAAGCTCTGGAGATGG - Intronic
976740122 4:88348276-88348298 ATGGAGAGAAGGGGTGGGGGGGG + Intergenic
977656887 4:99533040-99533062 ATGGAGAAAGTGGCAAGAGATGG + Intronic
977705096 4:100061837-100061859 AGGAAGAAAAGGGCAGGGGAGGG - Intergenic
980134941 4:128849730-128849752 TTGCAGAAAAGAGGTGGAGAAGG - Intronic
980232872 4:130066398-130066420 TTGGTGAAAAGGGCTTGATATGG - Intergenic
980458050 4:133070387-133070409 ATGGAGCAAAGGGTTAGGGAAGG + Intergenic
980481610 4:133395167-133395189 CTGGAGCCACGGGCTGGAGAGGG + Intergenic
981220847 4:142232551-142232573 AAGGAGAAGAGGGAGGGAGATGG - Intronic
981240562 4:142471843-142471865 ATGGAGGAAGGGGCTGGTGAAGG - Intronic
981258387 4:142690640-142690662 CTGGCAAAAAGGACTGGAGAAGG + Intronic
981554740 4:145980587-145980609 ATAGAGAAAGGGGCATGAGAGGG + Intergenic
982297790 4:153847598-153847620 ATGATGAAAAGTTCTGGAGATGG + Intergenic
982317545 4:154046982-154047004 TTTGAGCAAAGGGCTGGAGGAGG + Intergenic
982651924 4:158097254-158097276 CTGGAGAAAATGGATGGAAATGG - Intergenic
982996580 4:162356083-162356105 ATGGAGAAAATAGCTAAAGAAGG - Intergenic
983589271 4:169389764-169389786 ATGAAGAAATGGGCTGGGCATGG - Intergenic
984176831 4:176429368-176429390 AAGGAGGAAAGGCATGGAGAAGG + Intergenic
985190291 4:187365491-187365513 GTGGGGAGAGGGGCTGGAGATGG - Intergenic
985354810 4:189107294-189107316 GTGGAGAAAAGTGCAGGGGAAGG - Intergenic
986299539 5:6467194-6467216 AAGGAGGAAAGGGGAGGAGAGGG - Intronic
986666897 5:10112410-10112432 ATGGAAACAAGGGGTGGAGGTGG + Intergenic
987220202 5:15783385-15783407 GTGGAAAAAAGGGCTGTCGAAGG + Intronic
987244956 5:16039325-16039347 ATGGAGATAGGGGCTGCAGTGGG + Intergenic
987557446 5:19472635-19472657 ATGGAGAAAAGAACTGGGGAGGG + Intergenic
987579172 5:19766398-19766420 ATGGAGAGAAGGGGTGGATTTGG - Intronic
988497673 5:31758692-31758714 ATGGAGGAAAGGGAGGGAGGAGG - Intronic
988689244 5:33555926-33555948 ATGGAGAAACTGGCCTGAGAAGG - Intronic
989467883 5:41778438-41778460 AGAGAGAAGAGGTCTGGAGATGG + Intronic
989973599 5:50555054-50555076 AGGGAGAAGAGGACTGTAGAAGG - Intergenic
990301310 5:54451877-54451899 ATGGACAGGAGGGCAGGAGAAGG + Intergenic
990503646 5:56423148-56423170 ATGGAGAAGTGAGCTGGTGAAGG - Intergenic
990506317 5:56448974-56448996 AAGAAGAGAAGGGCTGGACATGG + Intergenic
990904864 5:60793018-60793040 ATGGAGCAGAGAGCTGGAGCAGG + Intronic
991214697 5:64148869-64148891 ATGGTGAAAGGGCTTGGAGAAGG - Intergenic
992259362 5:74954252-74954274 AAGTAGACAAGGGCTGGAGGAGG + Intergenic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
992981479 5:82178661-82178683 ATAGGGAAAAGAGTTGGAGAGGG - Intronic
993293211 5:86101924-86101946 GTGGAGAGGAGAGCTGGAGAGGG - Intergenic
993355863 5:86906556-86906578 AAGGAGGAAAGGGATGGACATGG - Intergenic
993763013 5:91820195-91820217 ATTGAGAAGGGGGCCGGAGAAGG + Intergenic
994212041 5:97097980-97098002 AGGCAGAAAAGGGCTGAAGAAGG - Intronic
994223800 5:97228633-97228655 ATGGAGGAGAGGACAGGAGAGGG + Intergenic
994532896 5:100989720-100989742 ATGGAGCAAAGAGCAGGAGGAGG + Intergenic
994867220 5:105290921-105290943 ATGGAGAAAAGAAATGTAGATGG - Intergenic
995061377 5:107814656-107814678 ATGTAATAAAGGGCTGGGGAAGG - Intergenic
995125389 5:108573400-108573422 ATGGAGAGAAGGGGTGGGGTGGG + Intergenic
995328324 5:110917647-110917669 ATGGAGAAAGAAGCAGGAGAAGG + Intergenic
995658046 5:114449232-114449254 ACTGAAAAGAGGGCTGGAGAAGG - Intronic
995741013 5:115355804-115355826 AAGGGGAGAAGGGCTGGAGTTGG - Intergenic
995755879 5:115503343-115503365 ATGGAGAGAAGGGCTGGTAATGG + Intergenic
996403207 5:123085237-123085259 ATGGAGAAGGGGGTTGGAGGCGG - Intergenic
996764406 5:127021220-127021242 ATGGAGGAAAGGGATGGAGTAGG + Intronic
996771293 5:127088560-127088582 AGGGAGAAGAGGGGAGGAGATGG + Intergenic
996810803 5:127514691-127514713 ATGGTGCATAGAGCTGGAGATGG - Intergenic
997167257 5:131674422-131674444 ATGGAGAATAGGGCTGGGCATGG + Intronic
997202242 5:132017988-132018010 AGAGAGAACAGGGCTGGAGGTGG + Intergenic
997842587 5:137255891-137255913 ATGGTAGAAAGGGCTAGAGAAGG - Intronic
997849378 5:137317174-137317196 AGGGAGACAAGGGCTGTAGTTGG - Intronic
997958813 5:138302767-138302789 ACAGAGAAAAGGGCTGGGTAGGG + Intronic
997983144 5:138482790-138482812 ATGGAGGAATGGGGTGTAGAAGG + Intergenic
998680077 5:144457400-144457422 ATGAAGAGAAGCCCTGGAGAAGG + Intronic
999070473 5:148738669-148738691 AAGGAGGAAAGGGAGGGAGAAGG - Intergenic
999730718 5:154475057-154475079 AGGTAGAAAAGGGTTGGGGATGG + Exonic
1000027402 5:157371326-157371348 ATGGAGAAAGGAGCTGGAAATGG - Intronic
1000056042 5:157607492-157607514 ATGGAAAACAGGGCCAGAGATGG - Intergenic
1000173525 5:158727581-158727603 AGGGAGAAAAGGGCAGGCTAAGG - Intronic
1000326370 5:160175600-160175622 GTGGAGAAAATGGCTGGTGTGGG - Intergenic
1000491908 5:161924630-161924652 TGGAAGACAAGGGCTGGAGAGGG - Intergenic
1000861989 5:166466966-166466988 ATAGAAAAGAGGGCTGGGGACGG - Intergenic
1000988614 5:167888429-167888451 ATGGAGGAAAGGTATGCAGAGGG + Intronic
1001210968 5:169809910-169809932 ATGGAGAAGAGGATTAGAGAAGG - Intronic
1001372714 5:171222427-171222449 ATGTAGATAAGGAATGGAGATGG + Intronic
1001948421 5:175798640-175798662 GTGGAGAGAAAGGCTGGAGCCGG + Intronic
1002272757 5:178083554-178083576 ATGTAGAAAAGGGCTGATAAGGG + Intergenic
1003871516 6:10407074-10407096 ATGTTTAAAAGGGGTGGAGATGG + Intronic
1004226534 6:13789817-13789839 ATGGAGAAGAGGGAGGGAGGAGG + Exonic
1004324800 6:14665036-14665058 CTGGAGAAACAGGCTGGAAAGGG - Intergenic
1005266204 6:24114668-24114690 ATGGAGATGAGGGCTGCAGGAGG - Intergenic
1005713261 6:28522852-28522874 ATGGAACAAGGGGCTTGAGAAGG + Intronic
1006175780 6:32120739-32120761 AAGGAGAAAAGGGCCGGGCATGG - Intronic
1006416798 6:33909185-33909207 CTGGGAAAGAGGGCTGGAGAGGG - Intergenic
1006962444 6:37946928-37946950 ATGAAAAAAAGCTCTGGAGATGG + Intronic
1007404079 6:41623562-41623584 AAGAGGAAAAGAGCTGGAGAGGG - Intergenic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1007941250 6:45783462-45783484 ATTGAGAAGAGTCCTGGAGAAGG - Intergenic
1007985499 6:46203650-46203672 ATGAAGCAAAAGGCTGTAGATGG + Intergenic
1008501302 6:52185670-52185692 ATGGAGAAAAGGGGGGCAGGGGG - Intergenic
1008527639 6:52422171-52422193 ATGGACAAGAGGGGTGGAAAGGG + Intronic
1009270806 6:61610985-61611007 ATGGAGAAAATGGCAGGAATTGG + Intergenic
1009305397 6:62083325-62083347 ATGGGGAAAGGGGATGGAGTAGG - Intronic
1010601927 6:77839387-77839409 AGATAGCAAAGGGCTGGAGAAGG - Intronic
1011007035 6:82657032-82657054 AGGGAGAAATTGGGTGGAGAAGG - Intergenic
1011437844 6:87357803-87357825 ACAGAGGAAAGGGCTGGAGGGGG - Intronic
1013112867 6:107078419-107078441 ATGGGGTTGAGGGCTGGAGATGG + Intronic
1013171665 6:107641761-107641783 ATGCAGACAAGTGCTGCAGAGGG + Intronic
1013358167 6:109365385-109365407 GAGGAGAAAAGGGCTGGGGATGG + Intergenic
1014342003 6:120221986-120222008 GTGGAGAAATGTGCTGAAGATGG + Intergenic
1014611910 6:123557804-123557826 ATGGAGAGAAGGGGTGGGGGGGG - Intronic
1015184777 6:130402929-130402951 ATAAAGAAAAGAGATGGAGATGG - Intronic
1015872508 6:137791338-137791360 ATGGATCAAAGGGCTGGATGTGG - Intergenic
1016197675 6:141365790-141365812 TTGGAGAAACGGTCTGTAGAAGG - Intergenic
1016702856 6:147073056-147073078 AGGGAAAAAAGAGATGGAGACGG + Intergenic
1016739576 6:147513129-147513151 CTGGAGAAAGTGGCAGGAGATGG + Intronic
1017162615 6:151380320-151380342 ATGGGGCAAAAGGGTGGAGAAGG + Intronic
1017846950 6:158266903-158266925 ATGAACAAAAGTTCTGGAGATGG - Intronic
1017942672 6:159066906-159066928 AGAGAGAGAAGGGCAGGAGAAGG - Intergenic
1018023260 6:159782973-159782995 ATGGAGAACAGGGCTGAAAAGGG + Intronic
1018214566 6:161514446-161514468 ATGGGGAAAAAGGGTGAAGAAGG + Intronic
1019686289 7:2383972-2383994 ATGGGGATTAGGGGTGGAGAGGG - Intergenic
1020834151 7:13127434-13127456 TTGGGGAAAAGGGTTGGAGGGGG - Intergenic
1021034016 7:15774594-15774616 GTGGAGAGAAAAGCTGGAGAGGG - Intergenic
1021213744 7:17889408-17889430 ATAGAGGAAAGGGCCTGAGAGGG + Intronic
1021289473 7:18824956-18824978 ATGGAGAAAAGATAGGGAGAAGG + Intronic
1021296800 7:18918131-18918153 TTGGAGATAAGGGCTAGAAAAGG + Intronic
1021942198 7:25688837-25688859 ATGAAGAAAAGACCGGGAGAAGG + Intergenic
1022902541 7:34825155-34825177 AAGGAGAAAAGGCCTGGAGGTGG - Intronic
1023152322 7:37213689-37213711 AAGGGGAAAAGCGCTGGAAAGGG + Intronic
1023243914 7:38179768-38179790 ATGGAGAAATGGGATGGTCAGGG + Intronic
1023450440 7:40278754-40278776 ATGGATAAAAGGGAGGGAGAGGG - Intronic
1024531060 7:50393136-50393158 ATGGAAAGAAGGGCTTGTGAAGG + Intronic
1026176831 7:68005404-68005426 ATAGAAAATAGGGCTGGACACGG - Intergenic
1026262491 7:68767079-68767101 ATGGAGAAAAGGGCCGGGCACGG - Intergenic
1026899528 7:74029240-74029262 ATGGAAAGGCGGGCTGGAGAAGG + Intronic
1027205238 7:76092533-76092555 AAAGAGAAAAGGGCTGGGCATGG + Intergenic
1027235109 7:76293373-76293395 ATGGAGAAAAGGGGTGAATGAGG - Intergenic
1028396326 7:90372604-90372626 ATGGAAAATATGGCTGGGGAGGG - Intronic
1028739256 7:94253397-94253419 AGGGAGAAAGGGTGTGGAGAGGG - Intergenic
1029419714 7:100466377-100466399 ATTGAGACAGAGGCTGGAGAAGG - Intronic
1029612248 7:101633027-101633049 ATTCAGAAAAGGGATGGTGAGGG - Intergenic
1031185082 7:118467657-118467679 ATGGAGTAAAGGGTGGAAGATGG - Intergenic
1031550479 7:123105544-123105566 AAGGAGAAAAGAGCAAGAGAGGG + Intergenic
1031876839 7:127151238-127151260 ATGGAGGTCAAGGCTGGAGAAGG - Intronic
1032473927 7:132199645-132199667 ATGCTGAAAAGGGGTAGAGATGG - Intronic
1033045872 7:137961827-137961849 ATGGAGGAAAGGCCTGGGGTAGG - Intronic
1033179696 7:139163747-139163769 ATGGAGAAAAGAGGTTCAGATGG + Intronic
1033265153 7:139879113-139879135 GGGGACAATAGGGCTGGAGAAGG + Intronic
1033282757 7:140017602-140017624 CTGGAGCACAGGGCTGCAGAGGG + Intronic
1033327281 7:140390262-140390284 ATGGTCAAAAGGGCTGGGGGTGG - Intronic
1033345964 7:140525953-140525975 ATGAAGAGCAGGGCTGGGGAGGG + Intronic
1033512689 7:142075777-142075799 AAGGAGAGAAGTGCTGGTGAGGG + Intronic
1034451280 7:151138538-151138560 CTGGGGAAAAGGGCTGCACATGG - Intronic
1036062717 8:5342279-5342301 GAGGAGAGAAGGACTGGAGAGGG - Intergenic
1036652768 8:10655587-10655609 GTGGAGAAAATGGCTGAGGACGG - Intronic
1036659440 8:10698470-10698492 AGGGAGACAAAGGCTGGAGCTGG + Intronic
1037009749 8:13826232-13826254 ATGGAGGAAAGGGCAGAAAATGG + Intergenic
1037178090 8:15970859-15970881 CTGAAGAAAAAGGGTGGAGATGG + Intergenic
1037583608 8:20261540-20261562 ATGCAGAAGGGGGCTGGGGATGG - Intronic
1037600772 8:20391889-20391911 AGGGAGAACAGGGTTTGAGAGGG + Intergenic
1037920034 8:22799350-22799372 ATTGAGAATAAGGCTGGAAAGGG - Intronic
1038324927 8:26565876-26565898 TTGGAGAAAAAGCCTGGAGGAGG + Intronic
1038328053 8:26587399-26587421 ATGGTGACATGGTCTGGAGAAGG - Intronic
1038454956 8:27667075-27667097 GAGGAGAGAAGGGCTAGAGAAGG - Intronic
1038646011 8:29362962-29362984 ATCAAGAAAAATGCTGGAGATGG + Intergenic
1038864741 8:31427732-31427754 ATGGGGAAGAGTGCAGGAGATGG - Intergenic
1038916530 8:32030789-32030811 ATGGAGCAAAGGCAGGGAGACGG + Intronic
1039037757 8:33378221-33378243 ATGAGGAAAAGGTCTGGGGAGGG - Intronic
1039076386 8:33693823-33693845 ATGGAGAGGGGAGCTGGAGAGGG - Intergenic
1039800278 8:40948649-40948671 ATGATGAAAAGTGCTGGAGATGG + Intergenic
1039969198 8:42307182-42307204 GAGGTGAAAAGGGCTGGAGGTGG + Intronic
1040060981 8:43102563-43102585 ATGGAGACCTGAGCTGGAGAAGG + Exonic
1040083625 8:43314909-43314931 ATGGGGAAAAGGGCTAAAGATGG - Intergenic
1040626542 8:49156324-49156346 ATGGAGGGAAGGGATGGAGATGG - Intergenic
1040663688 8:49604908-49604930 GTGGAGAAGAGAGCTGGAAAGGG - Intergenic
1040894004 8:52346886-52346908 AAGGAGGAAACGGCTGGAGTAGG + Intronic
1041043199 8:53867104-53867126 ATGGAGGAAGGGTCAGGAGAGGG - Intronic
1041074697 8:54158798-54158820 ATGAAGATAAGTGCTGGAAATGG + Intergenic
1041456352 8:58065209-58065231 ATGCATTAAAGGGCTGGTGATGG + Intronic
1041642180 8:60214999-60215021 AGGAAGAAAAGGGCAGGAAAAGG + Intronic
1042092436 8:65173196-65173218 AAGGAGAAGAGATCTGGAGAGGG + Intergenic
1042274889 8:66994015-66994037 ATGGAGAGAAGGGATAGAGGAGG - Intronic
1042392905 8:68256437-68256459 ATGGAGTGAAGGGCTTGAAAGGG + Intergenic
1044136494 8:88592295-88592317 AAGGAAAAGAGGGCAGGAGATGG + Intergenic
1044351190 8:91168363-91168385 CAGGAGAGGAGGGCTGGAGATGG - Intronic
1044598503 8:93981064-93981086 ATGGAGACAAGACCTGGGGAGGG + Intergenic
1044720359 8:95139711-95139733 CTGGAGAAAGGGGGTGGAGGGGG - Intronic
1045126218 8:99091943-99091965 ATGCAGGAAAGAGCTGAAGAAGG - Intronic
1045232506 8:100317995-100318017 ATGGGGTCAGGGGCTGGAGAGGG - Intronic
1045338746 8:101233128-101233150 ATGAAGGAAAGCGCTGAAGATGG + Intergenic
1045452139 8:102338087-102338109 ATGGAAAGAATGGCTAGAGAAGG + Intronic
1045833326 8:106490712-106490734 ATGGTGAGAAGGACTGAAGATGG + Intronic
1046151485 8:110232108-110232130 ATGGAGAAAGATGGTGGAGAGGG + Intergenic
1047418388 8:124685157-124685179 ATGATGAAAAGTTCTGGAGATGG - Intronic
1047742021 8:127814206-127814228 AATGAGGAAGGGGCTGGAGAAGG - Intergenic
1047880170 8:129184262-129184284 ATGGAAAACAGGGCTGGGCATGG + Intergenic
1048327679 8:133451690-133451712 ATGGAGTAGCGGGCTGCAGATGG - Intergenic
1048981478 8:139705156-139705178 AAGGAGATAAAGCCTGGAGAGGG - Intergenic
1049066656 8:140321641-140321663 AAGGAGAAAAGGGCTGAACTTGG + Intronic
1049629841 8:143647775-143647797 GTGTAGAAAAGAGCTGGAGAAGG + Intronic
1049829437 8:144690946-144690968 ATGGACAAAAGGGCTGGGCAAGG - Intergenic
1050225925 9:3455308-3455330 TAGGTGAAAAGGGGTGGAGAGGG - Intronic
1052027328 9:23588133-23588155 TTGGGAAAAAGGTCTGGAGAAGG - Intergenic
1052190334 9:25654101-25654123 AAGGAGAAAGAAGCTGGAGATGG - Intergenic
1052273900 9:26656746-26656768 ATGGAGAAAACAGCTGGTGGAGG - Intergenic
1052474678 9:28943728-28943750 AAGGATAACAGGGCTGGTGATGG + Intergenic
1052774282 9:32718421-32718443 GTGGAGGAGAGGGGTGGAGAAGG - Intergenic
1053052762 9:34975751-34975773 GTAGATAAAAGGGATGGAGATGG + Intronic
1053054738 9:34987885-34987907 AAGGAAAGAAGGGCTGGGGAGGG - Intergenic
1053152344 9:35751004-35751026 CTGGAGGGAAGGGCTGGGGAAGG + Intronic
1053234133 9:36437111-36437133 GTGAAGGAAAGGGCTGGAAAGGG - Intronic
1053305610 9:36982451-36982473 AAGGAGAGAAGGCCTGGAGATGG + Intronic
1053429231 9:38031029-38031051 ATGAAGGAAAGGGCTGGGCATGG + Intronic
1054879919 9:70134336-70134358 AGGGGGCAAAGGGATGGAGAAGG - Intronic
1054961583 9:70975992-70976014 ATGGAGATAGGGGCTGGGGGAGG - Intronic
1055660898 9:78502957-78502979 CTGGAAAAAAGGGCTGTGGAGGG + Intergenic
1055767765 9:79683223-79683245 AAGGAGAATAGGAATGGAGAAGG - Intronic
1055914719 9:81389369-81389391 ATAGAGAAAAGGGGGAGAGATGG + Intergenic
1056387815 9:86113511-86113533 ATGGAGAAATGGTGTGGAGTTGG + Intergenic
1056939912 9:90946182-90946204 ATTGAGAAGAGGGCAGGGGAAGG + Intergenic
1056953785 9:91066381-91066403 ATAGAGAAGACAGCTGGAGACGG + Intergenic
1057186714 9:93061192-93061214 TTGGAGGAAGGGCCTGGAGAGGG + Intronic
1058032128 9:100211613-100211635 ATGGAGCCAAGGCTTGGAGAAGG + Intronic
1059226169 9:112675097-112675119 TGGGAGAGAAGGGCAGGAGAAGG - Intergenic
1059375669 9:113879149-113879171 AAGGAGAGATGGGCTGGGGAGGG + Intronic
1059708774 9:116848191-116848213 ATGGAAAACAGGCTTGGAGAGGG + Intronic
1059808098 9:117826524-117826546 GTGGTAAAAAGGCCTGGAGATGG - Intergenic
1059875949 9:118634884-118634906 AGGGACAAAAGAGGTGGAGAAGG + Intergenic
1060217951 9:121749585-121749607 CTGGAGACTGGGGCTGGAGATGG + Intronic
1060602579 9:124888047-124888069 GGGGAGAAGAGGGCTGGGGAGGG + Intronic
1060619275 9:125048567-125048589 AAGAAGAAAAGGGCAGGGGAGGG + Intronic
1060665979 9:125432415-125432437 TTGCAGAAAAGGGCTGGGGGAGG - Intergenic
1060920352 9:127416418-127416440 ATGGAGATGAGTGATGGAGATGG + Intergenic
1061136369 9:128736374-128736396 AAAGAAAAAAGGGCTGGACATGG - Intronic
1061255672 9:129453395-129453417 ATGGAGTAGAGGGATGGGGATGG + Intergenic
1061646595 9:132007756-132007778 ATGGAGACAAGGCCAGGAGTAGG + Intronic
1061691800 9:132339051-132339073 ATTGGGAAAAGGGCTGGGCATGG - Intronic
1062088569 9:134661857-134661879 CTGGAGGGAAGGGCTGGAAAGGG - Intronic
1186858597 X:13649271-13649293 ATGACGAGAAGGGCTGCAGAGGG + Intergenic
1186915209 X:14211661-14211683 ATGGAAAAAACTGCTGGGGAAGG + Intergenic
1187017653 X:15346158-15346180 AAGGAGAAAAGGGCTGCCCAGGG - Exonic
1187167543 X:16818537-16818559 AAGGAGAAAAAAGATGGAGAAGG - Intronic
1187199208 X:17118570-17118592 TAGAAGAAAAGGGCTGGAAAAGG + Intronic
1187897789 X:23998793-23998815 CTGGAGAAAAGGTTTGGAGCAGG - Intronic
1188247182 X:27850653-27850675 AGGAAGCAAAGGGCTGGAGTGGG - Intergenic
1189565944 X:42241189-42241211 ATGGAGAGAATGGGTGGAGGAGG + Intergenic
1190363431 X:49670010-49670032 ACGGAGAAAAGCCCTGTAGAGGG - Intergenic
1191867638 X:65717976-65717998 ATGGAGACAGGGGTAGGAGAGGG + Intronic
1192317700 X:70065712-70065734 GTGGAGAGAAGGGCAGGAAAGGG + Intergenic
1192502398 X:71662676-71662698 AGGGAGAAAAGCACTGAAGAAGG + Intergenic
1192509601 X:71714053-71714075 AGGGAGAATAGCGCTGAAGAAGG + Intergenic
1192517096 X:71767500-71767522 AGGGAGAATAGCGCTGAAGAAGG - Intergenic
1192678435 X:73225290-73225312 ATGGAGAACAGGGATGGGAAAGG + Intergenic
1192801096 X:74465623-74465645 AGGCAGGAAAGAGCTGGAGAGGG + Intronic
1192838493 X:74828062-74828084 ATGGAAACAAGGGATGAAGATGG + Intronic
1192989861 X:76438880-76438902 ATGGAGAAAGGGGAAAGAGAAGG - Intergenic
1194598921 X:95895943-95895965 TTGGAGAAGAGGCCTTGAGATGG - Intergenic
1194701672 X:97120833-97120855 ATGGGGGAAATGGATGGAGATGG - Intronic
1195068752 X:101260184-101260206 ATGGAGAAAGGGGCTGGGAAAGG - Intronic
1195123261 X:101779138-101779160 ATGGAGGCAGGGGCTGCAGAAGG - Intergenic
1195328430 X:103776752-103776774 GTGGGGAAAAGGGGAGGAGAAGG + Intronic
1195966228 X:110432442-110432464 TTCGAGAGAAGAGCTGGAGAAGG + Intronic
1196508967 X:116482389-116482411 TTGGAGGAAAGGGTGGGAGAAGG + Intergenic
1197103374 X:122683938-122683960 AAGAAGAAAAGGGGGGGAGAAGG - Intergenic
1197467182 X:126819634-126819656 AGGGAGAAAAGGAGTGGGGAGGG - Intergenic
1197716088 X:129706960-129706982 ATGGAGAATAGGCCCTGAGAGGG - Intergenic
1197947741 X:131858909-131858931 ATGGAGAAAAGGTGTGTAAATGG - Intergenic
1198252698 X:134896263-134896285 AAGGAAATGAGGGCTGGAGAGGG + Intronic
1198547818 X:137711707-137711729 ATGGAGAAAAATTCTGGAGGCGG + Intergenic
1199066324 X:143422804-143422826 ATGGGCAAAAGGGCTGGGCATGG - Intergenic
1199426163 X:147703275-147703297 GTGGAAAAAAGGGCATGAGAGGG - Intergenic
1199431567 X:147766837-147766859 CAAGAGAAAATGGCTGGAGAGGG - Intergenic
1199766754 X:150946942-150946964 ATGGAGGAATGGGGTGGGGAGGG + Intergenic
1199830173 X:151541647-151541669 ATGGAGACAAGGGCTGGGGGAGG - Intergenic
1199857097 X:151768315-151768337 ATGGAGTTAAGGGCTGGTGATGG - Intergenic
1199907208 X:152245297-152245319 ATGGAGTAAAGGGCAGGATTTGG + Intronic
1200275088 X:154724458-154724480 ATGGAGACATGGGCTCCAGAAGG - Intronic
1201509420 Y:14741956-14741978 ATGGAGATAAGTGCTGAAAAAGG + Intronic
1201774148 Y:17645918-17645940 ATGGAGGCTAGGGCTGGAGGTGG - Intergenic
1201827409 Y:18260071-18260093 ATGGAGGCTAGGGCTGGAGGTGG + Intergenic
1201916207 Y:19184049-19184071 AAGGAGAAGAGGGAAGGAGAAGG - Intergenic