ID: 955260717

View in Genome Browser
Species Human (GRCh38)
Location 3:57387648-57387670
Sequence GACTCCCTTGGAATTCAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955260712_955260717 28 Left 955260712 3:57387597-57387619 CCAATTTTATTCTAGATAGCAAT 0: 1
1: 0
2: 1
3: 34
4: 370
Right 955260717 3:57387648-57387670 GACTCCCTTGGAATTCAGAATGG 0: 1
1: 0
2: 0
3: 18
4: 129
955260713_955260717 2 Left 955260713 3:57387623-57387645 CCCAGCTAAAAGACTAAATCTCC 0: 1
1: 0
2: 6
3: 26
4: 192
Right 955260717 3:57387648-57387670 GACTCCCTTGGAATTCAGAATGG 0: 1
1: 0
2: 0
3: 18
4: 129
955260714_955260717 1 Left 955260714 3:57387624-57387646 CCAGCTAAAAGACTAAATCTCCT 0: 1
1: 0
2: 1
3: 19
4: 137
Right 955260717 3:57387648-57387670 GACTCCCTTGGAATTCAGAATGG 0: 1
1: 0
2: 0
3: 18
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955260717 Original CRISPR GACTCCCTTGGAATTCAGAA TGG Intronic
905413437 1:37788267-37788289 GACTCCCCTGGATTTCAGGATGG + Intergenic
906088653 1:43157991-43158013 AACTCCCTTGGTGTACAGAATGG - Intergenic
907736259 1:57115656-57115678 GGCTTCCTGGGTATTCAGAAAGG + Intronic
908729764 1:67213932-67213954 GACTTCTAGGGAATTCAGAAGGG - Intronic
908750853 1:67421863-67421885 GAATCGCTTGAACTTCAGAATGG + Intronic
911346245 1:96700168-96700190 AACTCCCTAGAAATTCAGCAGGG - Intergenic
911658956 1:100478147-100478169 GACACATTTGGGATTCAGAATGG - Intronic
912456915 1:109804110-109804132 CACTCACTTGCAATTCAGAGAGG + Intergenic
915496247 1:156284703-156284725 GTCTCACTTGGAATGCAGGAGGG + Intronic
915854427 1:159366659-159366681 GGCACCTTTGGAATACAGAAAGG - Intergenic
916433315 1:164753552-164753574 GAGTCCCTTGGAATTAAAAATGG + Intronic
916633901 1:166647509-166647531 CACTCCCTTAGAATTCAAAAGGG - Intergenic
918535562 1:185570540-185570562 GACCACCTTGGATTTAAGAAGGG + Intergenic
924422977 1:243926319-243926341 GGCTCCCTTTGGATTCAGGAAGG - Intergenic
924892974 1:248305321-248305343 GACTTCTTGGGCATTCAGAATGG - Intergenic
1063519349 10:6726855-6726877 GACTACCTTGGAAGGCAGATAGG + Intergenic
1066292354 10:34026080-34026102 AACTCCCTGGGACTTCAGGATGG + Intergenic
1068077927 10:52280848-52280870 GATTCCTTTGGAATGCAGATAGG - Exonic
1068377001 10:56193812-56193834 CACTGACTTGGAATTCAGACAGG - Intergenic
1068405408 10:56582138-56582160 GTCTCACTTGGAATCCAGAAAGG + Intergenic
1068529646 10:58170999-58171021 GACTCACTAGGAATTAAGAAAGG + Intergenic
1071449335 10:85779524-85779546 GACTCCTTTGCAAATCAGAAAGG + Intronic
1074196323 10:111188784-111188806 TTCTGCCTTGGAATTCAGGAAGG + Intergenic
1077806323 11:5594788-5594810 AAGTCCCTTGGAATACAAAATGG - Intronic
1078783600 11:14464134-14464156 GATACACTTGGAGTTCAGAATGG - Intronic
1079296477 11:19239626-19239648 GAACAACTTGGAATTCAGAAAGG - Intronic
1084113603 11:67028963-67028985 GATTCCCTTGTAGTTCAGAGAGG - Intronic
1084190505 11:67496474-67496496 CACTCCCTGGGAAGTCAGTAGGG + Intronic
1084640873 11:70424914-70424936 GAGTCCCCTGCAATGCAGAAAGG + Intronic
1084948099 11:72649817-72649839 GATTCCCATGGAAACCAGAAAGG + Intronic
1088150504 11:106739357-106739379 GATTCCCTGGGAATTCAGTTAGG - Intronic
1091173256 11:133537228-133537250 GAGTCCCTGGGACTTCAGAAGGG - Intergenic
1091407158 12:216223-216245 GACCCACTTGGTATTCAGACTGG + Intergenic
1091407217 12:216603-216625 GACCCACTTGGTATTCAGACTGG + Intergenic
1092565113 12:9656950-9656972 GACTCCATTGTCATTCAGGAAGG - Intergenic
1092633095 12:10406804-10406826 GACTCCCTTTCAATACAGAGTGG - Intronic
1093020541 12:14199387-14199409 GCCTCCCATTGAATTCAGAAGGG + Intergenic
1093669617 12:21858184-21858206 AACTGCCTTGGAAATCTGAAAGG - Intronic
1097271099 12:57774732-57774754 GACTCCCTGGGAATCCATCAAGG + Intronic
1097754592 12:63395601-63395623 GATGCTCTTGGAATTCAGACTGG - Intergenic
1098957782 12:76705318-76705340 GAGGCCCTTGGAAATCTGAAAGG - Intergenic
1102224407 12:111217747-111217769 AACTCCATTGGATTTCACAAGGG - Intronic
1103244790 12:119447347-119447369 AACTCCTTAGGAATTCACAATGG - Intronic
1108527344 13:51297044-51297066 GACTCCCATGCATTTCTGAAAGG + Intergenic
1112442673 13:99435517-99435539 GACTCCCTTAATATTCACAAAGG - Intergenic
1112595757 13:100805585-100805607 GAATTCCCTGGAATTCAGACTGG - Intergenic
1113638703 13:111941700-111941722 GACTGCCTGTGTATTCAGAATGG + Intergenic
1114742358 14:25110514-25110536 GACTTCCATTCAATTCAGAAAGG + Intergenic
1115628819 14:35222721-35222743 TTCTCTCTTGCAATTCAGAACGG - Intronic
1117924473 14:60763523-60763545 GACTCCATTGTAATTTAGTAAGG + Intronic
1124229559 15:27932017-27932039 GAGGCCCTTGGAATTCAAAGTGG - Intronic
1125009925 15:34860441-34860463 GATTCCATTGAAATTTAGAAAGG + Intronic
1126677482 15:51173015-51173037 GAATCTTTTGGAGTTCAGAAAGG + Intergenic
1129962383 15:79699103-79699125 GACTCCCTTGGGACTCGGACTGG - Intergenic
1131977992 15:97964694-97964716 GGCTAACTTGGAATACAGAAAGG - Intronic
1132023969 15:98389057-98389079 GTTTCCCTTGGAAAGCAGAATGG + Intergenic
1147176392 17:38658678-38658700 GACTGACTTGGAACTCAGAAAGG + Intergenic
1148704675 17:49619250-49619272 TTCTCCCTTGGCATTCAGGATGG + Exonic
1148742551 17:49901171-49901193 GACTCAGTAGGAAATCAGAAGGG - Intergenic
1150320309 17:64208051-64208073 TACTCCCTTTGCATTCAGGAGGG + Intronic
1155741272 18:29291188-29291210 GGGTCCCTAGGATTTCAGAATGG - Intergenic
1155776334 18:29766614-29766636 GACTCCCCTGCAATTCATGAGGG + Intergenic
1156901962 18:42310469-42310491 GACACCCCTGGAATTCAGATCGG + Intergenic
1158828006 18:61245667-61245689 GACTACCTTGGATTCTAGAATGG + Intergenic
1159682133 18:71367983-71368005 GAGTCCCTTGGAATGCTGACTGG + Intergenic
1167141993 19:47658132-47658154 GACTCCCTTGCAGCTCAGAATGG - Intronic
1167229762 19:48274912-48274934 GAGTCCCTGGGTAGTCAGAATGG + Intronic
1168478502 19:56696367-56696389 GTCCCCCATGGAATTCAGCACGG - Intergenic
925746675 2:7049499-7049521 GAGTCTCTTGGAATCCACAAAGG + Intronic
928194114 2:29202036-29202058 GACGGCCTTGGAACTCAGATGGG - Intronic
932002039 2:67893935-67893957 GACTTGCAAGGAATTCAGAAGGG - Intergenic
932890097 2:75587104-75587126 GACTCCCAGGGAATTCAGCCAGG - Intergenic
936918672 2:117665338-117665360 GACTCTCTCTGAATTCAGATAGG + Intergenic
937757887 2:125562908-125562930 GAATGCCATGGAACTCAGAAAGG - Intergenic
939147589 2:138434659-138434681 TACTCACTTGGAATTCCAAATGG - Intergenic
942521595 2:176809635-176809657 GACCTCCTTGGACTTCACAAAGG + Intergenic
942827910 2:180202877-180202899 GAAGCCTTTGGAATTCAGAACGG + Intergenic
944682269 2:202087885-202087907 GACTCCGTTGCATCTCAGAATGG - Intronic
945426514 2:209711162-209711184 GACTTTCTTGGAATACTGAAAGG - Intronic
1175995548 20:62810676-62810698 GGGTCCCTTGGAAGGCAGAAGGG + Intronic
1178784003 21:35635354-35635376 CACTCCCTTGAAATTCAGCTTGG + Intronic
1182240437 22:28911794-28911816 GACTGCCCTGGGTTTCAGAAGGG + Intronic
952595102 3:35007911-35007933 GAATCCCTTTGAATTCAGCTGGG + Intergenic
953085752 3:39665099-39665121 GACTCGCTTGCAATTCGGCATGG + Intergenic
954628261 3:52034683-52034705 GAGACTCTTGGAATTCAGCAGGG + Intergenic
955260717 3:57387648-57387670 GACTCCCTTGGAATTCAGAATGG + Intronic
955813126 3:62812737-62812759 CACTCACTTGTAATTCAGAAAGG - Intronic
959150138 3:102598245-102598267 TCCTTCCTTGGAATTGAGAATGG - Intergenic
960993066 3:123324273-123324295 GACTCCCTGGAAATCCAGCAGGG - Intronic
965470160 3:169080499-169080521 GACTGCCTGGGAATCCAGGAGGG - Intergenic
968435749 4:588096-588118 GACTGACTTGGAAGACAGAACGG + Intergenic
968906244 4:3452647-3452669 GGCTCCCTTGGAGTCCAGCAGGG - Intergenic
971787432 4:31123396-31123418 GACCCCCTTGGACTTCTGAAAGG + Intronic
973208384 4:47586534-47586556 CACTCCCTTGAAATTAAGCATGG - Intronic
973958446 4:56086654-56086676 GACTGCCATGGAAATCAGATAGG - Intergenic
978085128 4:104642614-104642636 TTCTGCCTTGGAATACAGAATGG - Intergenic
978145921 4:105371930-105371952 GAGGCCCTTGAAATACAGAAAGG - Intronic
978580669 4:110228522-110228544 CAGTCCCTTGGAAGACAGAATGG + Intergenic
979736495 4:124092236-124092258 CAAACCCCTGGAATTCAGAAGGG + Intergenic
979890496 4:126086252-126086274 TACTCCCGTGTAATTCAGAGGGG + Intergenic
980501469 4:133659898-133659920 GACTCCCATGCCATTCATAAAGG - Intergenic
984065058 4:175037446-175037468 CACTCACTTCAAATTCAGAAAGG + Intergenic
994955802 5:106530427-106530449 GACTCCATTGTATTTCAAAATGG + Intergenic
996986788 5:129576964-129576986 GACTGCCATGGAAGTCAGAGAGG - Intronic
997017926 5:129959047-129959069 TATTCACTTGGGATTCAGAAGGG - Intronic
998281991 5:140819603-140819625 GTCTCCCATGAAATTCAGATTGG + Intronic
999403509 5:151285885-151285907 TTCTCCCCTGGAATCCAGAAAGG + Intronic
999499909 5:152136600-152136622 GACTCTATTGGAGTTCAGAGAGG + Intergenic
1000972022 5:167725356-167725378 GATTCCCTTGGTATTCACATAGG - Intronic
1002767535 6:255392-255414 TATTCCCTAGGAATTCAGAATGG - Intergenic
1003760162 6:9170959-9170981 AACTACCTTGTATTTCAGAATGG - Intergenic
1005661155 6:28000997-28001019 CACTCCCTCGGACTTCAGCATGG + Intergenic
1006770752 6:36550580-36550602 GATTCCCTTGGAACAAAGAACGG - Intergenic
1006918381 6:37611028-37611050 GACTCCCTTGCAGTTCAGTTGGG - Intergenic
1009637866 6:66289596-66289618 GAATCCCTTGAAAAACAGAAAGG - Intergenic
1012488608 6:99751763-99751785 TATTCCCTTTGAATACAGAAAGG - Intergenic
1014205627 6:118651991-118652013 GCCTCCCTTGGAATTAGGATTGG + Intronic
1015079943 6:129211530-129211552 AACTCCCTTGCAGCTCAGAAGGG + Intronic
1016581545 6:145633882-145633904 GCCAGCCTTGAAATTCAGAATGG + Intronic
1017131685 6:151113349-151113371 AACTTCCATGGAATGCAGAATGG + Intergenic
1018809985 6:167292201-167292223 GAATTCCCTGGAATTCAGACTGG - Intronic
1021434617 7:20600178-20600200 TACTCACTTAGAATTTAGAATGG - Intergenic
1023298358 7:38740408-38740430 CACGCCCTAGGAATCCAGAAAGG - Intronic
1033632819 7:143177238-143177260 GTCTTGCTTGGTATTCAGAAGGG - Intergenic
1033789166 7:144770588-144770610 GTCTCCCCTGGAAGTCAGTATGG + Intronic
1035071205 7:156146294-156146316 GACGACCTTGGAAATGAGAAGGG + Intergenic
1035871758 8:3142608-3142630 GACTTCCTTGAAATTCAAAATGG - Exonic
1035943246 8:3928742-3928764 GACCACCTTTGATTTCAGAATGG - Intronic
1039202627 8:35113247-35113269 GATTCCCTTGGAATTTGCAAGGG - Intergenic
1043645926 8:82518492-82518514 GAATCCCTTGCAATCCAGATAGG + Intergenic
1045369003 8:101502456-101502478 GGATCACATGGAATTCAGAAGGG + Intronic
1046397247 8:113656559-113656581 GACATCCCTGTAATTCAGAACGG - Intergenic
1046875406 8:119249336-119249358 GCCTCCTTTGGAGATCAGAATGG + Intergenic
1050742935 9:8843149-8843171 GACTCCCTGGGAAATCTGAGAGG + Intronic
1051266256 9:15311890-15311912 GACTCCTTTGCAATTAGGAATGG + Intergenic
1051532863 9:18124760-18124782 GACTCCTTTGCAATTCAAAAGGG + Intergenic
1060118936 9:120969746-120969768 GGGCCCCTTGGAATACAGAAAGG + Intronic
1060447983 9:123709422-123709444 GACTCAAGGGGAATTCAGAATGG - Intronic
1061467658 9:130794907-130794929 GACTCACTTGGCTTTCAAAAGGG + Intronic
1061900915 9:133671534-133671556 GACTCCCTGAGCATTGAGAAAGG - Exonic
1186380833 X:9057094-9057116 GACTCCTTTGGAATGGAGTATGG - Intronic
1186553295 X:10529890-10529912 TACTACATTGGATTTCAGAAGGG - Intronic
1186559077 X:10591413-10591435 GAGTCACTTGGAATTTGGAATGG - Intronic
1187207631 X:17198050-17198072 CACTCCCTTGGACTTCAGCATGG + Intergenic
1188682390 X:33026853-33026875 CACTCTCTTGGAAATGAGAAAGG - Intronic
1194754996 X:97728460-97728482 TACTCTGTTGAAATTCAGAAGGG + Intergenic
1197868957 X:131047509-131047531 AACTCCTTTGGAGATCAGAAGGG + Intergenic
1198793056 X:140366639-140366661 GACTCCATTGCAATTCAGTGAGG + Intergenic