ID: 955265259

View in Genome Browser
Species Human (GRCh38)
Location 3:57436815-57436837
Sequence CTGGGGGGCCAGGGGGCGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1634
Summary {0: 1, 1: 0, 2: 10, 3: 156, 4: 1467}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955265243_955265259 26 Left 955265243 3:57436766-57436788 CCCTTGTTGGACATGTAGTATGA 0: 1
1: 0
2: 6
3: 76
4: 651
Right 955265259 3:57436815-57436837 CTGGGGGGCCAGGGGGCGGGCGG 0: 1
1: 0
2: 10
3: 156
4: 1467
955265242_955265259 30 Left 955265242 3:57436762-57436784 CCAACCCTTGTTGGACATGTAGT 0: 1
1: 0
2: 1
3: 12
4: 123
Right 955265259 3:57436815-57436837 CTGGGGGGCCAGGGGGCGGGCGG 0: 1
1: 0
2: 10
3: 156
4: 1467
955265244_955265259 25 Left 955265244 3:57436767-57436789 CCTTGTTGGACATGTAGTATGAG 0: 1
1: 1
2: 5
3: 39
4: 197
Right 955265259 3:57436815-57436837 CTGGGGGGCCAGGGGGCGGGCGG 0: 1
1: 0
2: 10
3: 156
4: 1467
955265246_955265259 -5 Left 955265246 3:57436797-57436819 CCTTTGCCTTTTAAGCCACTGGG 0: 1
1: 0
2: 0
3: 18
4: 266
Right 955265259 3:57436815-57436837 CTGGGGGGCCAGGGGGCGGGCGG 0: 1
1: 0
2: 10
3: 156
4: 1467

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955265259 Original CRISPR CTGGGGGGCCAGGGGGCGGG CGG Intronic
900106642 1:984242-984264 CTGGGGGGCAAGTCGGGGGGCGG + Intergenic
900108355 1:995693-995715 CTGGGGCTCCAGGGGGCCGTGGG + Intergenic
900125032 1:1065164-1065186 CTGCGGGGCCCTGGGGGGGGTGG + Intergenic
900146767 1:1162032-1162054 CTGGGGGACCAGGGGTCTGGGGG - Intergenic
900158394 1:1212530-1212552 CTGGGGGGGCAGGTGGGGTGGGG - Intronic
900163711 1:1236451-1236473 CTGGGGAGCCTGGGGCCGGTGGG - Intergenic
900183773 1:1323920-1323942 CTGGGGGGCTGAGGGGCTGGGGG + Intronic
900183819 1:1324040-1324062 CTGGGGGGCTGGGGGGCTGAGGG + Intronic
900183854 1:1324128-1324150 CTGAGGGGCTGGGGGGCTGGGGG + Intronic
900183857 1:1324136-1324158 CTGGGGGGCTGGGGGGCTGAGGG + Intronic
900183862 1:1324144-1324166 CTGGGGGGCTGAGGGGCTGGGGG + Intronic
900227243 1:1539203-1539225 CTGGGGGGGCAGCGGGGAGGTGG - Intronic
900308581 1:2022759-2022781 CTGGGGGTCCCGTGGGCGCGGGG + Intronic
900326485 1:2110863-2110885 CTGTGGGGCCAGGGTGGGGCTGG + Intronic
900353401 1:2247995-2248017 CGGGGGGGCGCGGTGGCGGGGGG + Intronic
900395107 1:2450282-2450304 CTGGAGGCCCACGGGGAGGGAGG - Intronic
900457652 1:2785340-2785362 TTGGGGGGCCAGGTGTCTGGAGG - Intronic
900459960 1:2798247-2798269 CTGGGGGGCCGGGGAGCTGAGGG - Intronic
900464862 1:2820678-2820700 CCAGGGGGCCAGGGGGCCAGGGG + Intergenic
900513331 1:3070303-3070325 GTGGCGGGCGAGGGCGCGGGTGG - Intronic
900521235 1:3106404-3106426 CTGGGGCCCGAGGGGGCTGGAGG + Intronic
900566681 1:3335795-3335817 CTGGGGTGCCAGGGGAGGTGTGG - Intronic
900599997 1:3498858-3498880 CTGTGGGGCCAGCTGGCTGGGGG - Intronic
900607723 1:3531249-3531271 CTGGTAGGCCGGCGGGCGGGAGG + Intronic
900644330 1:3702241-3702263 CAGGCAGGCCAGGGGGCAGGCGG + Intronic
900807963 1:4780304-4780326 ATTGGGGGCCAGGGGATGGGGGG - Intronic
900824233 1:4913486-4913508 CTGGGGGCCCAGGGTGGGGAAGG - Intergenic
900970854 1:5991913-5991935 CAGAGAGGCCAGGGGGCAGGGGG + Intronic
901063810 1:6485607-6485629 CTGGGTGGCGAGGGCCCGGGCGG - Intronic
901091512 1:6644771-6644793 CTGGGGGTCGAGGAGGCTGGAGG - Intronic
901109819 1:6785598-6785620 CTGGGGGGCGGCGCGGCGGGCGG + Intronic
901109916 1:6785815-6785837 CTGGGGCCGGAGGGGGCGGGGGG + Intronic
901241776 1:7698480-7698502 CTGGGGGGCAAGGGGGGGTGCGG + Intronic
901473279 1:9472436-9472458 CGGGGGGGACAGGGGACAGGGGG - Intergenic
901651099 1:10743663-10743685 ATGGGGGGGCGGGGTGCGGGGGG + Intronic
901659857 1:10792328-10792350 GTGCGGGGCCGGGGGGGGGGGGG - Intronic
902177460 1:14661654-14661676 TTGGGGGACGGGGGGGCGGGAGG + Intronic
902205531 1:14865625-14865647 CTGGAGAGCAAGGGGGAGGGTGG - Intronic
902385539 1:16073527-16073549 CTGCGGAGCCAGAGGACGGGCGG + Exonic
902512795 1:16975343-16975365 CTGCGGGGACAGGGCACGGGAGG + Intronic
902515974 1:16989855-16989877 CAGGGCGGCCAGGGAGCTGGGGG + Intronic
902629048 1:17694002-17694024 CTGGGAGTGCAGGGGGCAGGAGG - Intronic
902668350 1:17954714-17954736 CTGGGGGCACAGGGGTCGGGGGG - Intergenic
902715742 1:18271614-18271636 CTGGGGTGCCTAGGGGAGGGAGG - Intronic
902795792 1:18799754-18799776 CCGGGGTGCCAGGGGCTGGGAGG + Intergenic
902816516 1:18919413-18919435 CAGGGGAGCCCGGGGGAGGGCGG + Intronic
902872361 1:19322211-19322233 CTGATGGGGCCGGGGGCGGGAGG + Intronic
903078126 1:20787368-20787390 GTGGGGTGCGAGGGGGCGCGCGG + Intergenic
903247738 1:22028540-22028562 GTGGGGGGCGGCGGGGCGGGAGG - Intergenic
903389274 1:22953002-22953024 CTGGGAGGCCAGGGACAGGGGGG + Intergenic
903468453 1:23568412-23568434 CGGCGGGGCCAGGCGCCGGGAGG + Intergenic
903594279 1:24482297-24482319 GTGGGGGGCCAGGATGGGGGTGG - Intergenic
903609475 1:24599829-24599851 TTGGGAGGCCAAGGGGGGGGGGG - Intronic
903846194 1:26280940-26280962 CTGGGGGACGGGGGGGTGGGGGG + Intronic
904036585 1:27562239-27562261 CTCGGGGGTCAGGAGGCGGGAGG - Intronic
904311524 1:29632628-29632650 CTGAGGGGCCGGGAGGCTGGGGG - Intergenic
904311538 1:29632661-29632683 CTGAGGGGCCAGGAGGCTGGGGG - Intergenic
904311589 1:29632797-29632819 CTGGGGGACTGGGGGGCTGGAGG - Intergenic
904505805 1:30952674-30952696 CGGGGGGGGCGGGGGGGGGGCGG + Intronic
904840198 1:33367682-33367704 CTGGGCGGGCAGGGGTGGGGAGG + Intronic
904842053 1:33379288-33379310 GTGGGGGGGCAGGGGGGCGGTGG - Intronic
904842086 1:33379340-33379362 TGGGGGGGGCAGGGGGCGGTGGG - Intronic
905001183 1:34671327-34671349 CTGTGGGGCCAGGGGGTTGGGGG - Intergenic
905031396 1:34886286-34886308 CTGGGGGGCAGGGGGTCGGGAGG + Intronic
905033158 1:34900945-34900967 GTGGGGGATGAGGGGGCGGGAGG + Intronic
905371783 1:37486360-37486382 TTGGGGGGCCTGTGGGGGGGTGG - Intergenic
905462452 1:38130578-38130600 TTGGGGGGAAAGGGGGAGGGAGG - Intergenic
905774824 1:40661833-40661855 CTGGGGAGCCAGAGGGCAAGAGG - Intronic
905863759 1:41366132-41366154 CTGGGGGGAGAGGAAGCGGGTGG - Intronic
905864369 1:41368657-41368679 GAGGGGGGCCAGGTGGCGTGTGG + Intronic
906078620 1:43069298-43069320 CTGGGAGGCCAGGGTGAGGCTGG - Intergenic
906125051 1:43422656-43422678 CGGGGGGGTGGGGGGGCGGGGGG - Intronic
906143511 1:43547092-43547114 CCTGGGGGCCTGGGGGTGGGAGG - Intronic
906147594 1:43569225-43569247 CTGGGGCTGCAGGGGGTGGGGGG - Intronic
906808235 1:48800995-48801017 CTGTGGGGCATGGGGGAGGGTGG + Intronic
907010647 1:50959923-50959945 CTGGCGGGCGAGCCGGCGGGCGG + Exonic
907165413 1:52406231-52406253 CTGGGAGGCCCGGGGGGGGAGGG - Intronic
907406242 1:54255150-54255172 CGGGGGGGCGGGGGGGGGGGTGG + Intronic
908131800 1:61082206-61082228 CGGGGGGGCCGGGGAGCGAGCGG + Intronic
908131938 1:61082845-61082867 CTTGGGGGCCGGGGCGCCGGGGG + Intronic
908268020 1:62397344-62397366 CTTGGGGGCCAGGAGGAAGGAGG + Intergenic
908355386 1:63322312-63322334 CCTGGGGCCCAGGGAGCGGGTGG - Intergenic
909169982 1:72282754-72282776 GTGTGGTGCCAGGGGGAGGGAGG - Intergenic
909330092 1:74399566-74399588 GGGTGGGGCCGGGGGGCGGGCGG + Intronic
909432167 1:75601379-75601401 CTGGGGGGCTGGGGGGCTAGAGG + Intronic
909443227 1:75720859-75720881 CTGGGGGGGTAGGCGGGGGGAGG + Intergenic
910515334 1:88054191-88054213 CTGGGGAGGCAGGGAGGGGGTGG - Intergenic
911995232 1:104758100-104758122 GTGGGGAGGCAGGGGGTGGGGGG + Intergenic
912014667 1:105017802-105017824 GGCGGGGGCCAGGGGGCGGTTGG + Intergenic
912340816 1:108912900-108912922 TGGGGGGGACACGGGGCGGGGGG + Intronic
912492719 1:110070737-110070759 CGCGGGGGGCGGGGGGCGGGGGG + Intronic
912713236 1:111964417-111964439 CTGTGGGGGCCGGGGGAGGGAGG - Intronic
913250408 1:116908696-116908718 TTGGGGGGGCAGGGGGAGGCGGG - Intergenic
913518990 1:119628057-119628079 TTGGCGGGGCGGGGGGCGGGGGG + Intronic
913528087 1:119712679-119712701 TGGGGGGGTCGGGGGGCGGGGGG + Intronic
913534204 1:119755623-119755645 GTGAGAGGCCAGGGGACGGGAGG + Intronic
914081128 1:144412462-144412484 CTAGGAGGGCTGGGGGCGGGGGG + Intergenic
914728516 1:150349880-150349902 TTTGGGGGCGGGGGGGCGGGGGG + Intronic
915165618 1:153946355-153946377 CTGGCGGGCCGGCGGGCGGCGGG + Exonic
915213297 1:154325490-154325512 GGCGGGGGCCGGGGGGCGGGAGG - Intergenic
915267118 1:154726847-154726869 CAGGGGAGCCCGGGGGAGGGTGG + Intronic
915309602 1:155000649-155000671 GGCGGGGGGCAGGGGGCGGGGGG - Intergenic
915345568 1:155195263-155195285 CGGGGAGGCCGGGGGGCCGGGGG - Intergenic
915364184 1:155304960-155304982 CTGTGGGGCCAGGAGGCTGACGG + Intergenic
915463363 1:156082282-156082304 CGGGGGTGACGGGGGGCGGGGGG + Intergenic
915530687 1:156500659-156500681 CGCGGGGGCCAGCAGGCGGGCGG + Exonic
915535116 1:156530776-156530798 GTGGGGGGCCAGGGGCAGGTTGG - Intronic
916459509 1:165008863-165008885 GTGGAAGGCCAGGGTGCGGGAGG - Intergenic
916717903 1:167460733-167460755 TCGGGGGGTCAGGGGGCTGGAGG - Intronic
917098325 1:171422116-171422138 CTGGGGGGGGAGGGGAGGGGCGG - Intergenic
917414147 1:174790779-174790801 GTGTGTGGGCAGGGGGCGGGGGG + Intronic
917689009 1:177448390-177448412 CTGGGAGGCTAGGGGGAGGAAGG + Intergenic
918038446 1:180897470-180897492 CTGGGGGGCCAGTGGGCTCAGGG - Intergenic
918215700 1:182390999-182391021 TTGGGGGGTCCGGGGGAGGGTGG + Intronic
918320793 1:183362422-183362444 CTGCAGGGCCAGGGGGCGGTGGG - Intronic
919471912 1:197989245-197989267 CTGGGGGACCATGGGGGTGGAGG + Intergenic
919653059 1:200169381-200169403 CTGCTGAGCCAGGGGGCTGGGGG - Intronic
919687181 1:200494886-200494908 CTGGGTGGCCTGGGGGCTGTGGG - Intergenic
919849828 1:201665162-201665184 ATGGTGGGGCAGGGTGCGGGGGG - Intronic
920074155 1:203324907-203324929 GTGGGCTGCCAGGGAGCGGGAGG - Intergenic
920251433 1:204624772-204624794 CTGAGGGTCCAGAGGGAGGGTGG + Intronic
920284332 1:204868779-204868801 CTGGGTGGCCTGGGGGTTGGAGG - Intronic
920331518 1:205211586-205211608 CTGGGGGGCGGGGAGGAGGGAGG - Intergenic
920366300 1:205450004-205450026 GTGGGCGGGCAGGGGGAGGGAGG - Intronic
920878731 1:209860940-209860962 ATGGGGAGCCAGGGGGCTGTTGG - Intergenic
921167385 1:212516908-212516930 CTGGGTGGGTTGGGGGCGGGGGG - Intergenic
921218459 1:212956321-212956343 CTTGAGGGCTAGGGGGCAGGAGG - Intronic
921487565 1:215733196-215733218 GCGGGGGGGCGGGGGGCGGGTGG + Intronic
922469986 1:225870448-225870470 GTAGGGAGCCAGGAGGCGGGGGG - Intronic
922604919 1:226883959-226883981 CTGAGTTGCCAGGGGGTGGGGGG + Intronic
922766078 1:228157320-228157342 CTTGGGGGCTAGGGAGCTGGAGG + Intronic
922794803 1:228334747-228334769 ATCCGGGGCCAGGAGGCGGGCGG + Intronic
922831489 1:228556618-228556640 CGGGGGGGCAAGAGGGCGTGGGG + Intergenic
922831967 1:228608572-228608594 CGGGGGGGCAAGAGGGCGTGGGG + Intergenic
922832528 1:228610813-228610835 CGGGGGGGCAAGAGGGCGTGGGG + Intergenic
922833088 1:228613054-228613076 CGGGGGGGCAAGAGGGCGTGGGG + Intergenic
922833649 1:228615295-228615317 CGGGGGGGCAAGAGGGCGTGGGG + Intergenic
922834208 1:228617536-228617558 CGGGGGGGCAAGAGGGCGTGGGG + Intergenic
922834766 1:228619777-228619799 CGGGGGGGCAAGAGGGCGTGGGG + Intergenic
922835317 1:228621992-228622014 CGGGGGGGCAAGAGGGCGTGGGG + Intergenic
922835876 1:228624212-228624234 CGGGGGGGCAAGAGGGCGTGGGG + Intergenic
922836435 1:228626454-228626476 CGGGGGGGCAAGAGGGCGTGGGG + Intergenic
922836993 1:228628693-228628715 CGGGGGGGCAAGAGGGCGTGGGG + Intergenic
922837552 1:228630935-228630957 CGGGGGGGCAAGAGGGCGTGGGG + Intergenic
922838111 1:228633176-228633198 CGGGGGGGCAAGAGGGCGTGGGG + Intergenic
922838670 1:228635415-228635437 CCGGGGGGCAAGAGGGCGTGGGG + Intergenic
922839229 1:228637641-228637663 CGGGGGGGCAAGAGGGCGTGGGG + Intergenic
922839787 1:228639882-228639904 CGGGGGGGCAAGAGGGCGTGGGG + Intergenic
922840350 1:228642113-228642135 CGGGGGGGCAAGAGGGCGTGGGG + Intergenic
922840910 1:228644354-228644376 CGGGGGGGCAAGAGGGCGTGGGG + Intergenic
922841473 1:228646585-228646607 CGGGGGGGCAAGAGGGCGTGGGG + Intergenic
922851317 1:228735840-228735862 CTGGGGAGCCGGGGGGCCGGGGG + Exonic
923401571 1:233619916-233619938 GAGGGGGGCGGGGGGGCGGGGGG + Intronic
923401576 1:233619924-233619946 CGGGGGGGCGGGGGGGCAGGGGG + Intronic
923460507 1:234205896-234205918 CTGGGGGTGCAGGGGGTGGTGGG + Intronic
923506522 1:234609928-234609950 CCGGGGGGGCAGGGGGCGGGGGG + Intergenic
924551688 1:245084060-245084082 CCGGGGCGCCGGGGGGGGGGCGG - Intronic
924741647 1:246797591-246797613 CTGGCGGGGAGGGGGGCGGGGGG - Intergenic
1062872904 10:922071-922093 CGGAGGGGTCAGGGGGTGGGGGG + Intronic
1062890692 10:1057241-1057263 CAGAGGGACCAGGGTGCGGGAGG + Intronic
1063366974 10:5496827-5496849 CTGGGGGGCCAGGGGTAGCCCGG - Intergenic
1063450213 10:6145624-6145646 CCCGGGGGTCAGAGGGCGGGAGG - Intronic
1063614449 10:7589926-7589948 CTGAAGGGCCAGCGGGCGGGGGG - Intronic
1064133762 10:12732673-12732695 TGGGAGGGACAGGGGGCGGGGGG - Intronic
1064279013 10:13933835-13933857 CTAGGGGAGCAGGGGGCAGGTGG + Intronic
1064948406 10:20818301-20818323 GTGGGGGGGCTGGGGGTGGGAGG + Intronic
1065099672 10:22321049-22321071 CGGCGGGGGGAGGGGGCGGGCGG + Intronic
1066022664 10:31319170-31319192 GTGGGGGGGAAGGGGGAGGGAGG + Exonic
1066107358 10:32167563-32167585 CTGGTTGGCCTGGGGGCAGGAGG - Intergenic
1066310548 10:34191671-34191693 CTGGGAGCCTAGGGGGAGGGAGG + Intronic
1067318700 10:45198007-45198029 CTGGGAGGCCTGGGGACGAGGGG - Intergenic
1067449866 10:46375674-46375696 CCCGGGGGCGAGGGGGCGGCAGG + Exonic
1067495465 10:46756955-46756977 CTGGGCGGCAAGGGGGCAGGGGG + Intergenic
1067599188 10:47583433-47583455 CTGGGCGGCAAGGGGGCAGGGGG - Intergenic
1067634439 10:47991856-47991878 CCCGGGGGCGAGGGGGCGGCAGG - Intergenic
1067693564 10:48519793-48519815 CTGGGGAGCCTGGGAGGGGGAGG + Intronic
1067830847 10:49610352-49610374 CGGGCGGGCAAGCGGGCGGGCGG + Exonic
1067850654 10:49751793-49751815 CTGGAGGGCCAAGTGGCTGGAGG - Intronic
1067948849 10:50710018-50710040 CTGGGCGGCAAGGGGGCAGGGGG - Intergenic
1068595169 10:58895571-58895593 CGGGGGGGGGGGGGGGCGGGGGG - Intergenic
1069034077 10:63630043-63630065 CCGGGAGCCCAGGGGGCTGGAGG + Intergenic
1069248589 10:66241627-66241649 GTGGGGGGGCTGGGGGTGGGGGG - Intronic
1069486525 10:68827446-68827468 CTGGCGGGCCGGGGGTGGGGCGG - Intergenic
1069623667 10:69853276-69853298 CTGGGGTGCCAGGTGGGGGATGG - Intronic
1069751559 10:70748446-70748468 CTGGGTGGGCAGGAGGCGAGGGG + Intronic
1069883848 10:71611061-71611083 ATGGGGGGCTGGGGGGCTGGGGG - Intronic
1069957389 10:72060457-72060479 CTGGGGGGCCTGGGGAAGGAAGG - Exonic
1069962718 10:72087914-72087936 CTGGGGGTCCCGGGGCTGGGGGG + Intronic
1070579923 10:77711468-77711490 CTGTGGGGGCAGGGGGCAAGGGG - Intergenic
1070655524 10:78268630-78268652 CTGGGGGGTAAGGGGGTTGGAGG - Intergenic
1070711209 10:78684510-78684532 CTGTGGAGCTAGGGGGTGGGAGG + Intergenic
1070884167 10:79875010-79875032 CTGGGCGGCAAGGGGGCAGGGGG - Intergenic
1071482950 10:86078781-86078803 CTGCAAGGCCAGGGGGCTGGGGG - Intronic
1071521496 10:86334090-86334112 CTAGGGGGCCAGGTGTGGGGAGG - Intronic
1071650721 10:87391310-87391332 CTGGGCGGCAAGGGGGCAGGGGG - Intergenic
1072438300 10:95433021-95433043 GTGGGGGGGGTGGGGGCGGGTGG + Intronic
1072609791 10:97010617-97010639 GTGGGTGGCCAGAGGGAGGGTGG + Intronic
1073249841 10:102114666-102114688 CTGGGGGGCGGGGGGCCGCGGGG + Intronic
1073417226 10:103394740-103394762 GTGGGGGGGCGGGGGGCGGGGGG - Intronic
1074115719 10:110456441-110456463 CTGGGGGGGCAGGTGGTGGTGGG - Intergenic
1074477615 10:113786950-113786972 GTGGGGGGGGGGGGGGCGGGGGG - Intergenic
1074503157 10:114044104-114044126 CTGCGGAGGCCGGGGGCGGGGGG - Exonic
1075709123 10:124521342-124521364 CTGAGGTGCCAGAGGGCTGGGGG - Intronic
1075727551 10:124618260-124618282 CTGGTGGGCCAGGGGCTGGCGGG - Exonic
1076193773 10:128500567-128500589 CTGGGGGGCAGAGGGGCAGGAGG + Intergenic
1076250267 10:128979411-128979433 CTGAGGGGCCAGAGGGGGTGTGG - Intergenic
1076362448 10:129898829-129898851 CAGCGGGGCCTGGGCGCGGGAGG - Intronic
1076692438 10:132230663-132230685 CTGGGGGGGAAGCTGGCGGGGGG + Intronic
1076786842 10:132754163-132754185 CATGGCGGCCAGGTGGCGGGGGG - Intronic
1076838326 10:133032355-133032377 CTGTGGGTGCAGGTGGCGGGAGG + Intergenic
1076843105 10:133056244-133056266 CTGGGGAGCCGGGGGACTGGGGG + Intergenic
1076853526 10:133104480-133104502 CTGGGGGGCCAGCGGGCCCGGGG + Intronic
1076871826 10:133198314-133198336 CTGGGGAGCCAGGGGGCTGAGGG - Intronic
1077048278 11:555599-555621 CTGGAGGACCAGGGGGCGGCCGG + Intronic
1077065537 11:639560-639582 CGGGGGCGCCGGGGCGCGGGCGG - Intronic
1077147251 11:1051800-1051822 GTGGGAGTCCAGGGGGCCGGGGG - Intergenic
1077192300 11:1260518-1260540 CTGGAGGGCCATGGGAGGGGTGG + Intronic
1077235092 11:1478150-1478172 CTGTGGGGCCTGGCGGCGGTGGG - Intronic
1077305022 11:1865076-1865098 CAGGGGGGCAGGGGTGCGGGAGG + Intronic
1077305681 11:1867812-1867834 GTGGGGGGCGACGGGGCAGGGGG - Intronic
1077343799 11:2037355-2037377 CTGGGGGCGGTGGGGGCGGGAGG + Intergenic
1077360858 11:2139567-2139589 CTGGGGCCCCGGGGGGGGGGCGG + Intronic
1077365397 11:2159534-2159556 CTGAGGGGCCAGGGGTGGTGGGG - Intronic
1077500565 11:2908144-2908166 CTGGATGGGCAGGGGGTGGGAGG - Intronic
1077886549 11:6391626-6391648 CTGGGGGGCTAGGGGGTTTGGGG - Exonic
1078599763 11:12719573-12719595 TTGGGGGGAGGGGGGGCGGGGGG + Intronic
1078771764 11:14358629-14358651 GGCCGGGGCCAGGGGGCGGGAGG - Intronic
1078971580 11:16418700-16418722 GAGGGGGGCCAGGGAGAGGGAGG + Intronic
1079064334 11:17276586-17276608 CCGGGGAGCCTGGAGGCGGGCGG - Intronic
1079238506 11:18706307-18706329 GGGGGAGGCCTGGGGGCGGGTGG - Intronic
1079251972 11:18793163-18793185 CTCGGGGGCGGGGGGGTGGGGGG - Intergenic
1080406320 11:31982612-31982634 CTGGTGGGCCGGGGGACAGGAGG + Intronic
1080628666 11:34052753-34052775 CGTGTGGGCCAGGGGGTGGGAGG - Intronic
1080844538 11:36015311-36015333 CAATGGGGGCAGGGGGCGGGGGG - Intronic
1080911567 11:36605267-36605289 GTGGGGGGGCAGGGGGGAGGTGG - Intronic
1081625587 11:44653392-44653414 CTGGGGCGCCAGGGGGTGGGAGG + Intergenic
1081705635 11:45180798-45180820 CGGGGCGGCCACGGGGCAGGGGG + Intronic
1081870400 11:46380467-46380489 CTGTGCGGCCTGGGGGTGGGGGG + Exonic
1081992162 11:47343657-47343679 CTGGGGGAGCAGGGTGCGGGCGG - Intronic
1082784282 11:57308510-57308532 CTTGGAGGCCAGGGAGCTGGGGG - Exonic
1082928897 11:58579190-58579212 TCGGGAGGCGAGGGGGCGGGGGG + Exonic
1083211950 11:61193772-61193794 CTGGGGGGCAAGGCGGCAGCAGG + Intergenic
1083334901 11:61916828-61916850 CTGCGGGGCCGGGGCGGGGGGGG + Intronic
1083448619 11:62727474-62727496 CGGGGGCGCCAGAGGGCGGGAGG - Intergenic
1083651716 11:64208135-64208157 CTGGGCTGCCAGTGGGTGGGGGG + Intronic
1083661289 11:64252687-64252709 CTGGGGGCCCCAGGGGCCGGGGG + Intronic
1083662041 11:64255925-64255947 CTGGAGCGCCAGGGGGCGGAGGG + Intronic
1083663999 11:64265049-64265071 TGGTGGGGCCAGGGGGCCGGCGG - Exonic
1083680342 11:64348841-64348863 CTGGGGGGGCAGGGGGCGCCAGG - Intronic
1083728801 11:64642489-64642511 CCGGTTGGCCCGGGGGCGGGGGG - Intronic
1083945695 11:65921375-65921397 CTGAGGGGCCCGGGGGCGCTGGG - Exonic
1084121260 11:67070399-67070421 CAGGGGGGCGAGGGGGCATGTGG - Intronic
1084146767 11:67269181-67269203 CTGGGGCGGCGGGGGGCGGGGGG - Intronic
1084153549 11:67302183-67302205 CTGGGTGGACCGGGGGCTGGGGG - Exonic
1084270533 11:68027026-68027048 CTCGGGGGCCTGGGAGCTGGGGG - Intronic
1084319173 11:68363983-68364005 CTGGGGGGAGCGGGGGCGCGGGG + Intronic
1084385712 11:68841702-68841724 CTGCGGGGGCCGGGGACGGGCGG - Intronic
1084605793 11:70170920-70170942 CAGTGGGGCCAGGGGGAAGGAGG - Exonic
1084642494 11:70434205-70434227 CTGAGGGAACACGGGGCGGGCGG - Intronic
1084898686 11:72293962-72293984 CTGGGGGGCCCTGGGGAGGGAGG + Intronic
1084946695 11:72642491-72642513 CGGGGCGGGCCGGGGGCGGGCGG - Intronic
1084978113 11:72814346-72814368 CCGTGACGCCAGGGGGCGGGCGG - Exonic
1085047099 11:73359974-73359996 CTGGGGAGCCAGAGGGTGGGAGG + Intronic
1085054114 11:73394166-73394188 CTGCTGGGGCAGGGGGTGGGAGG + Intronic
1085254754 11:75166080-75166102 CTGGGGAGCCAGGTTGGGGGGGG - Intronic
1085327242 11:75615951-75615973 GCGGGGCGGCAGGGGGCGGGGGG + Intronic
1085741531 11:79081749-79081771 CTGGTGGGGCAGGGGCAGGGCGG + Intronic
1086720372 11:90113988-90114010 GTGGGGGGCTGGGGGGCTGGGGG - Intergenic
1086735083 11:90296461-90296483 CTGGGTGGCAGGGGGGTGGGTGG + Intergenic
1086912415 11:92488448-92488470 TTGGGGGGCGGGGGGGGGGGCGG - Intronic
1087047003 11:93850661-93850683 ATGGGGGGGCGGGGGGGGGGGGG + Intergenic
1087297106 11:96389967-96389989 GGGTGGGGCCAGGCGGCGGGAGG + Intronic
1088257164 11:107912689-107912711 CTGGGCGGCCGGCCGGCGGGGGG - Intronic
1088541903 11:110921718-110921740 CTGGGGGGCCGTGGGGAGGGAGG - Intergenic
1088639627 11:111858961-111858983 CTGGGAGGCCAAGGTGTGGGGGG + Intronic
1088676501 11:112198740-112198762 CTAGGGGTCCAGAGGGCTGGAGG + Intronic
1088870449 11:113886193-113886215 CGGGGGGGGCAGGGGGTGGGGGG - Intergenic
1089242984 11:117098014-117098036 GTTGGGGGCCGGGAGGCGGGAGG - Intronic
1089289786 11:117430668-117430690 GGCTGGGGCCAGGGGGCGGGGGG + Intronic
1089498370 11:118919105-118919127 TTGGGGGGTCGGGGGGGGGGGGG - Intronic
1089515745 11:119030476-119030498 GGGGAGGGCCAGGCGGCGGGCGG + Intronic
1089521734 11:119068999-119069021 TTGGGAGGCCGGGGGGGGGGGGG - Intronic
1089624433 11:119742343-119742365 CAGGGGTGCGAGGGGGCGTGGGG + Intergenic
1089825512 11:121272474-121272496 CTGGGAGGCCAAGCGGGGGGAGG + Intergenic
1090435772 11:126685223-126685245 CTGGGGAGTCAGGGGCAGGGCGG + Intronic
1090473506 11:127000394-127000416 CTGGGTTGTCAGGGCGCGGGAGG - Intronic
1091251578 11:134148429-134148451 CTGAGGGGGCAGGGGGCAAGTGG + Intronic
1091271195 11:134313046-134313068 CTGAGGGGCCAGGGCCTGGGAGG - Intronic
1202826785 11_KI270721v1_random:92544-92566 CTGGGGGCGGTGGGGGCGGGAGG + Intergenic
1091402460 12:189218-189240 CTAGGGGCCCCGGGGGAGGGCGG + Intergenic
1091794909 12:3292521-3292543 CTGGGGGTCCAGGTGGCAGTAGG + Intergenic
1092244014 12:6852906-6852928 CTGGGGGGCGGGGGGAAGGGTGG - Intronic
1092743045 12:11649019-11649041 CTGGGGGACCGTCGGGCGGGGGG - Intergenic
1093662646 12:21774824-21774846 CTGGGGGGGCGGGGGCGGGGGGG + Intronic
1094218900 12:27972912-27972934 CTGGGGGGACGGGGGGGGGAGGG - Intergenic
1094680925 12:32666397-32666419 AGGGGGGACCAGGGGGCGTGGGG + Intergenic
1094680930 12:32666405-32666427 CCAGGGGGCGTGGGGGCGGGAGG + Intergenic
1095206209 12:39443058-39443080 CTGGGGCGTCTGCGGGCGGGCGG + Intronic
1095363186 12:41368814-41368836 CTGGGGAGCCAAGGGGATGGTGG + Intronic
1095385574 12:41646045-41646067 GTGGGGGGCCAGGGTGAGGGAGG - Intergenic
1095930940 12:47624449-47624471 CTTGGTGGGCTGGGGGCGGGGGG + Intergenic
1095953785 12:47795450-47795472 GTGGGGGGCCAGGGTGCAGCAGG + Intronic
1096104162 12:48986845-48986867 CAGCCGGGCCAGGCGGCGGGAGG - Intergenic
1096257517 12:50072423-50072445 CAGAGGGGCCAGGGGCCTGGGGG + Intronic
1096470749 12:51874060-51874082 GTGGTGGGGCGGGGGGCGGGGGG - Intergenic
1096649105 12:53053218-53053240 GTGGGGGGCCTGGGGGGTGGGGG + Intronic
1096659862 12:53117680-53117702 CTGGGGAGGCAGTGGGAGGGTGG + Intronic
1096777093 12:53970881-53970903 CTGGAGGGCCAGGAGGGGGAAGG + Intergenic
1096843671 12:54393574-54393596 CTGGGGGTGCAGGGAGGGGGAGG - Intergenic
1097003793 12:55900628-55900650 CTGGGGGGACACTCGGCGGGAGG + Intergenic
1097211074 12:57370387-57370409 TTGGGAGGCCCGGGGGGGGGGGG + Intronic
1097319859 12:58213359-58213381 ATGGGGGGGCAGGGGGGTGGAGG - Intergenic
1097719384 12:63003418-63003440 GTAGAGGGCCAGGGGGCGGGTGG + Intergenic
1097747536 12:63316904-63316926 GTGGGGGGGCAGGGGGCGGGGGG + Intergenic
1097876273 12:64647162-64647184 CTGGGGTGCCAGGAGGTGGAGGG - Intronic
1097929730 12:65170184-65170206 GTGGGGGGCCAGGAGGCCGGCGG + Exonic
1098343003 12:69470705-69470727 CTGTGGGTCCATGGGGTGGGCGG + Intronic
1098426116 12:70366683-70366705 CGGGGGCGGGAGGGGGCGGGGGG + Exonic
1099483357 12:83196213-83196235 CTGGTGGGCGGGGGGGGGGGGGG + Intergenic
1099665248 12:85619960-85619982 ATGGTGGGCCGGGGGGCTGGGGG + Intergenic
1099882006 12:88478228-88478250 ATGGGGGGCCAGGGGAGGGAAGG + Intergenic
1100181174 12:92087988-92088010 CTGGGGGGGCAGGGTGGGGCGGG + Intronic
1101124360 12:101615660-101615682 GTGGGGGGGCGGGGGGGGGGCGG - Intronic
1101859835 12:108474190-108474212 CTTGGGGAGCAGGGGCCGGGTGG - Intergenic
1101961749 12:109256090-109256112 CTGGAGGGCCAGGTGGCTGGGGG - Intronic
1102025271 12:109711133-109711155 CTGAGGGGGCAGGGGGCAGAGGG - Intergenic
1102106914 12:110333106-110333128 GCGGGGGGGCAGGGGGCGGGAGG + Intronic
1102205074 12:111084778-111084800 ATGAGGGGCCACGTGGCGGGCGG + Intronic
1102332740 12:112048861-112048883 TTGGGGGGGCGGGGGGCAGGTGG - Intronic
1102466993 12:113135756-113135778 CTGGGCGGGCAGGGGGCGGGAGG + Intronic
1102520635 12:113475852-113475874 CTGGGGGCCCAGGTGGCTGGGGG + Intergenic
1102552115 12:113698864-113698886 GTGGGGGGTCAGGGGGAGGTGGG + Intergenic
1102571664 12:113830567-113830589 CTGCGGGGCGGGGGGGGGGGGGG + Intronic
1102952954 12:117042278-117042300 CTGGGGGGCTGGGGGAGGGGAGG - Intronic
1103075955 12:117982704-117982726 TTGGGAGGCCGGGGGGAGGGTGG + Intergenic
1103400545 12:120640571-120640593 CTGGGCCGCCAGGGAGCCGGGGG + Exonic
1103488168 12:121296659-121296681 CTGGGGGCGCAGAGCGCGGGAGG - Intronic
1103675509 12:122652702-122652724 TTGGGAGGCCAAGGGGTGGGCGG - Intergenic
1103800119 12:123532693-123532715 CTGGGGAGACTGGGGGGGGGGGG + Intronic
1104360554 12:128129139-128129161 GGGGGGGGCGGGGGGGCGGGCGG - Intergenic
1104536341 12:129621381-129621403 CAGTGGGGGCAGGGGGAGGGTGG - Intronic
1104718362 12:131031101-131031123 CCGGGGAGCCAGGGGCTGGGCGG + Intronic
1104877284 12:132044328-132044350 CAGGGGGGCAAGAGGGCAGGAGG - Intronic
1104929257 12:132329484-132329506 CGGGGGCGCCGGGGGGCGGCGGG + Intergenic
1104957995 12:132475262-132475284 CCGGGGAGAGAGGGGGCGGGGGG - Intergenic
1104963355 12:132498456-132498478 GTGGAGGGCTAGGGGCCGGGAGG - Intronic
1104972742 12:132539366-132539388 CTGGGTGGACATGGGGCTGGAGG - Intronic
1104972752 12:132539395-132539417 CTGGGTGGACATGGGGCTGGAGG - Intronic
1104972794 12:132539516-132539538 CTGGGTGGGCACGGGGCTGGAGG - Intronic
1104972825 12:132539603-132539625 CTGGGCGGGCACGGGGCTGGAGG - Intronic
1104972942 12:132539938-132539960 CTGGGTGGGCACGGGGCTGGAGG - Intronic
1104972953 12:132539967-132539989 CTGGGTGGGCACGGGGCTGGAGG - Intronic
1104972984 12:132540054-132540076 CTGGGTGGGCACGGGGCTGGAGG - Intronic
1104972995 12:132540083-132540105 CTGGGTGGGCACGGGGCTGGAGG - Intronic
1104973015 12:132540141-132540163 CTGGGTGGGCATGGGGCTGGAGG - Intronic
1105030573 12:132880413-132880435 TTGGGAGGCCAAGGGGGGGGCGG + Intronic
1105070491 12:133231625-133231647 CAGGGGTGCCAGGTGCCGGGAGG - Exonic
1105223867 13:18409146-18409168 CTGGGGGTCCTGGGGACGAGGGG + Intergenic
1105446502 13:20461974-20461996 CTGGGGGAGGAGGAGGCGGGAGG + Intronic
1105578513 13:21673977-21673999 CACGGGGGCCGGGGGGCGGCAGG + Intronic
1106006440 13:25774406-25774428 TTGGGGAGGCAGGGGGAGGGAGG + Intronic
1106054964 13:26229208-26229230 CTGGGGTGCTAGGGGAGGGGAGG - Intergenic
1106141413 13:27015133-27015155 CTGGGGGGCCTGGGGTAGGAAGG - Intergenic
1106308229 13:28532295-28532317 CAGGGTGGACAGCGGGCGGGTGG - Intergenic
1106776787 13:33016721-33016743 CGGGGGTGCCAGGGGGTGGTGGG - Exonic
1107132523 13:36911614-36911636 CTGGGGGGGGGGGGGGCGGGTGG + Intronic
1107851682 13:44577480-44577502 CTGGCGGGGCAGGAGGCGGCGGG + Intergenic
1109649791 13:65310528-65310550 CTCGGGGACGGGGGGGCGGGCGG - Intergenic
1110296973 13:73878846-73878868 CTGGGAGGCCAGGGGAGGTGTGG + Intronic
1110318513 13:74135309-74135331 CCGCGGGGCCCGGGGGCGGCGGG + Intergenic
1111199960 13:84922605-84922627 CGGGGGGGCCGGGGCGGGGGCGG - Intergenic
1111482060 13:88842522-88842544 CTAGGGGTTCAGGGGGAGGGAGG + Intergenic
1111920956 13:94410755-94410777 TTGGGAGGCCCGGGGGTGGGGGG + Intergenic
1111927388 13:94478151-94478173 CTGGGGGTGGGGGGGGCGGGCGG - Intronic
1111963826 13:94840370-94840392 CTGTGGGGTCAGGGGGCACGGGG + Intergenic
1112092676 13:96098577-96098599 CTGGGAGGCCAGGGGTAGGTGGG + Intronic
1112443624 13:99444090-99444112 CTGGGGGTGATGGGGGCGGGTGG - Intergenic
1112515601 13:100050497-100050519 CTGGGGGGTGGGGGGGCGGCAGG - Intergenic
1112566186 13:100552965-100552987 CAGGCAGGCCAGGTGGCGGGTGG + Intronic
1112639789 13:101260005-101260027 CTGGGGGGACGGGGGGAGGCAGG - Intronic
1113335412 13:109372227-109372249 CTGGGGGTCCTGGGGTGGGGTGG - Intergenic
1113548522 13:111173793-111173815 TTGGGAGGTCAGGGGGTGGGTGG + Intronic
1113614217 13:111669604-111669626 CCGAGGGGGCAGGGGGCAGGGGG - Intronic
1113619685 13:111754518-111754540 CCGAGGGGGCAGGGGGCAGGGGG - Intergenic
1113856072 13:113446125-113446147 CTGGGGGGGAGGGGGGAGGGGGG - Intronic
1113950699 13:114069683-114069705 CTGGGGGGCCAGGAGACTCGGGG + Intronic
1113950868 13:114070104-114070126 CTGGGGGGCCAGGAGACTCGGGG + Intronic
1114008014 14:18333972-18333994 CTGGGGGTCCTGGGGACGAGGGG + Intergenic
1114265745 14:21071582-21071604 CTGGGGAGGGAGGCGGCGGGCGG - Intronic
1114270570 14:21098110-21098132 CTGGGGGGGCGGGGTGGGGGTGG - Intronic
1114323467 14:21566639-21566661 CTGGGAGGCCGCGGGGCGGAGGG + Intergenic
1114516056 14:23301251-23301273 CGTGGGGGCGTGGGGGCGGGGGG - Intronic
1114602707 14:23969525-23969547 CTGGGAGGCAAGGGGCGGGGAGG - Intergenic
1114607075 14:24006654-24006676 CTGGGAGGCAAGGGGCGGGGAGG - Intergenic
1114612390 14:24051618-24051640 CTGGGAGGCGAGGGGCGGGGAGG - Intergenic
1115155641 14:30336204-30336226 CTGGTGGGCCAGGGAGGAGGAGG + Intergenic
1115399332 14:32939453-32939475 CTCGCGGCCCAGGAGGCGGGCGG - Intronic
1115555132 14:34539525-34539547 CTCGGGGGCCAGGGTGGGGCGGG + Intronic
1116149982 14:41128702-41128724 CTGGGGGGCTGGAGGGCTGGGGG - Intergenic
1116177261 14:41488109-41488131 TTGGGAGGACAGGGGGTGGGGGG - Intergenic
1116426578 14:44798881-44798903 GCGGGGGGCGAGGAGGCGGGGGG - Intergenic
1116547776 14:46191852-46191874 CTGGCAGGCCTGGGGGCAGGTGG + Intergenic
1116605024 14:46981160-46981182 TTGGGAGGCCAAGGGGGGGGCGG + Intronic
1116876121 14:50113786-50113808 CTTGGGGGCGGGGGGGGGGGGGG + Intronic
1116973713 14:51094327-51094349 CTAGGGGCCCCCGGGGCGGGTGG + Exonic
1117016121 14:51519164-51519186 TTGGGGTGGCAGGGGGCGGGGGG - Intronic
1117132040 14:52695924-52695946 CTGCGGGGTTGGGGGGCGGGGGG + Intergenic
1117327275 14:54681173-54681195 TTGGGGGGCTGGGGGGCTGGAGG - Intronic
1117353585 14:54902937-54902959 CTGGGGACCCCGGGGGCGGGAGG - Intergenic
1117391406 14:55266332-55266354 CTGGGGGTGGTGGGGGCGGGAGG - Intergenic
1117427024 14:55610886-55610908 CGGGGCGGGAAGGGGGCGGGTGG - Intronic
1117459378 14:55929895-55929917 ACGGGGGGGCAGGGGGTGGGGGG - Intergenic
1118206062 14:63724695-63724717 CTGGGAGGCCAGTGGTGGGGAGG + Intronic
1118423369 14:65633002-65633024 CTGGGGAGACGGGGGGGGGGAGG - Intronic
1118531505 14:66711735-66711757 GTGGGGGGGTAGGGGGCTGGGGG - Intronic
1118992533 14:70809405-70809427 CGGGGGGGCGAGCGGGCAGGCGG - Exonic
1119182552 14:72614495-72614517 CTTGGGGGACAGGGGCCTGGGGG + Intergenic
1119237780 14:73034116-73034138 TTGGGAGGCCAAGGGGTGGGGGG - Intergenic
1119704826 14:76776973-76776995 CTGGGAGGCCAGCGGGCGGTAGG + Intronic
1119734570 14:76973774-76973796 CTGGGGGGGCGGGGCGGGGGTGG - Intergenic
1119899537 14:78248296-78248318 GTGGGGGGGGGGGGGGCGGGGGG - Intronic
1120398261 14:83995818-83995840 TGTGGGGGGCAGGGGGCGGGGGG - Intergenic
1120888522 14:89471091-89471113 CTAGTTGGCCAGGAGGCGGGAGG + Intronic
1120902705 14:89589723-89589745 ATTGGGGGCGGGGGGGCGGGGGG + Intronic
1121123843 14:91393328-91393350 CTGGGGGTTTAGGGGGTGGGGGG - Intronic
1121796691 14:96741706-96741728 CTGGGGGGCGAGGGGGGCGAGGG + Intergenic
1121916160 14:97838528-97838550 CCCGGGGGCCTGGGGGTGGGAGG - Intergenic
1122070727 14:99203967-99203989 CTGGGGGACCTGGGGGCTGATGG - Intronic
1122079218 14:99255436-99255458 CAGGGGGGCCAGGGGGTGGAAGG + Intronic
1122108669 14:99480523-99480545 CTCGGGGGCCAGGGCGAGGAGGG - Intronic
1122177507 14:99931937-99931959 GTCGGGGGCCAGGGGCTGGGAGG + Intronic
1122220992 14:100239106-100239128 GCGGGGGGAGAGGGGGCGGGCGG - Exonic
1122328579 14:100897762-100897784 GTGGGGGGGTGGGGGGCGGGGGG + Intergenic
1122371950 14:101233905-101233927 CTGTGGGGCCATGGGGCTGTGGG - Intergenic
1122374926 14:101251265-101251287 CTCAGGGCCCAGGGGGAGGGTGG + Intergenic
1122436740 14:101706038-101706060 GTGGGGTGACAGGGGGCGCGGGG + Intergenic
1122445038 14:101761839-101761861 CTGCGGGGGCAGGCGGCGGCAGG + Exonic
1122577711 14:102752304-102752326 CTAAGGGGCCAGTGGGTGGGAGG + Intergenic
1122697469 14:103562977-103562999 CGCGGGAGCCAGGGGGCGTGGGG + Exonic
1122717727 14:103705624-103705646 CTTGCGGGCCAGGGGAAGGGAGG - Intronic
1122786728 14:104167396-104167418 CTGAGGGGGCTGGGGGCAGGAGG + Intronic
1122811902 14:104293362-104293384 CTGGAGGGCCAGGGGGCTGCAGG + Intergenic
1122916928 14:104863800-104863822 CTGGAGGGCGGGGGGGGGGGGGG - Intergenic
1122921412 14:104881932-104881954 CTGGGGGGCCAGAGGGTCTGGGG - Intronic
1122930846 14:104932509-104932531 CTGTGGGGCCAGGTGACAGGCGG - Intronic
1122937842 14:104968128-104968150 CTGGGGGGCCCGGGGAGTGGGGG - Intronic
1122971402 14:105153715-105153737 CTGGGGGGCCTGGTGGGTGGGGG - Intronic
1123025039 14:105420271-105420293 CTCGGCGGCCCGGGGGTGGGGGG + Intronic
1123038712 14:105481728-105481750 TTGGCGGGGCGGGGGGCGGGGGG + Intergenic
1123112308 14:105878760-105878782 CTGGGGGGCCAGGGGCATGGCGG - Intergenic
1123717016 15:23040526-23040548 CGGAGGTGCCGGGGGGCGGGGGG + Intergenic
1123717973 15:23043724-23043746 CGGAGGTGCCGGGGGGCGGGGGG + Intergenic
1124118198 15:26867142-26867164 CTGGGGGGCTCTGCGGCGGGCGG + Intronic
1124327866 15:28782984-28783006 CCGGAGGCCCAGGAGGCGGGCGG - Intergenic
1124365586 15:29069021-29069043 CTGTGGGGGCTGGGGGCGGAGGG - Intronic
1124394778 15:29291566-29291588 CTGGGGGTCCAGGGTGGGGCAGG - Intronic
1124483689 15:30098357-30098379 GTGGGGGGGGGGGGGGCGGGAGG + Intergenic
1124484723 15:30104029-30104051 CTGGCGGGGCAGGGCGAGGGCGG + Intergenic
1124500759 15:30225171-30225193 GTGCGGGCCCCGGGGGCGGGCGG - Intergenic
1124500874 15:30225506-30225528 CTGGGGGTCCAGGCCGCTGGCGG - Intergenic
1124518858 15:30393209-30393231 CTGGCGGGGCAGGGCGAGGGCGG - Intronic
1124519890 15:30398869-30398891 GTGGGGGGGGGGGGGGCGGGAGG - Intergenic
1124539797 15:30573037-30573059 CTGGCGGGGCAGGGCGAGGGCGG + Intergenic
1124630715 15:31335480-31335502 GTGGCGGGGCAGGGGGCGGGGGG + Intronic
1124742696 15:32313161-32313183 CTGGGGGTCCAGGCCGCTGGCGG + Intergenic
1124742811 15:32313496-32313518 GTGCGGGCCCCGGGGGCGGGCGG + Intergenic
1124758854 15:32434545-32434567 CTGGCGGGGCAGGGCGAGGGCGG - Intergenic
1124759887 15:32440227-32440249 GTGGGGGGGTGGGGGGCGGGAGG - Intergenic
1124940504 15:34213228-34213250 CTGGATGGCCAGGGGTAGGGAGG + Intergenic
1125407265 15:39366097-39366119 GTGGGCGGGGAGGGGGCGGGTGG + Intergenic
1125599150 15:40906260-40906282 CTGGAGGGCCAGAGGGGGGTGGG + Intergenic
1125621747 15:41069229-41069251 CAGGGGGGTGAGGGGGCGAGGGG - Intronic
1125661154 15:41395842-41395864 CTGGGAGGCCAAGGGTGGGGTGG + Intronic
1125750021 15:42021625-42021647 CTGGGAGGCCAGGTGGAGAGAGG + Intronic
1126348201 15:47718226-47718248 CTCTGGGGCCAACGGGCGGGAGG - Intronic
1126500641 15:49340401-49340423 CGGGGGGGGGAGGGGGGGGGCGG - Intronic
1126915070 15:53457289-53457311 CTGGGGGAACAGGGGGCAGGTGG - Intergenic
1127103075 15:55587650-55587672 CTCGGGGGCCAGCGGGCGCCCGG + Intronic
1127236616 15:57059732-57059754 GTGGGGGGCTGGGGGGAGGGTGG + Intronic
1127467056 15:59254430-59254452 TTGGGAAGCCAGGGGGCAGGAGG - Intronic
1127880936 15:63157796-63157818 CGGCCGGGCCAGGGGGCCGGGGG - Exonic
1127964801 15:63915602-63915624 CTGCTGGGCCAGGAGGAGGGTGG - Intronic
1128054771 15:64691464-64691486 CCGGTGGGCGAGGGGGCGGCAGG - Exonic
1128086326 15:64888999-64889021 CCTGGGGGTCAGGGGGTGGGGGG + Intronic
1128093195 15:64932986-64933008 CTGGGTGGCCATTGGGTGGGGGG + Intronic
1128147017 15:65337495-65337517 CTTGGGGCCCTGGGGGTGGGAGG + Intronic
1128155184 15:65387592-65387614 TTGGGAGGCCAAGGTGCGGGCGG - Intronic
1128157784 15:65402523-65402545 CAGGGGGGCCACAGGGAGGGTGG + Intronic
1128301234 15:66567569-66567591 GAGGGAGGCCAGGGGGTGGGTGG + Intergenic
1128570479 15:68729958-68729980 CTGGGGGGGCGGGGGCCGGGAGG - Intergenic
1129208774 15:74053440-74053462 CTGGGGCGGGGGGGGGCGGGGGG - Intergenic
1129273520 15:74431749-74431771 CTGGTGGCCCTGGGGGTGGGGGG + Intronic
1129278011 15:74460240-74460262 CTGGGGGGCCGGGGTGGGGCAGG - Intronic
1129333830 15:74840899-74840921 CTGGGGGGACAGTGAGAGGGTGG - Intronic
1129375276 15:75126360-75126382 CTGGGGTACTAGGGGGCAGGTGG - Intergenic
1129503249 15:76059915-76059937 CGGGGCCGCGAGGGGGCGGGGGG + Exonic
1129644710 15:77419749-77419771 CAGGGGCGGCAGGGGGCGCGCGG + Intronic
1129770652 15:78201343-78201365 CTGGGGGGCAAGGGTGAGGTGGG - Intronic
1129810664 15:78507499-78507521 CTGGGCGGCGAGGGACCGGGAGG + Intergenic
1129829915 15:78661946-78661968 CTGGGGCTTCAGGGGGAGGGAGG - Intronic
1129880227 15:79001485-79001507 TTGGGGTGGCGGGGGGCGGGTGG + Intronic
1130321972 15:82849124-82849146 CTGGGGGGGCGGGGGGCAGGGGG + Exonic
1130656519 15:85795067-85795089 GTGGGGGGCCGGGGGCGGGGAGG + Intergenic
1130908935 15:88257739-88257761 CTGCCGGGTGAGGGGGCGGGCGG + Intergenic
1130949983 15:88578575-88578597 CTTGAGGGCCAGGGAGTGGGAGG + Intergenic
1131070139 15:89460942-89460964 CTGGGGGGCCAAGGGGGTGGGGG - Intergenic
1131262150 15:90893040-90893062 CTGGGGGGCCCTGGGGAGGCGGG + Intronic
1132182635 15:99770663-99770685 TTGGCGGGGCGGGGGGCGGGGGG - Intergenic
1132310326 15:100852898-100852920 GTGGGGGCTCAGGGGGAGGGTGG - Intergenic
1132408822 15:101561525-101561547 CTGGGGGACAAGGGAGCAGGCGG + Intergenic
1132546481 16:535637-535659 CTGGAGGGGCAGGGTGCGGAGGG - Intronic
1132550691 16:552776-552798 GTGGGGGTCCCGGGGGAGGGTGG + Intronic
1132600505 16:770672-770694 CTGGGGGGACGGGGTGAGGGGGG + Intronic
1132600546 16:770764-770786 CTGGGGGGACGGGGTGAGGGGGG + Intronic
1132642793 16:985321-985343 CTGGTGGGGCTGTGGGCGGGCGG - Exonic
1132654325 16:1035557-1035579 CTGGAGGGCCACGGGGAGTGAGG + Intergenic
1132656994 16:1045562-1045584 CTGGGGGCCCAGGGAGCGCCAGG + Intergenic
1132670984 16:1102245-1102267 GTGGGCAGCCAGGGGACGGGAGG + Intergenic
1132726521 16:1341243-1341265 ATGGAGGGCCAGAGGGCGTGGGG + Intronic
1132793511 16:1706767-1706789 CTGGGGGTCCAGGGGTCCCGCGG - Intronic
1132854889 16:2040320-2040342 CTGGAGGGCCACGGGGGTGGTGG - Intronic
1132934528 16:2473969-2473991 CTGGGGGCGCGGGGGGCCGGGGG + Exonic
1133022710 16:2973958-2973980 ATGGGGGGCTAGGGGGAAGGTGG - Intronic
1133036172 16:3035569-3035591 CTGGAGGGCCAGGTGCTGGGCGG - Intronic
1133040787 16:3058952-3058974 TTGGGGGGCCTGGGGGCGCGGGG - Exonic
1133212705 16:4272231-4272253 CTGGGGGCCCGGGGCGCGCGTGG - Intronic
1133246824 16:4454720-4454742 CTGGGTGGCCAGGCGGGGGTAGG + Intronic
1133287736 16:4698360-4698382 GTGGGGGCCCAGGGGCCAGGTGG + Intronic
1133344350 16:5060083-5060105 ATGGGAGGCCAGCGGGCGGCTGG + Intronic
1133406133 16:5526010-5526032 CTGTGGTCCCAGGGGGCGGACGG + Intergenic
1134244938 16:12532946-12532968 CTGCGGACCCAGGGAGCGGGTGG + Intronic
1134608986 16:15592892-15592914 TTGGGGGGGGGGGGGGCGGGGGG - Intronic
1134645090 16:15858756-15858778 CTGGGGGCCGGGGGTGCGGGGGG + Intergenic
1135109427 16:19679133-19679155 CTGGGGGGGCGGGGGTGGGGAGG + Intronic
1135174750 16:20218018-20218040 TTGGGAGGCCAAGGGGGGGGCGG - Intergenic
1135690450 16:24533080-24533102 TTGGGAGGCCAAGGGGTGGGGGG + Intergenic
1136247037 16:28982076-28982098 CTGGGGGGCCTGCGGGTGGCAGG + Intronic
1136251565 16:29008912-29008934 CGAGGGGGCGAGGGGGAGGGAGG - Intergenic
1136280805 16:29210136-29210158 CTGGGGTGGCAGGAGGCAGGTGG - Intergenic
1136402568 16:30026571-30026593 CTGGGCGGGCGGGGTGCGGGTGG - Intronic
1136512676 16:30748690-30748712 CTGGGGCGCCAGGGTCCTGGGGG - Intronic
1136540217 16:30924369-30924391 CGGGGGGGCCGGGCGGCGCGGGG - Intronic
1136577052 16:31131172-31131194 CTGTGGGGAGAAGGGGCGGGAGG - Exonic
1136580927 16:31150252-31150274 CTGGAGGCCCAGGGTGGGGGTGG + Intergenic
1136634008 16:31507977-31507999 CTCGGAGCCCGGGGGGCGGGGGG - Intronic
1136707048 16:32200127-32200149 GCCGGGGGCCAGGGGCCGGGGGG + Intergenic
1136716930 16:32288869-32288891 CTGGGGGACCTGGGGGCTCGTGG + Intergenic
1136760862 16:32729290-32729312 GCCGGGGGCCAGGGGCCGGGGGG - Intergenic
1136807241 16:33141096-33141118 GCCGGGGGCCAGGGGCCGGGGGG + Intergenic
1136835305 16:33495114-33495136 CTGGGGGACCTGGGGGCTCGTGG + Intergenic
1137054040 16:35734959-35734981 CTGGGGAGACTGGGGGCTGGAGG + Intergenic
1137054302 16:35735960-35735982 CTGGGGAGACTGGGGGCTGGAGG + Intergenic
1137056279 16:35748018-35748040 CTAGGGCGCCAGGGGGCTGCCGG - Intergenic
1137056791 16:35749889-35749911 CTGGGGAGACCGGGGGCTGGAGG + Intergenic
1137057129 16:35751147-35751169 CTGGGGGGACCGGTGGCTGGAGG + Intergenic
1137057387 16:35752162-35752184 CTGGGGAGACTGGGGGCTGGAGG + Intergenic
1137485274 16:48885482-48885504 GTGGGGGACCAGGGGGTGGGTGG - Intergenic
1137613708 16:49835174-49835196 CTGGGGGCCCATGGGGTGTGGGG - Intronic
1137692349 16:50437780-50437802 CTGGGGGGCCTGGAAGAGGGAGG - Intergenic
1137723143 16:50639536-50639558 CCGGTGGGGCAGGGGGCAGGTGG - Exonic
1137787580 16:51151336-51151358 CGGGCGGGCCGGCGGGCGGGGGG - Intronic
1137821479 16:51449646-51449668 CTGGGGGGCAGGGGTGGGGGTGG - Intergenic
1137988468 16:53130470-53130492 CGGCGGGGCCGCGGGGCGGGCGG + Intronic
1138229510 16:55326943-55326965 GTTGTGGGGCAGGGGGCGGGGGG + Intronic
1138599521 16:58046434-58046456 CTGGGGGCACAGGGAGCTGGAGG - Exonic
1138704278 16:58898396-58898418 CTGGGAGGCCGGGGGCCAGGGGG - Intergenic
1139528091 16:67528768-67528790 CCGGCGGGCCAGGGGAGGGGCGG + Intronic
1139591872 16:67937507-67937529 CCTGGGGGTCGGGGGGCGGGGGG - Intergenic
1139672217 16:68499641-68499663 CTGTTGGGGCAGGGGGCAGGGGG - Intergenic
1139784999 16:69385721-69385743 CTGGGGGGCCCGGCGGAGCGCGG - Exonic
1139948952 16:70660098-70660120 CTGGGGGACCACGGGGGCGGAGG - Exonic
1139952715 16:70679934-70679956 CGGGCGGGCAGGGGGGCGGGGGG - Intronic
1140219518 16:73033508-73033530 CTGGGGGGAAAGGGGGCAGGCGG + Intronic
1140388096 16:74560454-74560476 CTGCGGGGGCAGGGGGGCGGCGG - Intronic
1140389730 16:74574997-74575019 TTGGGAGGCCGGGGGGGGGGGGG + Intronic
1140580278 16:76223255-76223277 CTGGGGGGTGGGGGGGCAGGGGG + Intergenic
1140879541 16:79185498-79185520 TTGGCTGGCCAGGGGGCAGGAGG - Intronic
1140903907 16:79394413-79394435 CTGGGAGGCCCAGGGGAGGGAGG - Intergenic
1141102192 16:81206040-81206062 TTGGGGGGGGGGGGGGCGGGTGG - Intergenic
1141155380 16:81593370-81593392 CTGGGGGGTTGGAGGGCGGGGGG + Intronic
1141527009 16:84618126-84618148 CTGGGCGGCCAATGGGCGCGGGG - Intergenic
1141636202 16:85315203-85315225 CTGAGGGAGCAGGGGTCGGGGGG + Intergenic
1141643357 16:85354575-85354597 CTGGGGGGCCAGGGTTCTGCTGG - Intergenic
1141682532 16:85553132-85553154 CTGGGGGGCGGGGCGGGGGGCGG - Intergenic
1141694600 16:85613598-85613620 CTGGGAGGCCTGGCTGCGGGCGG + Intronic
1141697625 16:85627666-85627688 CCGGGGGGCCGGGGGGCCGGGGG - Intronic
1141700729 16:85640898-85640920 CCCGGGGGCCAGAGGGCTGGTGG + Intronic
1141847716 16:86622214-86622236 CTGTGGGGCCTGGCGACGGGAGG - Intergenic
1141869491 16:86775085-86775107 CCGGCAGGCCAGGCGGCGGGTGG + Intergenic
1141895138 16:86954354-86954376 CTGGGGAGGCAGTGGGCGTGGGG - Intergenic
1141920912 16:87134729-87134751 CTGGGGGACCAGGGAGCCTGCGG - Intronic
1141923804 16:87153746-87153768 CTGGGGGACCAGGGGTCAGGAGG + Intronic
1141988054 16:87592870-87592892 CTGTGGGGGAAGGGGGAGGGAGG + Intergenic
1141997550 16:87645037-87645059 TAGGAGGGCGAGGGGGCGGGGGG + Intronic
1142104376 16:88294481-88294503 CTGGGAGCCCAGAGGGCAGGAGG - Intergenic
1142153553 16:88523227-88523249 CTGGGGAGCAAGGGGGAAGGGGG - Intronic
1142181834 16:88674935-88674957 CTGGGCGGGCAGGGGCTGGGAGG - Intergenic
1142211036 16:88808559-88808581 CTGGGGGGCCATCGGGAGTGTGG + Exonic
1142246547 16:88972802-88972824 AAGGGGGGACAGGAGGCGGGAGG + Intronic
1142267783 16:89072474-89072496 ATGGGGAGCCAGGGAGAGGGAGG + Intergenic
1142313859 16:89330656-89330678 CTGGGGGGGGGGGGGGGGGGCGG + Intronic
1142359231 16:89618988-89619010 CGGGGGGGGCAGGGGGCTGCAGG - Intronic
1142359259 16:89619049-89619071 CAGGGGGGGCAGGGGGCTGCAGG - Intronic
1142359340 16:89619232-89619254 GTGGGGGGGCAGGGGGCTGCAGG - Intronic
1142359396 16:89619352-89619374 CAGGGGGGGCAGGGGGCTGCAGG - Intronic
1142359411 16:89619383-89619405 CAGGGGGGGCAGGGGGCTGCAGG - Intronic
1142359495 16:89619573-89619595 CAGGGGGACCAGGGGGCTGCAGG - Intronic
1203009498 16_KI270728v1_random:228918-228940 CTGGGGGACCTGGGGGCTCGTGG - Intergenic
1203063014 16_KI270728v1_random:989604-989626 GCCGGGGGCCAGGGGCCGGGGGG - Intergenic
1203145478 16_KI270728v1_random:1795435-1795457 CTGGGGGACCTGGGGGCTCGTGG + Intergenic
1142592535 17:1012618-1012640 CTGGGGGGCCCGGGCTGGGGGGG + Intronic
1142666678 17:1467578-1467600 CTGGGGGGCCAGGCAGGAGGAGG + Intronic
1142742996 17:1941590-1941612 CTCGGGGGCCAGGCGGTGGGGGG + Intronic
1142757411 17:2024384-2024406 CTGGGGAGCTAGGGCGCGCGGGG + Intronic
1142807659 17:2379903-2379925 CTGGGGTGGCAGAGGGCGAGAGG + Exonic
1142809037 17:2386772-2386794 CTAGGAGGCCTGGGGGTGGGTGG + Exonic
1142812289 17:2401003-2401025 CCCGGGGGCCGCGGGGCGGGAGG - Exonic
1142872137 17:2827887-2827909 GTGGGGGCCCAGGGGGAGCGTGG + Intronic
1143026623 17:3945033-3945055 GTGCGGGGCCAGGGGACGCGCGG - Intronic
1143083330 17:4397354-4397376 CATGTGGGGCAGGGGGCGGGAGG + Intergenic
1143099757 17:4498744-4498766 GTGGGGGGCCCGGGGACTGGGGG - Intergenic
1143106101 17:4531330-4531352 CTGGGGGCCCCGAGGGCGGCGGG - Intronic
1143503913 17:7353484-7353506 CTGGGGGGCCAGGAGAGCGGCGG + Exonic
1143558310 17:7676317-7676339 CTGGAGGGCTGGGGGGCTGGGGG - Intronic
1143564010 17:7710571-7710593 CTGGGGGATCAGGAGGTGGGAGG + Exonic
1143636093 17:8164376-8164398 CTGGGAAGCCAGGGTGGGGGAGG - Intergenic
1143661367 17:8326649-8326671 CTTGGGGGCCGGGGCGTGGGGGG - Intergenic
1143705936 17:8697700-8697722 CTGGGGGAGCAGGGAGCTGGGGG + Intergenic
1143818186 17:9536987-9537009 TTGGGAGGCCAGGGCGGGGGTGG - Intronic
1143956797 17:10676452-10676474 CTGGGGTGGCAGTGGGTGGGGGG + Exonic
1144021082 17:11240788-11240810 CTGCGGGGCCGGGCGGCTGGGGG + Intergenic
1144068171 17:11642401-11642423 TGGTGGGGGCAGGGGGCGGGGGG + Intronic
1144425042 17:15133660-15133682 GTGGGGGGCCAGGGGTGTGGGGG - Intergenic
1144703407 17:17352680-17352702 CTGGGTGGTCACGGGGCGGGGGG + Intergenic
1144728872 17:17515361-17515383 ATCCGGGGCCAGGGAGCGGGTGG + Intronic
1144756002 17:17681244-17681266 CAGGCCGGCCAGCGGGCGGGGGG + Intergenic
1144765480 17:17730354-17730376 CTGCGGGGCCTAGGGGTGGGTGG - Intronic
1144787654 17:17840765-17840787 CAGGGGGGCAGGGGGGCAGGGGG - Intergenic
1144837083 17:18162178-18162200 CTGGGAGGCCTGGGTGAGGGAGG + Intronic
1144998477 17:19287235-19287257 TTGGGGGAACAGGGGGCAGGTGG - Intronic
1145013407 17:19382282-19382304 CTGGGCAGCCAGGAGGCTGGTGG - Exonic
1145754479 17:27380748-27380770 GTGGGGAGCCAGGGGGATGGCGG + Intergenic
1145770561 17:27489816-27489838 ATGGGGGCCCAGGGGTTGGGAGG + Intronic
1145808012 17:27748351-27748373 CTGGGGGACCCGGGGGTGAGAGG - Intergenic
1145875279 17:28314686-28314708 CTGGAGGGCAATGGGGCCGGAGG - Intergenic
1145902739 17:28498818-28498840 CTGGGGGACCAGGGTGGGGCTGG - Intronic
1145903918 17:28506159-28506181 TTGGGGGGCCAGGGTGCGGCTGG + Intronic
1145978616 17:28998412-28998434 CTGGGGACCCAGGGGTAGGGAGG + Intronic
1146256629 17:31394922-31394944 GTGGGGTGGCGGGGGGCGGGGGG + Intronic
1146276908 17:31522067-31522089 CTGGGGGGTGAGAGGCCGGGGGG + Intronic
1146457220 17:33017424-33017446 CTGTGGGGCAAGGGGATGGGAGG - Intronic
1146639713 17:34531055-34531077 GTGAGGGGCCAGGGGAGGGGAGG + Intergenic
1146846468 17:36184212-36184234 CTGGAGGGCCTGGGGGAGGCTGG + Intronic
1147133899 17:38424439-38424461 CTCGGGGGCCAGTGGGTGTGGGG - Intergenic
1147141158 17:38461282-38461304 CTGCAGGGCCTGGGGGCTGGTGG + Intronic
1147185867 17:38712828-38712850 CTGGGGTGGCAGAGGGAGGGAGG + Intronic
1147199402 17:38789934-38789956 TTGCCTGGCCAGGGGGCGGGGGG + Intronic
1147276725 17:39324018-39324040 TTGGGAGGCCAGGGGGTGGGGGG - Intronic
1147285293 17:39398024-39398046 TTGGGAGGCCGGCGGGCGGGGGG + Intronic
1147571422 17:41573409-41573431 CTAGGGGGCCTGGGGGATGGTGG - Intergenic
1147661833 17:42121083-42121105 GTGGGGGGGCCGGGAGCGGGGGG - Exonic
1147736353 17:42641088-42641110 GTGGCGGGGCAGGGGGGGGGGGG + Intergenic
1147758359 17:42782434-42782456 CAGGCCGGCCATGGGGCGGGAGG - Intronic
1147840625 17:43369012-43369034 CTGGGGCGGCACGGGGCGGGGGG + Intergenic
1147970922 17:44218942-44218964 GTGGGTGGCTCGGGGGCGGGGGG - Intronic
1147987578 17:44315332-44315354 CGGCGGGCCCGGGGGGCGGGCGG + Intronic
1148048666 17:44758917-44758939 CTGGGGGGGCCGGGGGGCGGCGG + Intergenic
1148048667 17:44758918-44758940 TGGGGGGGCCGGGGGGCGGCGGG + Intergenic
1148215263 17:45830650-45830672 CTGGGGGGCCTGAGGGATGGAGG + Intronic
1148432129 17:47650562-47650584 TTGGGGGGGGAGGGGGAGGGGGG - Intronic
1148439081 17:47702574-47702596 CTTGTGGGCCAGGGGCTGGGAGG - Intronic
1148542682 17:48492925-48492947 GTGGGGGGACAGGGAGCGCGCGG - Intergenic
1148780895 17:50121201-50121223 TTGGGGTGGCAGGGGGTGGGAGG - Intronic
1148797540 17:50204214-50204236 CTGGGGGGATGGGGGGTGGGAGG + Intergenic
1148849594 17:50548219-50548241 CTGGGGGGCCTGGGAGAAGGTGG + Intronic
1149342236 17:55698985-55699007 CAGGGAGGCCAGGGGAAGGGAGG + Intergenic
1149429751 17:56588411-56588433 GTGGGGGGCCTGGGGGTGGGTGG - Intergenic
1149470860 17:56914096-56914118 GTGGGGTGCGGGGGGGCGGGCGG + Intergenic
1149540296 17:57463441-57463463 CAGTGGGGCCATGGGGAGGGAGG - Intronic
1149656416 17:58311714-58311736 CAGGTGGGCCTGGGGGCAGGGGG + Exonic
1149727392 17:58910144-58910166 CTGTGGGGCAACGAGGCGGGTGG - Intronic
1149849815 17:60027605-60027627 CTGGAGGGCCTGGGGGAGGCTGG + Intergenic
1149860353 17:60118919-60118941 CTGGAGGGCCTGGGGGAGGCTGG - Intergenic
1149869054 17:60166712-60166734 TTGGGAGGCCAAGGGGGGGGCGG + Intronic
1149993949 17:61397289-61397311 CTGGAGGGGGAGGGCGCGGGCGG - Intergenic
1150041247 17:61863526-61863548 CTGGGAGTCGAGGGGGCGGGAGG - Intergenic
1150045803 17:61912353-61912375 CTGGGAGGCCAAGGTGGGGGCGG + Intronic
1150134817 17:62689865-62689887 ATGGGGGGCCATGGGGTGGGAGG - Intronic
1150137173 17:62702406-62702428 TTGGAAGGCCAAGGGGCGGGGGG + Intronic
1150630484 17:66877093-66877115 CTGCGGGGTTAGGGGGAGGGTGG + Intronic
1150634397 17:66902683-66902705 AGGTGGGGCCAGGGGGCTGGAGG + Intergenic
1150643516 17:66964798-66964820 TTGGGGGGCCGAGGGCCGGGGGG - Intergenic
1150770300 17:68035582-68035604 CTTGGGGGCGAGTGGGAGGGGGG - Intronic
1151313834 17:73310418-73310440 CTGAGGGTCCAGGGTGCTGGAGG - Intronic
1151340924 17:73470481-73470503 CTGAGAGTCCAGGGGGCAGGGGG - Intronic
1151511923 17:74566021-74566043 CGGGGGGGCAGGGGGGCGGGCGG + Intergenic
1151598472 17:75091845-75091867 TTGGGGGGCCAGGGCGCAGGAGG + Intronic
1151649379 17:75456781-75456803 GTGGGGAGCAAGGGGGCGTGGGG + Intronic
1151807060 17:76412386-76412408 ATGGGGGGTCAGGGAGGGGGTGG - Intronic
1151866422 17:76806241-76806263 CGGCGGGGCCGGGGGGCTGGCGG - Intergenic
1151969254 17:77449474-77449496 CTGGGGGGCCAGAAAGCTGGGGG + Intronic
1151979103 17:77498500-77498522 CTGTGGGGGTGGGGGGCGGGCGG - Intronic
1152185623 17:78854905-78854927 CTGGGGAGCATGTGGGCGGGGGG + Exonic
1152263844 17:79282013-79282035 CTGAGGGGGCAGGGGATGGGAGG + Intronic
1152357550 17:79814168-79814190 CTGCTGGGCGGGGGGGCGGGGGG - Intergenic
1152380926 17:79941924-79941946 CTGGGGGGCCATGGTGGGGATGG + Intronic
1152508778 17:80771413-80771435 CAGGAGGGCCAGCGGGCGGCGGG - Intronic
1152597260 17:81243841-81243863 TTGCGGGGCCAGGGGCTGGGAGG - Intergenic
1152699718 17:81812950-81812972 CGGGGGAGCCGGCGGGCGGGCGG - Intronic
1152701883 17:81823468-81823490 CTGCGAGGCCAGGTGCCGGGTGG - Exonic
1152786463 17:82250510-82250532 CTCGGGGCCCAGGTGCCGGGAGG - Intronic
1152810544 17:82379866-82379888 CGGGGTCGCCAGCGGGCGGGGGG - Intergenic
1152901132 17:82941707-82941729 TTGGGGGGCCGGGGAGTGGGTGG + Intronic
1153265161 18:3262335-3262357 CAGGGCGGCCAGGCGGCGGCAGG + Intronic
1153911338 18:9708580-9708602 CCGGGGAACCAGGGGGCGCGCGG - Intronic
1153914680 18:9734834-9734856 CTGGGGGGCCTGTGTGCTGGTGG - Intronic
1153970907 18:10226170-10226192 TTGGGGGGGCAGGGGGCGGGGGG - Intergenic
1154194442 18:12255025-12255047 CAGGGGGGACAAGGGGCGGGTGG + Intronic
1154367703 18:13726481-13726503 CTGGCGGGGCCGGGGGCGGCAGG - Exonic
1154475292 18:14748716-14748738 CTGGGGGTCCTGGGGACGAGGGG + Intronic
1154529438 18:15329968-15329990 CTGGGGGTCCTGGGGACGAGGGG - Intergenic
1155098473 18:22584158-22584180 CTGATGGGGCAGGGGGCTGGAGG - Intergenic
1156180465 18:34597763-34597785 CTGGGGGGGCGGGGGGCGGTGGG - Intronic
1156270170 18:35523465-35523487 TTGGGAGGCCAAGGGGCGGGAGG - Intergenic
1156315081 18:35962228-35962250 ATGGGGGGCAAGGGGGTGGGTGG - Intergenic
1156325526 18:36071498-36071520 TTGGGAGGCCAAGGGGCTGGGGG + Intergenic
1156496691 18:37530539-37530561 CTGGGGTGGCAGGGGGTAGGGGG - Intronic
1156717064 18:40024198-40024220 GTGGGGGGGTGGGGGGCGGGGGG - Intergenic
1156902642 18:42319452-42319474 CTGATGGGGCAGGGGGCAGGGGG - Intergenic
1157122202 18:44921768-44921790 GTGGGGGCCCAGGGGACGGAGGG + Intronic
1157384166 18:47247862-47247884 CTGGGGGGCGCGGGCGCAGGCGG - Intronic
1157427266 18:47594588-47594610 TGGGGGGGCCAGGGGGAGGTGGG + Intergenic
1157580639 18:48771991-48772013 CTGGGGAGCCAGGGACAGGGCGG - Intronic
1158112096 18:53951727-53951749 CTGGGATGCCAGGTGGAGGGAGG - Intergenic
1158505679 18:58044433-58044455 CTGCGGGACCAGCGGGCGGGCGG - Exonic
1159184474 18:64950578-64950600 CTGGCGGGGCAGGGGGGCGGGGG + Intergenic
1159798488 18:72869164-72869186 CGGGGTCGCCGGGGGGCGGGGGG + Intergenic
1159813711 18:73047264-73047286 TTGGGAGGCCGGGGGTCGGGGGG + Intergenic
1160270955 18:77382932-77382954 CTTGGGGGCCAGGGTGTGGGAGG + Intergenic
1160680238 19:408916-408938 CGGGGAGGGCTGGGGGCGGGGGG - Intronic
1160697632 19:492281-492303 ATGGGGGTCCATGGGGCAGGAGG - Intronic
1160698392 19:495267-495289 GTGGGGGGCGAGGGGGTGAGGGG + Intronic
1160708787 19:541316-541338 CTGGGGGGACAGGGTGGGTGAGG - Intronic
1160725410 19:616081-616103 GTGCGGGCCCCGGGGGCGGGCGG - Exonic
1160725534 19:616416-616438 CTGGGGGTCCAGGCCGCCGGCGG - Exonic
1160762383 19:791996-792018 CTGAGGGCCCAGGGTGGGGGTGG + Intergenic
1160766565 19:811205-811227 CTGGGGACCCAAGGGGTGGGGGG + Exonic
1160780037 19:873401-873423 ATGGGGGCCCAGGTGGGGGGCGG + Intronic
1160791535 19:925833-925855 GAGGGGGGCGAGGGGGCGTGCGG + Intronic
1160844207 19:1159492-1159514 GTGGGGGGACAGGGGGCAGCAGG + Intronic
1160844897 19:1161895-1161917 CTGGGGAGCCGCGGGGGGGGGGG + Intronic
1160863732 19:1248495-1248517 CAGGGGGGCGGGGGGCCGGGCGG - Intergenic
1160865244 19:1253286-1253308 CTTGGGGCCCATGGGGAGGGAGG - Intronic
1160868795 19:1267751-1267773 CTGGGGCTCCAGTGGGTGGGTGG + Intronic
1160873425 19:1286879-1286901 CTGAGGGGCCGGGGAGCTGGGGG + Intronic
1160913930 19:1487853-1487875 CAGGGGGTCCTGGGGGCAGGTGG + Exonic
1160930163 19:1566674-1566696 CTGCGGGGCGGGCGGGCGGGTGG - Intronic
1161010847 19:1958770-1958792 ATGGGGGGACAGGGGGACGGGGG - Intronic
1161061886 19:2219403-2219425 TTCGGGGGCCCGGGGGCTGGGGG - Intronic
1161231336 19:3176531-3176553 CTGGGGGGACAGAGGGCAGGTGG + Intronic
1161262521 19:3345647-3345669 ATGGGGAGCCGGGCGGCGGGAGG - Intergenic
1161333529 19:3699413-3699435 CAGGCGGGCAAGCGGGCGGGCGG - Intronic
1161471268 19:4457718-4457740 CGGGGGGCCGCGGGGGCGGGGGG + Exonic
1161475087 19:4480317-4480339 CTGGGGGGCCAGGGAGTCAGGGG - Intronic
1161589757 19:5124010-5124032 CTGGGGTCCCTGGGGGTGGGGGG + Intronic
1161594541 19:5144422-5144444 GGGGTGGGGCAGGGGGCGGGGGG + Intronic
1161731537 19:5963977-5963999 CTGGGGTACCAGGGGGCAGCAGG - Intronic
1161740935 19:6020951-6020973 TTGGGGGGCCGGGGAGAGGGAGG - Intronic
1161745325 19:6056017-6056039 GTGGGGGGGCAGGTGGCGGTGGG + Intronic
1161766515 19:6211731-6211753 CTGGGGGTCCCAGGGGCTGGAGG - Intergenic
1161779145 19:6279708-6279730 CGGGCGGGCCGGCGGGCGGGAGG + Intronic
1161779206 19:6279914-6279936 CTGGCGGGCGAGCGGGCGGCCGG - Exonic
1161792956 19:6371803-6371825 CTGTGGGGGCAGGGAGGGGGCGG - Intergenic
1161793866 19:6375591-6375613 CAGGCGGGCAAGGGGGCGGTGGG + Exonic
1161815778 19:6498999-6499021 CTGGGTGGCCAGGGGGTGGGAGG + Intronic
1161854388 19:6754933-6754955 CTGGGGGCCCAGCAGGCAGGAGG + Exonic
1162020166 19:7864677-7864699 CCGGGGGGCCGGGGGAAGGGAGG - Intronic
1162063728 19:8111909-8111931 GTGGGGGGCAAGGCGGTGGGGGG - Intronic
1162094809 19:8304035-8304057 AGGGGAGGCCAGGGGGCGGTGGG + Exonic
1162321025 19:9970629-9970651 CCGGGGGGCCCGGGGGCGCCGGG + Exonic
1162381711 19:10335316-10335338 CCGGGGGGCCACGAGGCGCGGGG + Exonic
1162392193 19:10396311-10396333 CTGGGAGACCAGGGCACGGGAGG - Intronic
1162420066 19:10561120-10561142 CTGGGGGACAGGGTGGCGGGTGG - Intronic
1162432063 19:10635074-10635096 GTGGGGGGCCAGGGTGCCAGGGG + Intronic
1162483798 19:10946060-10946082 TTGGGAGGCCAAGGGGTGGGGGG + Intergenic
1162585077 19:11553393-11553415 CTGGGGGGCCAGGGGCTGCAGGG + Exonic
1162806487 19:13140260-13140282 GTGGCAGGCCAGGAGGCGGGGGG - Exonic
1162818194 19:13208531-13208553 CGGGTGGGCAAGGGGGCTGGGGG + Intronic
1162910930 19:13847496-13847518 CTGGGGGTCCCTGGGGCGAGGGG + Intergenic
1162913701 19:13863545-13863567 CTGGCCGGCAGGGGGGCGGGCGG + Intronic
1162915829 19:13873894-13873916 CTGGGGGCACCCGGGGCGGGGGG + Intronic
1162931613 19:13960442-13960464 CTGCGGGGCCAGGGGGTGAGTGG - Intronic
1162951779 19:14075241-14075263 CCGGGCCGCCAGGGGGCGGTAGG - Intergenic
1163115926 19:15188629-15188651 ATGGGGGGCCCTGGGGCTGGGGG - Intronic
1163135492 19:15308138-15308160 TTGCGGGGCCGGGGGGGGGGGGG + Intronic
1163158147 19:15449960-15449982 CGGGGGGGCGGGGCGGCGGGGGG - Intergenic
1163158190 19:15450061-15450083 CGGGGCGGCGAGGGGGGGGGGGG - Intergenic
1163329570 19:16627967-16627989 CGGCCGGGCCAGCGGGCGGGCGG + Exonic
1163446785 19:17351676-17351698 CTGGGAGGCCAGGAGGCTGGAGG + Exonic
1163591558 19:18196897-18196919 CTGGTGGGCGGGGGGGGGGGGGG + Exonic
1163628111 19:18402350-18402372 CTGGGGGTCCAGGGGTCTGGTGG + Intergenic
1163630903 19:18417586-18417608 CTGGGGGACCACGGGGGGCGTGG - Intergenic
1163649578 19:18509472-18509494 CTGTGGGCCAAGGGGCCGGGTGG - Intronic
1163695069 19:18759934-18759956 CGGCGGGGACAGGGGGCTGGCGG - Intronic
1163810486 19:19428620-19428642 CTGGAGTGCCAGGGAGCGAGAGG + Intronic
1164464359 19:28475043-28475065 CTGAGGGAGCAGGGGGTGGGCGG - Intergenic
1164626581 19:29732744-29732766 TTGGGAGGCCAAGGGGTGGGTGG - Intergenic
1164693827 19:30228781-30228803 CTGGGCGGCTGGGCGGCGGGAGG + Intronic
1164722734 19:30444269-30444291 CTGCAGGGCCAGGGTGCAGGCGG - Exonic
1165018058 19:32898401-32898423 GTGGGGGGCTGGGGGGCAGGTGG + Intronic
1165057511 19:33187404-33187426 GCGGGGGGGCAGGGGGCAGGAGG - Intronic
1165061574 19:33207512-33207534 TTGGGGAGCAGGGGGGCGGGGGG - Exonic
1165139694 19:33691196-33691218 CTGGGGACCCAGGGGACGGCTGG + Intronic
1165249124 19:34515537-34515559 CTGAGGGGACAGGCGGGGGGGGG - Intergenic
1165313003 19:35039921-35039943 CTGGGGTGGGAGGGGGCAGGGGG + Intronic
1165319563 19:35076888-35076910 CTGGGGACCCAGGTGGCAGGAGG - Intergenic
1165326621 19:35117845-35117867 CTGGGGTGCCAGGCAGAGGGAGG + Intronic
1165349692 19:35269081-35269103 ATGGGGGGGGCGGGGGCGGGGGG - Exonic
1165413670 19:35677919-35677941 CTGGGTGGGCTGGGGGTGGGGGG + Intronic
1165815366 19:38638715-38638737 CTGGAGGGCTAGGGGGTTGGGGG + Intergenic
1165941698 19:39417736-39417758 CGAGGGGGCCTTGGGGCGGGTGG + Intronic
1165993059 19:39826913-39826935 CGGGCGGGCCCGGGGGCCGGCGG - Exonic
1165993160 19:39827238-39827260 GTGAGGGGCCACGGGGTGGGAGG + Intronic
1166043764 19:40217868-40217890 CTTGGGGGCCAGGGGCCCTGGGG - Intronic
1166053656 19:40275763-40275785 CTGGGGGGGGGGGGGGTGGGCGG + Intronic
1166091660 19:40513209-40513231 CTGGCGCGCCAGGCGGCGGCTGG - Exonic
1166109136 19:40612050-40612072 CTGGGGGGCAGGGGAGAGGGTGG - Intronic
1166184847 19:41133350-41133372 CTGGCGAGCCAGTGGGCGGGGGG - Intergenic
1166250420 19:41565535-41565557 CAAGGGGGGCGGGGGGCGGGGGG - Intronic
1166364991 19:42273826-42273848 CTCGGGGGGCAGGTGGCGGTGGG - Intronic
1166375472 19:42324784-42324806 GAAGGGGGCCAGGGGGCCGGAGG - Exonic
1166381481 19:42357390-42357412 CTGGGGGGCCTGAGGGATGGAGG - Exonic
1166394377 19:42427935-42427957 TTGGGAGGCCCGGGGGCGGGGGG - Intergenic
1166666025 19:44680958-44680980 GTCGGGGGACTGGGGGCGGGTGG - Intronic
1166677483 19:44748631-44748653 CGGGGGGGCCGGGGGCGGGGAGG + Exonic
1166789018 19:45386418-45386440 CTGGGGGGCCATGGGATTGGTGG + Intronic
1166789792 19:45392012-45392034 ATGGGGGGCCAGGGCCCGGGGGG - Exonic
1166811348 19:45516327-45516349 CTGGGGAGCCAGGCGAGGGGTGG + Intronic
1166888095 19:45973547-45973569 GGGGGGGGGCGGGGGGCGGGGGG + Intergenic
1166888248 19:45973935-45973957 GTGGGGGCCCGGGGGGCGGCGGG + Intergenic
1167055587 19:47109949-47109971 CCGGGGGGACTGGGGGCTGGAGG + Intronic
1167149727 19:47701824-47701846 CGGGGGCGGCAGGCGGCGGGTGG - Exonic
1167322283 19:48804663-48804685 CCGCGGGTCCAGGGGGCGGAAGG - Intronic
1167377389 19:49119362-49119384 GTGGGGGGGGAGGGGGAGGGAGG + Intergenic
1167427458 19:49436840-49436862 CTTGGGGGTGAGGGGGCTGGGGG - Intronic
1167437461 19:49487664-49487686 CGGGGCGGCAAGGGGCCGGGTGG + Intronic
1167445558 19:49535096-49535118 CTGGGGGCCCAGGAGGGGGAGGG - Intronic
1167465886 19:49651022-49651044 CTGGGGGTGCAGGGGGCGGTGGG - Exonic
1167490900 19:49792264-49792286 CTGGGCATCCAGGGGGCGTGAGG - Intronic
1167509294 19:49887849-49887871 CAGGGGGGACAGGGCGGGGGCGG - Intronic
1167517362 19:49930940-49930962 CCAGGGGGGCAGGGGCCGGGGGG - Exonic
1167521590 19:49958965-49958987 CTGGGGGCCCAGGAGTCTGGAGG - Intronic
1167562416 19:50233803-50233825 CGGGGGGGTCGGGGGGAGGGGGG - Intronic
1167609586 19:50500798-50500820 CTGGGGGCGCTGGGGGTGGGGGG - Intergenic
1167643783 19:50695248-50695270 CCGGGGGGCGCGGGGGCGCGGGG + Intronic
1167648671 19:50718669-50718691 GTGGGGGGACAGGGGGCGGCTGG + Intronic
1167694556 19:51007090-51007112 CTGTGGGGGCAGGGGTGGGGCGG - Intronic
1167738708 19:51311764-51311786 CTGGGGGGAGAGGGGGGAGGGGG - Intergenic
1167785025 19:51629485-51629507 CTCGGGGTCCAGGGGGCTGAGGG + Exonic
1167787126 19:51645909-51645931 CTCGGGGTCCAGGGGGCTGAGGG + Exonic
1168020072 19:53602780-53602802 CTGGGAGGCCGGGTGCCGGGGGG - Intronic
1168062036 19:53898560-53898582 CTGGGGGGCCGGGGTCCTGGCGG + Exonic
1168145579 19:54418727-54418749 GTGTGGGATCAGGGGGCGGGTGG - Intronic
1168339323 19:55614488-55614510 CTGGGAGGCCCAGCGGCGGGAGG - Exonic
1168709804 19:58492561-58492583 CTGGGAGGCTAAGGGGGGGGCGG + Intronic
925169172 2:1740489-1740511 CTGGGGGGCCTGCAGGCGGGAGG + Intronic
925342228 2:3145655-3145677 CTGGAGGGCCAGGGAGAGAGAGG - Intergenic
925725214 2:6865423-6865445 CTGCGGGGCCCGGGTCCGGGCGG - Exonic
925754846 2:7123431-7123453 TTTGGGGGCAGGGGGGCGGGGGG - Intergenic
925846924 2:8043048-8043070 CAGAGGGGCCATGGGGCGGGGGG + Intergenic
925919686 2:8630537-8630559 CTGAGGGGCGGGGGGGCAGGGGG + Intergenic
925928271 2:8685673-8685695 CTGGGGGGCGAGCGTGCGGCCGG - Intergenic
926095666 2:10079746-10079768 CTGGGGGCCCAGGGGCGGGGAGG + Intronic
926268251 2:11344919-11344941 CGGGAGGGGCAGGGGGCGCGCGG - Intronic
926560048 2:14406827-14406849 GTGCGTGGCCAGGGGGCAGGGGG + Intergenic
926683090 2:15678661-15678683 CTGGGGGGCTGGGGGGCTGGAGG + Intergenic
926773004 2:16394524-16394546 GTGTGGGGGCGGGGGGCGGGGGG - Intergenic
927471275 2:23379438-23379460 CTGTGGGGCGGGGGGGGGGGGGG + Intergenic
927596651 2:24403208-24403230 CTGGGGGGAGGGCGGGCGGGGGG - Intergenic
927881503 2:26692837-26692859 CGGGGGCGCCGGGGGGCCGGCGG + Exonic
928118853 2:28567050-28567072 CTTGGGGGCCGGGGGCGGGGAGG + Intronic
928143955 2:28754336-28754358 TTGGGGGGGCGGGGGGGGGGCGG + Intronic
928166795 2:28977726-28977748 CTGGTGGGCCAGGAGAGGGGCGG + Intronic
928412602 2:31066403-31066425 GTGCGGGGGCGGGGGGCGGGGGG + Intronic
928910157 2:36412274-36412296 ATGGGGGCGCAGGGGGTGGGGGG + Intronic
929109242 2:38392433-38392455 CCGGGGGGGCGGGGGGGGGGTGG + Intergenic
929665649 2:43831914-43831936 CGGGGGGGCCAGGGGTGTGGGGG + Intronic
929795142 2:45053480-45053502 CTGAGGGGACAGGGGTGGGGGGG + Intergenic
931659219 2:64542619-64542641 CTTGGGGGCATGGGGGCGGGGGG - Intronic
931731939 2:65160963-65160985 CGGGGGGGCGGGGGGGCGGGGGG + Intergenic
932488988 2:72106524-72106546 CTAGGGGGGTAGGGAGCGGGGGG - Intergenic
932493226 2:72134300-72134322 CCAGGGGCCTAGGGGGCGGGGGG + Intronic
932493231 2:72134308-72134330 CTAGGGGGCGGGGGGGAGGGTGG + Intronic
932780052 2:74554129-74554151 CGGGAGGGCCAGGGAGGGGGAGG - Exonic
933070318 2:77849441-77849463 TTGAGGGGGCAGGGGGTGGGGGG + Intergenic
933691483 2:85182366-85182388 CTGGGGTGCCAGGGAGCTGAGGG + Intronic
933763084 2:85687480-85687502 CTGGGTGGCCAGGGAGATGGTGG - Intronic
933797972 2:85936577-85936599 CTGAGTGGCCAGTGGGCTGGGGG + Intergenic
933886130 2:86720468-86720490 CTAGGGCGCCATGGGGCAGGCGG + Exonic
933924051 2:87076238-87076260 CTAGGGCGCCATGGGGCAGGCGG - Intergenic
933979457 2:87538539-87538561 CAGGGGGACGAGGGGGCGGCTGG - Intergenic
934261289 2:91478463-91478485 CCGCGGCGGCAGGGGGCGGGGGG - Intergenic
934573144 2:95384572-95384594 CTGGGGGGCAGGGGGGAGAGGGG + Exonic
935196547 2:100819925-100819947 CCGGGGGTCTAGGGGGCCGGGGG + Intergenic
935217877 2:100988877-100988899 CTGGAGGGGCAGGGGGCGCCTGG - Intronic
935296671 2:101655988-101656010 AAGTGGGGCCAGGGGGAGGGGGG - Intergenic
935645414 2:105329903-105329925 CGGGGCGGCCAGCGGGCGGAAGG + Exonic
935731417 2:106067050-106067072 TTGGGAGGCCGGGGGGGGGGGGG + Intronic
935821291 2:106895502-106895524 CTGAGTGACCAGGGGGTGGGTGG - Intergenic
936029929 2:109062840-109062862 TTGGGGGCCCTGGGAGCGGGTGG + Intergenic
936217989 2:110576889-110576911 CCGGGGGGGGAGGGGGGGGGCGG - Intronic
936314366 2:111412252-111412274 CAGGGGGACGAGGGGGCGGCTGG + Intergenic
936370428 2:111898458-111898480 TTGGGGTGGGAGGGGGCGGGAGG - Exonic
936431153 2:112464871-112464893 CTGTGGTTCCAGGGGGCTGGAGG + Intergenic
937478238 2:122234145-122234167 CGGGGGGGCGGGGGGGCGGGCGG + Intergenic
937724778 2:125149726-125149748 GTGGGGGGATAGGGGGCTGGGGG - Intergenic
938114246 2:128592420-128592442 GTGGGGGGCCAGGGGGAGCAAGG + Intergenic
938528536 2:132161390-132161412 CTGGGGGTCCTGGGGACGAGGGG - Intronic
939036378 2:137136145-137136167 CTGGGGGGTGAGGGGGCAAGGGG + Intronic
939630875 2:144524559-144524581 CTTGGGGGGCGGGGAGCGGGGGG + Intronic
940213112 2:151276051-151276073 TTGGGGGGTCAGGGGGAAGGAGG + Intronic
942125614 2:172822157-172822179 GTGTGGGGCCAGGGGGTGAGTGG + Intronic
942346084 2:175004806-175004828 CTGGGGGGCCTGGGCGCCCGGGG - Intronic
942459151 2:176157748-176157770 CTAGGGTGCCAGGGGGCGAGGGG + Intronic
942811370 2:180004685-180004707 CTGGGGGGGAGGGGGGCGAGGGG - Intronic
942942016 2:181630208-181630230 CTGGGGGGGCAGGGGGAGTGGGG - Intronic
944091417 2:195916438-195916460 CTGGTGGGGCAGGGGTGGGGGGG - Intronic
944495902 2:200306955-200306977 CTGGGGATGCAGGGCGCGGGCGG + Intronic
944507221 2:200425122-200425144 CGGGGGGGGGGGGGGGCGGGGGG - Intronic
945080755 2:206085222-206085244 CTGGCGGGCGTGGGGTCGGGTGG - Intronic
945274253 2:207972336-207972358 TTGGGAGGCCGGGGGGCGGGGGG + Intronic
946293810 2:218766809-218766831 GTGGGGGGCCAGGGGAGGGATGG - Intergenic
946311442 2:218884329-218884351 CTGGGGGGACGGGTGGAGGGGGG + Intronic
946357750 2:219199163-219199185 CTGGGGGGGCAGTGGGAGAGGGG + Intronic
947122959 2:226836211-226836233 CCGGGGGGCTAGGGCGAGGGAGG + Intronic
947514009 2:230785380-230785402 CAGGGGGGCAGGGGGGCAGGGGG + Intronic
947537266 2:230948098-230948120 GGGGGCGGCCAGGGGGTGGGCGG - Intronic
947629026 2:231639866-231639888 TTGGGAGGCCTGGGGGGGGGTGG - Intergenic
948036569 2:234862878-234862900 CTGGGGGACCAGGGAAGGGGAGG + Intergenic
948430319 2:237914327-237914349 CTGGGGGCCCGGGGGCCGCGGGG - Intergenic
948686967 2:239675879-239675901 CTGGAGGGGCAGGAGGCGGGGGG - Intergenic
948806009 2:240453644-240453666 CGGGGAGGGAAGGGGGCGGGCGG - Intronic
948901241 2:240957857-240957879 CTGCTGGGCCAGTGGTCGGGAGG - Intronic
948911108 2:241003114-241003136 GCGGGGGGCCCGGGGGAGGGCGG - Intronic
948936367 2:241167544-241167566 CAGGGAGGCCAGGGTGCAGGAGG - Intronic
949040963 2:241849839-241849861 CTGTGGGGGCAGTGGGCAGGAGG - Intergenic
949056820 2:241932383-241932405 TTGAGGGGTCAGGGGGCTGGAGG - Intergenic
1168765828 20:381200-381222 CCCGGAGGCCGGGGGGCGGGAGG + Intronic
1168769780 20:407995-408017 CCGGGGGGGCCGGGGGCTGGGGG - Intronic
1168876344 20:1174765-1174787 GGGGGGTGGCAGGGGGCGGGAGG - Intronic
1169117007 20:3072296-3072318 CTCCGGGGCCAGGGGGAGGCGGG + Intronic
1169120958 20:3095293-3095315 CTGGGAGGCCAGGGGCAGGCTGG - Intergenic
1169267571 20:4175889-4175911 CTGGCGGGGGAGGGGGTGGGGGG + Intronic
1169393959 20:5213590-5213612 ATGAGGCGGCAGGGGGCGGGGGG + Intergenic
1169626946 20:7581792-7581814 CTGGGGTGCCAGGGGTCAAGTGG - Intergenic
1170569593 20:17625356-17625378 GTGGGGGTCCAGGGTGTGGGGGG - Intronic
1171215494 20:23349635-23349657 GTGGGGGGAGAGGGTGCGGGGGG + Intergenic
1171249705 20:23638259-23638281 CTGGGGGGCCAGGGGAGGAGGGG - Intronic
1171330293 20:24331469-24331491 CTGGGGTGCCAGGGGCCAAGAGG - Intergenic
1171959938 20:31486017-31486039 CTGGGAGGTGAGAGGGCGGGAGG + Intergenic
1172110888 20:32544289-32544311 ATGGGAAGGCAGGGGGCGGGTGG + Intronic
1172126427 20:32627523-32627545 CTGGGGGGCCAGGGCGAAAGTGG - Intergenic
1172127877 20:32636032-32636054 GAGGGGGGCCTGGGGGCTGGGGG - Intergenic
1172164846 20:32892794-32892816 TTGGGGGGCCAGGGAGGGAGTGG + Intronic
1172367877 20:34363656-34363678 CTGAGGGGCGAGGGGCCGGACGG - Intronic
1172778070 20:37419763-37419785 CTGGGGGCCCTGGGAGGGGGGGG + Intergenic
1172840787 20:37901878-37901900 CGGGTGGGGCGGGGGGCGGGGGG + Intergenic
1173007609 20:39152074-39152096 TTGGAGGGCCTGGGGGGGGGGGG + Intergenic
1173570850 20:44075114-44075136 GTGAGGGGCCAGGGGCAGGGAGG + Intergenic
1173733368 20:45343461-45343483 CTGGAGGGAGAGGGGGCAGGGGG - Intronic
1174287265 20:49482496-49482518 CTGGGGGGGCAGGGGGGGCGGGG - Exonic
1174308908 20:49635230-49635252 ATGGCGGGGCGGGGGGCGGGGGG - Exonic
1174542130 20:51297844-51297866 TTGGGAGGCCGGGGGGCGCGGGG + Intergenic
1174568191 20:51482112-51482134 CTTGGGGGGCTGGGGGTGGGGGG - Intronic
1174938017 20:54893536-54893558 CTGGGGTTCCAGGGGGTGTGTGG + Intergenic
1175200062 20:57270606-57270628 CTGGGAGGCCAGCAGGCGAGGGG - Intergenic
1175210426 20:57350841-57350863 CGGGGGGACGGGGGGGCGGGGGG + Intergenic
1175210432 20:57350849-57350871 CGGGGGGGCGGGGGGGCGGGGGG + Intergenic
1175210437 20:57350857-57350879 CGGGGGGGCGGGGGGACGGGGGG + Intergenic
1175210442 20:57350864-57350886 GCGGGGGGACGGGGGGCGGGGGG + Intergenic
1175215250 20:57389184-57389206 CAAGGGGGCCCGGGGGCGGGGGG + Intergenic
1175217343 20:57398540-57398562 GTGGGGGGGCAGGGGGGCGGCGG - Intronic
1175238177 20:57526848-57526870 CTGGGAGACCTGGGGTCGGGGGG + Intergenic
1175424877 20:58856920-58856942 TTGGGGGGCTGGGGGGAGGGTGG - Intronic
1175747831 20:61473006-61473028 CTGGTGGGGCAGGGGAGGGGAGG + Intronic
1175758265 20:61544086-61544108 GTGTGGGGCCAGGGGGCGTGGGG - Intronic
1175771627 20:61627926-61627948 CAGGGGGCCCAGGAGGCGGCTGG - Intronic
1175846950 20:62064618-62064640 GTGGGGGTCCCGGGGGCGGGCGG + Exonic
1175997320 20:62817578-62817600 CTGGGGGGCCGGGGGGGCCGGGG - Exonic
1176019337 20:62954567-62954589 CTGGGGGCGCGGGGGACGGGGGG - Intronic
1176085612 20:63294195-63294217 CTGGGGGTGCAGGGGACTGGGGG + Intronic
1176097928 20:63352829-63352851 CTGTGGGACCTGGGGGCTGGGGG - Intronic
1176111485 20:63412745-63412767 TTGGGGGGCCTGGGAGAGGGAGG + Intronic
1176138767 20:63536155-63536177 GTGGGAGGCCAGGTGGGGGGGGG - Intronic
1176239134 20:64067887-64067909 CAGGGGAGCCAGGGGCCAGGAGG - Intronic
1176382713 21:6121179-6121201 CTGGGGGGCCTGGGAGCAGCCGG - Exonic
1176767960 21:13038500-13038522 CTGGGGGTCCTGGGGACGAGGGG + Intergenic
1178170633 21:30035764-30035786 CTGGGGGGGTAGGGGGAGGAAGG + Intergenic
1178319012 21:31590820-31590842 TTGGGAGGCCAAGGGGTGGGGGG + Intergenic
1178319024 21:31590835-31590857 GTGGGGGGCGGGGGGGAGGGGGG + Intergenic
1178487450 21:33027863-33027885 CAGGGGAGCCAGGGGCCGCGGGG + Exonic
1178824529 21:36004769-36004791 GTGGGGGGGGAGGAGGCGGGGGG + Intergenic
1178824553 21:36004811-36004833 CGGGGGGGGGAGGAGGCGGGGGG + Intergenic
1179198059 21:39183864-39183886 CTAGAGGGGCAGGGGGCGAGAGG + Intergenic
1179209349 21:39312944-39312966 CGGGGGGGGCGGGGGGCGGGGGG + Intronic
1179375396 21:40846551-40846573 CGGGGGGGCGGGGGGGTGGGGGG - Intronic
1179481819 21:41683114-41683136 CTCGGTGGCCAGGGGTGGGGTGG + Intergenic
1179505800 21:41839538-41839560 CTGGCGGGGCAGGGGGCAGAGGG - Intronic
1179590150 21:42402766-42402788 TTGGGAGGCCAAGGGGGGGGTGG - Intergenic
1179603528 21:42496759-42496781 CTGCGAGGCCTGGGGGCGGAAGG - Intronic
1179613865 21:42569377-42569399 CAGGGAGGCCATGTGGCGGGAGG - Intronic
1179618315 21:42595907-42595929 CTGGGGGGCTACTGGGCTGGGGG - Intergenic
1179624510 21:42641223-42641245 GGGGGGGGGCGGGGGGCGGGCGG - Intergenic
1179740756 21:43417060-43417082 CTGGGGGGCCTGGGAGCAGCCGG + Exonic
1179788691 21:43743455-43743477 CTCGGGGGCTGGGGGGAGGGAGG - Intronic
1179883169 21:44301868-44301890 ATGGGGTGGCAGGGGGTGGGGGG - Intronic
1179893967 21:44351148-44351170 CTGGGCTGGCTGGGGGCGGGTGG + Intronic
1179920678 21:44505565-44505587 CTGGGGGGGGGGGGGGGGGGAGG - Intronic
1180041406 21:45282201-45282223 CTGGGGGCCCTGGGGGGTGGTGG - Intronic
1180080845 21:45486947-45486969 CTGGGGGCCCAGGGGGCCCAGGG - Exonic
1180084993 21:45504508-45504530 CTGGGGGGCCTGGGGGGCCGGGG - Exonic
1180090343 21:45531005-45531027 CTGGGGGGCCACGGGGCAGGGGG + Intronic
1180432521 22:15264782-15264804 CTGGGGGTCCTGGGGACGAGGGG + Intergenic
1180654493 22:17408198-17408220 CTGGGGGGTGAGGGGGCTGAGGG - Intronic
1180724034 22:17931119-17931141 TTGGGGGACCAGGGGGTGTGGGG - Intronic
1180907139 22:19422401-19422423 GTGGGGGACCAGAGGGAGGGAGG - Intronic
1180935943 22:19625526-19625548 CTGGGGTGCTCGGGGGTGGGGGG - Intergenic
1181031428 22:20150320-20150342 CAGGGGCGCCAGGTGGTGGGTGG + Intronic
1181031451 22:20150369-20150391 CAGGGGCGCCAGGTGGTGGGTGG + Intronic
1181106910 22:20581119-20581141 CTGGGAGACCAGGGGGTGGGGGG - Intronic
1181235950 22:21447702-21447724 CTGGGGTTCCGGGGGGTGGGGGG + Exonic
1181299246 22:21867648-21867670 CGGGCGGGCCGGCGGGCGGGCGG + Intronic
1181522944 22:23459885-23459907 CTGGGGGCCCAGGGGGCGTCTGG - Intergenic
1181592659 22:23894670-23894692 CTGGGGGGCGGGGCGGGGGGAGG + Exonic
1181602486 22:23960626-23960648 CTGGTGGGCCAGGGGAGGGGAGG + Intronic
1181606027 22:23980681-23980703 CTGGTGGGCCAGGGGAGGGGAGG - Intronic
1182446588 22:30393242-30393264 CTGTGGTGCCAGGGGGAAGGGGG - Intronic
1182622875 22:31627459-31627481 CTGGTGGGCCAGGGAGGGTGGGG - Intronic
1182623461 22:31630315-31630337 CCCGAGGGCCAGGGAGCGGGTGG - Intronic
1182649183 22:31836895-31836917 ATGGGGGGCCAGGGGAGGGAAGG - Intronic
1182833712 22:33324373-33324395 CTGGGGAGCCATGGAGCCGGAGG + Intronic
1183353581 22:37346856-37346878 CTGAGGGGACTGGGGGCTGGTGG - Intergenic
1183398281 22:37585749-37585771 CAGTGTGGCCAGGGGGCAGGTGG - Intergenic
1183472427 22:38016728-38016750 CCGCGGGGGGAGGGGGCGGGAGG + Intronic
1183508655 22:38222806-38222828 CTGTGGGGCCTGGGGGGGTGGGG - Intronic
1183540702 22:38427825-38427847 GCGGGGGGCCCGGCGGCGGGTGG - Exonic
1183597653 22:38822211-38822233 ATGGGGGACAAGGGGGCGGGCGG + Exonic
1183663704 22:39235516-39235538 GTGGGGTGCCAGGAGGAGGGAGG - Intronic
1183680882 22:39328536-39328558 GTGGGTGGCCATGGGACGGGTGG + Intergenic
1183718404 22:39547925-39547947 CTGGGGGGTCAGGGTGCAAGGGG + Intergenic
1183880373 22:40822077-40822099 TTGGGAGGCCAGGGGGTGGGGGG - Intergenic
1183966606 22:41446347-41446369 TTGGGGGGCGTGCGGGCGGGGGG - Intronic
1183966685 22:41446601-41446623 GCGGGGGGCCCGAGGGCGGGCGG + Exonic
1184155208 22:42662586-42662608 CGGGGAGGCCCGGGAGCGGGAGG + Intergenic
1184242442 22:43218287-43218309 CTGGAGGGGCAGGGGGCATGTGG - Exonic
1184500442 22:44868303-44868325 GTGGGGGGCAGGGGGACGGGGGG + Intergenic
1184645110 22:45891245-45891267 GTGGGGGGCCGGGGGACGTGGGG - Intergenic
1184656725 22:45945714-45945736 CTGAGAGGCCAGGGGTCGTGTGG - Intronic
1184657321 22:45948337-45948359 GTGGGGCCCCAGGGAGCGGGCGG + Intronic
1184728889 22:46362416-46362438 CTGGGGACCCAGGGGGCCGGCGG + Exonic
1184729783 22:46365976-46365998 CTGGGGGGGAAGGTGGTGGGGGG + Intronic
1184769462 22:46589073-46589095 CAGGGACGGCAGGGGGCGGGGGG + Intronic
1185121723 22:48975346-48975368 CTGGGGGGACACGTGGCGAGGGG - Intergenic
1185182604 22:49372010-49372032 ATGGGGGGCCGGGGTGTGGGGGG - Intergenic
1185282013 22:49976170-49976192 CTGTGGGGCCATGGGGCTGCTGG + Intergenic
1185287952 22:50010803-50010825 GTGGGGGGAGCGGGGGCGGGGGG + Intronic
1185296806 22:50058608-50058630 CTGGGGGGCCCGAGGGGGAGGGG - Intergenic
1185313812 22:50170418-50170440 CCCCGGGGTCAGGGGGCGGGCGG - Intergenic
1185335831 22:50270455-50270477 CTGGGTGGCCGGGGCGTGGGGGG + Intronic
1185346696 22:50313584-50313606 CTGGGGGGCACGGGGCTGGGGGG - Intronic
1185349484 22:50327097-50327119 CTCGGGCGCTAGGGGGCGCGCGG - Intergenic
1185413424 22:50697564-50697586 CGGGGGGCGCAGGGGGCGCGGGG - Intergenic
949382710 3:3464007-3464029 CTGGGGGGCCAAGGGGAGTGTGG + Intergenic
950010767 3:9722164-9722186 TTGGGAGGCCGGGTGGCGGGGGG - Intronic
950090663 3:10291948-10291970 CTGGGTGGCTTGGGGGAGGGTGG + Intronic
950138665 3:10600667-10600689 CTGCCGGGCCAGGGGCAGGGAGG - Intronic
950464595 3:13145788-13145810 CCTGGGCGCCCGGGGGCGGGGGG + Intergenic
950831572 3:15879914-15879936 CTGGGGGGCTGGGGGCAGGGAGG - Intergenic
951694091 3:25427870-25427892 CTGGGGGGCGAGGCGGTGGGCGG + Intronic
952392601 3:32893184-32893206 TTGGGGGGAGAGGGGGCGGGGGG - Exonic
952822566 3:37498035-37498057 CTGGGTGGCCAGGGAGCTGTGGG + Intronic
953030633 3:39177707-39177729 CGGGGGGGGGAGGGGGCGGAGGG + Intergenic
953319750 3:41961557-41961579 CTGGGGAGCGGGGGGGGGGGGGG - Intronic
954005693 3:47588701-47588723 CTGTGGGGGCGGGGGGGGGGCGG - Intronic
954076908 3:48188182-48188204 CCGCGAGGCCAGCGGGCGGGCGG + Exonic
954230992 3:49217489-49217511 GTGGGGGGCTGGGGGGCTGGGGG + Intronic
954275652 3:49540025-49540047 CCGTGGGGCCGGCGGGCGGGCGG + Intergenic
954329509 3:49882077-49882099 CAGGGGGGCCATGGAGCAGGAGG - Intergenic
954380206 3:50215289-50215311 CTGGGAGGCCTGGGGGTGGAGGG - Intronic
954440601 3:50519808-50519830 CTGCTGGACCAGGGGGCTGGAGG - Intergenic
954581812 3:51707044-51707066 CGGCGGGGCGAGCGGGCGGGCGG + Intergenic
954615592 3:51967500-51967522 CGGGCGGGCCGGGGGGTGGGGGG - Intronic
954654175 3:52183928-52183950 CTGGGAGTCCAGGGGTCTGGAGG + Intergenic
954864686 3:53718576-53718598 CCGGGGGGCGGGGGGGCGGGGGG - Intronic
954864693 3:53718584-53718606 ATGCTGGGCCGGGGGGCGGGGGG - Intronic
955018368 3:55093915-55093937 CTGGGGGGGTAGGGGGTAGGAGG - Intergenic
955265259 3:57436815-57436837 CTGGGGGGCCAGGGGGCGGGCGG + Intronic
956369189 3:68539677-68539699 GTGGGGGGGCATGGGGTGGGTGG + Intronic
956642681 3:71429475-71429497 CTTGGGGGTGGGGGGGCGGGAGG + Intronic
958154992 3:89745425-89745447 CGGGGGTGTCAGGGGGTGGGGGG - Intergenic
958453861 3:94306075-94306097 CGGGGTGGCGGGGGGGCGGGGGG + Intergenic
958533632 3:95366940-95366962 CACGGGGGACAGGGGGCGGAGGG - Intergenic
959849720 3:111071968-111071990 CGGGGGAGCCGGGGGGCGGGCGG + Exonic
960228512 3:115195997-115196019 GGGGGGGGCCAGGGGGTGGGGGG + Intergenic
960741696 3:120841108-120841130 TTGAGAGGCCAAGGGGCGGGGGG - Intergenic
960869881 3:122238186-122238208 CTGGGGGGATAGGGGAGGGGTGG - Intronic
960941097 3:122935314-122935336 CTGGGGGAGCAGGGGGTGGGAGG + Intronic
961000959 3:123373759-123373781 CGGGGGGGTCGGGGGGGGGGGGG - Intronic
961158309 3:124700041-124700063 CTGGGGGGCCAGGGCTGGGCTGG - Intronic
961340047 3:126211910-126211932 CTGGAGGGTCAGCGGGCGGTAGG + Intergenic
961383294 3:126509742-126509764 CTGAGCGGCCAGGGGCTGGGCGG - Intronic
961409007 3:126704717-126704739 CTGAGGGGCCACGGGCTGGGAGG - Intronic
961447883 3:126989552-126989574 CTGGTGGGCCAGGGCACGGCCGG - Exonic
961664519 3:128487628-128487650 CTGGGGGGACTTAGGGCGGGGGG - Intronic
961827577 3:129606873-129606895 GCGGGGGTCCCGGGGGCGGGCGG - Intergenic
962750998 3:138434814-138434836 CTGGGGGCCCCGGGGGCGCAGGG - Exonic
963044816 3:141094774-141094796 CAGGGGGGCAAAGGGGCGGGGGG - Intronic
963397916 3:144757158-144757180 GTGGGGGGCCAGGGGGTGGGAGG - Intergenic
963768856 3:149368066-149368088 CTGGGGGGCAAGGGGAGGGAGGG + Intergenic
963981874 3:151547012-151547034 TTGGGAGGCCAAGGGGGGGGTGG - Intergenic
964282179 3:155079500-155079522 CCGGGGAGACGGGGGGCGGGCGG - Intronic
965429495 3:168568755-168568777 CCAGGGGGCCAGGGGGCCAGGGG - Intergenic
965429500 3:168568763-168568785 CCAGGGGGCCAGGGGGCCAGGGG - Intergenic
965530891 3:169769206-169769228 CTGGGGTGGCTGGGGGTGGGGGG - Intronic
965615297 3:170586202-170586224 CAGGGGGGCCAGGTGGGAGGTGG - Intronic
965694756 3:171396108-171396130 TTGGGGGGGCAGTGGGTGGGAGG - Intronic
966182218 3:177197623-177197645 CGGGCGGGCGAGCGGGCGGGCGG + Intergenic
966350145 3:179024845-179024867 CTGGGGGCCCGGGGGCGGGGCGG - Exonic
966372203 3:179261553-179261575 GGGGCGGGCCATGGGGCGGGCGG - Intronic
966528359 3:180944728-180944750 CTTGGGGGCCTGGGGTAGGGTGG - Intronic
966594293 3:181712277-181712299 TTGGGGGGCCCGCGGGCGGGGGG - Exonic
966669369 3:182509457-182509479 ATGGGGGGCGAGGGGGTGGGAGG + Intergenic
966710987 3:182972797-182972819 CTGGGAGGCCAAGAGGGGGGCGG + Intronic
967010831 3:185432013-185432035 CATGGGGGCCAGGGGGTGGAGGG - Intronic
967100226 3:186210101-186210123 CTGTGGGGCCTGGAGCCGGGAGG + Intronic
967255860 3:187591234-187591256 GGGGAGGGGCAGGGGGCGGGTGG + Intergenic
968047349 3:195631722-195631744 CGGGGTGGCGGGGGGGCGGGTGG - Intergenic
968156876 3:196388297-196388319 CTGGGGGGCTGGGGGGCTGGGGG + Intronic
968161626 3:196432011-196432033 CCCGGGGACCCGGGGGCGGGAGG - Intronic
968234585 3:197024148-197024170 CGGGGGAGGCACGGGGCGGGCGG + Intronic
968307264 3:197658202-197658224 CGGGGTGGCGGGGGGGCGGGTGG + Intergenic
968443033 4:634096-634118 CTGGGAGGCCAGAGGGGTGGAGG + Intronic
968479522 4:827069-827091 GTCGGGAGCCAGGCGGCGGGAGG + Intergenic
968510756 4:994731-994753 GTTGGGGGGCAGGGGGCGGCCGG - Intronic
968514933 4:1011927-1011949 CGGGGGGCTCAGCGGGCGGGCGG - Intronic
968579634 4:1383962-1383984 CGGGGGGGCCACGCGGTGGGAGG - Intronic
968585016 4:1412315-1412337 CTCGGGGGCACGGGGGCGGGGGG - Intergenic
968606125 4:1536514-1536536 ATGGGGTGGCAGCGGGCGGGGGG + Intergenic
968606635 4:1538455-1538477 GTGGGAGGGCAGGGGTCGGGGGG + Intergenic
968651185 4:1760883-1760905 GCTGGGGGCCAGGGGGCCGGGGG + Intergenic
968699600 4:2048264-2048286 CTGGAGAGCCAGGGGGCTGGAGG - Intergenic
968705178 4:2074316-2074338 CTGGGGAACCAGGGGTCGGGCGG - Intronic
968725037 4:2242818-2242840 TTGGGAGGCCGGGGGGGGGGGGG + Intergenic
968758035 4:2426930-2426952 CTGGGGCGCCTGGGGGATGGAGG - Intronic
968844011 4:3029700-3029722 CTGCTGGGCCAGGAGGCAGGTGG - Intronic
968850746 4:3075638-3075660 GTGGCGGGGCAGGGGGGGGGCGG + Intronic
968902120 4:3436728-3436750 CTGGGAGGCCTGGGGGCGACCGG + Intronic
968907885 4:3463072-3463094 CTGGCGGGGCGGGGGTCGGGCGG - Intergenic
969113349 4:4857044-4857066 GCGGGGGGCCCGGGGGCGGGCGG - Intergenic
969239317 4:5888626-5888648 CTGGGCGGGTGGGGGGCGGGGGG - Intronic
969242084 4:5905907-5905929 CACGGGGGCAGGGGGGCGGGGGG + Intronic
969285594 4:6200223-6200245 CAGGTGCGCCGGGGGGCGGGAGG - Intronic
969705975 4:8791806-8791828 GGGAAGGGCCAGGGGGCGGGGGG + Intergenic
969724844 4:8912887-8912909 GGGGGGGGCCAGGGTGGGGGAGG - Intergenic
969843575 4:9901678-9901700 TTGAGGGGCCAAGGGGCTGGTGG - Intronic
969880580 4:10170122-10170144 CTGGGGGGGGGGGGGGTGGGGGG + Intergenic
970696321 4:18681738-18681760 CTGGGGGGCCATGCGGCGAATGG - Intergenic
970891226 4:21046832-21046854 TTGGAAGGCCAGGAGGCGGGTGG - Intronic
971442479 4:26702866-26702888 CTGCTGGGCCCGGGGGCAGGGGG - Intronic
971457954 4:26861370-26861392 GTGAGGGGCCGGGGGGCGGCGGG + Intronic
973093671 4:46169910-46169932 CTGTGGGGTGAGGGGGAGGGCGG + Intergenic
973224284 4:47765187-47765209 GTGGGGGGCGTGGTGGCGGGAGG + Intronic
973317896 4:48780316-48780338 CAGGAAGGCCAGGGGGCGGGCGG - Intronic
973565678 4:52184826-52184848 CTGGGGGGGCAGGTGGAGGCAGG - Intergenic
973741884 4:53926400-53926422 CTGGGGGTCCTGGGGGTGGTGGG - Intronic
973774079 4:54229922-54229944 CTGGGGGACCAGGGGGAGGTGGG + Intronic
973781105 4:54288938-54288960 CTGTGGGTCTAGGGGGAGGGAGG + Intronic
973806131 4:54527710-54527732 TTGGGGGGATAGGGGGTGGGAGG + Intergenic
974047487 4:56908993-56909015 CGGAGGGGCCCGGGGGCGGTCGG + Intronic
974875792 4:67701173-67701195 TGGGGGGGTCAAGGGGCGGGCGG + Exonic
975385266 4:73750796-73750818 TTGGGAGGCCAGGGAGGGGGTGG + Intergenic
975477131 4:74836110-74836132 TTGGGAGGCCAAGGGGTGGGCGG - Intergenic
975708725 4:77137336-77137358 CTGGGGAGGCCGGGGGCTGGGGG + Intergenic
975821020 4:78270533-78270555 CGGGGGGGCGGGGTGGCGGGGGG - Intronic
976100306 4:81554953-81554975 ATGGGGGGCACGGGGGTGGGGGG + Intronic
976569924 4:86595371-86595393 CGGTGGGGCTAGGGGGCCGGAGG - Intronic
976791243 4:88880775-88880797 GTGGGGGGCGGGGGGGGGGGGGG + Intronic
977055286 4:92183190-92183212 CTGGGGGTCCAGGCGGCTTGAGG - Intergenic
977160087 4:93623301-93623323 TTGGGGGGTCAGGGGGCTAGGGG - Intronic
978838182 4:113178324-113178346 TTGGGAGGCCAGGAGGTGGGTGG + Intronic
980562995 4:134501976-134501998 ATGGGGGGAAAGGGGGCAGGCGG - Intergenic
980660735 4:135855076-135855098 CTGGGGAACCTGGGGGCTGGGGG - Intergenic
981005452 4:139870300-139870322 CTTGGGGGCCAGGGGTAGGGTGG - Intronic
981475208 4:145180492-145180514 CCGGAGGGGCAGGGAGCGGGTGG + Intergenic
981574860 4:146193903-146193925 CTGGGGGCCCAGGCCGAGGGAGG + Intronic
981745634 4:148049831-148049853 GTGGGGGGGCGGGGGGCGGGGGG + Intronic
982738551 4:159033288-159033310 CTAGGGGGAAAGGGGGAGGGGGG + Intronic
982770187 4:159390253-159390275 GTGGGGGGTGGGGGGGCGGGGGG - Intergenic
982777385 4:159455753-159455775 CTGGGGGGCGGGGGGAGGGGGGG - Intergenic
983113345 4:163781100-163781122 TTGGGAGGCCAAGGGGCGGGGGG + Intronic
983247003 4:165298935-165298957 CTGGGGGGGGAGGGGGGGCGGGG - Intronic
983466669 4:168101498-168101520 TTGGGGGGGAAGGGGACGGGGGG + Intronic
983704194 4:170638088-170638110 GTTGGGGGCCAGGGGGCAAGGGG - Intergenic
984828154 4:183946866-183946888 CTGGGAGGCCAAGGAGGGGGTGG - Intronic
984908141 4:184649008-184649030 CGGGGAGGCCAGGCAGCGGGAGG - Intronic
985539589 5:481886-481908 GTGCGGGGCTGGGGGGCGGGGGG - Intronic
985539646 5:482041-482063 GTGCGGGGCTGGGGGGCGGGGGG - Intronic
985588125 5:751325-751347 GTGGGGGGCACGGGGGCAGGGGG + Intronic
985602795 5:843792-843814 GTGGGGGGCACGGGGGCAGGGGG + Intronic
985629895 5:1008885-1008907 CGGGGGAGCCAGGGGGCGCCAGG - Exonic
985640792 5:1062673-1062695 CTGGGGGGCTGGGGGGCTGGGGG + Intronic
985671313 5:1208386-1208408 CTGGACTGCCAGGGGGTGGGTGG + Intronic
985696612 5:1344649-1344671 CCGCGGGGCCGGGGGCCGGGCGG - Intronic
985748936 5:1663557-1663579 CTGGGAGGTCAGGGGGTGGCTGG + Intergenic
985760833 5:1747734-1747756 GTAGCGGGGCAGGGGGCGGGGGG - Intergenic
985777471 5:1852342-1852364 GTGGTGGGCGGGGGGGCGGGGGG - Intergenic
985778374 5:1857089-1857111 CTGGGGCGGCGTGGGGCGGGCGG + Intergenic
985877337 5:2609988-2610010 CTTGGGGGCGGGGGGGGGGGGGG + Intergenic
987075679 5:14379944-14379966 GTGGGTGGCCAGCAGGCGGGAGG - Intronic
987384800 5:17319007-17319029 CTGGGGGGCAGGGTGGCGGGGGG + Intergenic
988949352 5:36241710-36241732 CTGCGGGGACCGGGTGCGGGAGG - Exonic
989539251 5:42599604-42599626 TTGGGAGGCCAAGAGGCGGGGGG - Intronic
990007820 5:50963890-50963912 GTGGGGGGGCGGGGGGGGGGGGG + Intergenic
990450657 5:55929329-55929351 GTGTGGGGCCAGGGGAGGGGTGG + Intergenic
990503622 5:56423011-56423033 CTGAGGAGCCAGGGAGCTGGAGG - Intergenic
991334159 5:65528238-65528260 TTTGGGGGCAGGGGGGCGGGGGG - Intronic
991576449 5:68108571-68108593 TCGGGGGGTCAGGGGGCTGGGGG + Intergenic
991743791 5:69710593-69710615 GTTGGGGGGCGGGGGGCGGGGGG + Intergenic
991753917 5:69844642-69844664 GTTGGGGGGCGGGGGGCGGGGGG - Intergenic
991795363 5:70290325-70290347 GTTGGGGGGCGGGGGGCGGGGGG + Intergenic
991803542 5:70401397-70401419 GTTGGGGGGCGGGGGGCGGGGGG - Intergenic
991823163 5:70585868-70585890 GTTGGGGGGCGGGGGGCGGGGGG + Intergenic
991833234 5:70719762-70719784 GTTGGGGGGCGGGGGGCGGGGGG - Intergenic
991887730 5:71289844-71289866 GTTGGGGGGCGGGGGGCGGGGGG + Intergenic
992023677 5:72650284-72650306 CTGGGGGGTGAGGGGGTGAGGGG - Intergenic
992625863 5:78635373-78635395 CTGGGGGAAGAGGGGGCGGTGGG - Intronic
992765094 5:79991125-79991147 CTCGCGGGCCAGGGCGCAGGAGG - Intronic
992962790 5:81972278-81972300 CTGCGGGGTCAGGGGCCGAGCGG + Exonic
993519513 5:88883496-88883518 CTGGGGGTGGTGGGGGCGGGGGG + Intronic
993526840 5:88975580-88975602 CAGGGAGGCCAAGAGGCGGGAGG + Intergenic
994107304 5:95961692-95961714 CGGGGGGGACAGGGGGCCTGCGG - Exonic
994146600 5:96402349-96402371 ATGAGGGGCCAGGGGGCCTGCGG - Intronic
994149619 5:96432812-96432834 CTGGGGCCCCAGGGGACTGGCGG - Intronic
994498721 5:100546382-100546404 GTGGGGAGGCAGGGGGAGGGAGG + Intronic
995565737 5:113431752-113431774 TTGGGAGGCCAAGGGGGGGGGGG + Intronic
996398430 5:123035825-123035847 CTGCGGGGAAAGGGGGCGGGGGG - Intronic
997126617 5:131233606-131233628 TTGGGAGGCCAGGGGCAGGGAGG - Intergenic
997739076 5:136237988-136238010 CTCGGGCTCCAGGAGGCGGGAGG - Intronic
997961758 5:138327372-138327394 TTGGGAGGCCAAGGGGTGGGTGG + Intronic
998527508 5:142856270-142856292 CTGGAGGGCCAGGTGGCAGTCGG + Intronic
998680007 5:144456482-144456504 CAGGGGGGTCAGGGGTAGGGAGG + Intronic
999100274 5:149018278-149018300 TTGGTGGGCATGGGGGCGGGGGG - Intronic
1000318812 5:160118414-160118436 CGGGGGGACGGGGGGGCGGGGGG - Intronic
1000357988 5:160419160-160419182 CTGGCGGGGCCGGGGGCGGAGGG + Exonic
1000502481 5:162068533-162068555 CTGGGGGGAGGGGCGGCGGGCGG + Intronic
1000734418 5:164881504-164881526 ATGGGGGGCGTTGGGGCGGGGGG - Intergenic
1001314685 5:170633697-170633719 GGAGGGGGCGAGGGGGCGGGGGG + Intronic
1001383339 5:171318213-171318235 CTGGGGGTGGTGGGGGCGGGGGG - Intergenic
1001395898 5:171419592-171419614 GCGGGCGGCGAGGGGGCGGGGGG - Intergenic
1001402029 5:171451370-171451392 CTCGGGGGCCAGAGAGCGAGGGG - Intronic
1001424858 5:171616347-171616369 CCTCGGAGCCAGGGGGCGGGGGG - Intergenic
1001435329 5:171695324-171695346 CTGAGGGGCCAGGGTGGGCGAGG - Intergenic
1001568521 5:172715491-172715513 CTGGTGGGCCAGGGAGTGAGAGG + Intergenic
1001857112 5:175022561-175022583 CTGGGGCTGCAGGGGGAGGGAGG + Intergenic
1001960670 5:175878835-175878857 CTGGGGAGAGAGGGGCCGGGTGG - Intronic
1002045409 5:176538682-176538704 GTGGTGGGCCATGGGGCAGGGGG + Intergenic
1002069883 5:176672852-176672874 GTGGCGGGGCATGGGGCGGGGGG + Intergenic
1002081623 5:176740861-176740883 CTGGGGGGCCCCGGGGAAGGCGG + Intergenic
1002123359 5:177022814-177022836 CTGGAGGGCCAGGAGCCGGACGG + Exonic
1002191339 5:177479318-177479340 CTGAGAGGCCAGGGTGTGGGTGG - Intergenic
1002259887 5:177985645-177985667 CTGGCGGGCGGGCGGGCGGGCGG + Intergenic
1002299162 5:178247783-178247805 CTGGGGGGCCAGGGGGGCCAGGG + Exonic
1002524264 5:179806710-179806732 GCGGGGGGCCCGGGGCCGGGCGG + Intronic
1002601640 5:180357064-180357086 CAGAGGGCCCAGGGGGCTGGGGG + Intergenic
1002621992 5:180494522-180494544 CCGGGGGCCGAGAGGGCGGGAGG + Intronic
1002660900 5:180790680-180790702 ATGGGGCGCCTGGGAGCGGGCGG + Exonic
1002813498 6:657037-657059 CTGGGGGGCCGGAGGGAGGGCGG - Intronic
1002879417 6:1238154-1238176 CTGTGGGCCCAGGGGCCAGGTGG + Intergenic
1003112118 6:3259205-3259227 CTGGCGGCCGAGGGTGCGGGCGG + Intronic
1003256884 6:4482738-4482760 ATGGGAGGCCAGGGGGCTCGGGG + Intergenic
1003948179 6:11094076-11094098 CGGGGTGGCCAGAGCGCGGGAGG - Exonic
1004298172 6:14433239-14433261 CTGCGGGGGCAATGGGCGGGGGG + Intergenic
1004716689 6:18223334-18223356 TGGGGGGGGCGGGGGGCGGGCGG - Exonic
1004814868 6:19301897-19301919 GTGTGGGGCCGGGGGGAGGGCGG + Intergenic
1005861960 6:29908571-29908593 CTGGGGTGCCAGGGACCAGGAGG + Intergenic
1006034844 6:31202970-31202992 CTTATGGGCCAGGGGGTGGGAGG + Exonic
1006079938 6:31559253-31559275 CTGGGGGGCCATGAGGAGGCTGG + Intergenic
1006134886 6:31889174-31889196 CTGGGGGGCCGGGCGGGGGCTGG + Intronic
1006306689 6:33225643-33225665 CACAGGGGCTAGGGGGCGGGGGG + Intergenic
1006320679 6:33317657-33317679 GGGGGGGGCCCGGGGGCGCGCGG - Exonic
1006400168 6:33813093-33813115 CTGGGGGGGCGGGGGGCGGGGGG + Intergenic
1006717678 6:36130711-36130733 CTGGGCCGCTGGGGGGCGGGGGG + Intronic
1006837505 6:37007816-37007838 CTGGGGTGCCAGGGAGGGGTGGG + Intronic
1006928649 6:37673928-37673950 CTGGGAGGACAGGGAGCGAGAGG - Intronic
1007150731 6:39688231-39688253 CTGGGAGGCCAGAGGGCAGGAGG + Intronic
1007423890 6:41735005-41735027 CTGGGAGTCGAAGGGGCGGGAGG - Intronic
1007574071 6:42913607-42913629 TTGGGAGGCCGAGGGGCGGGGGG - Intergenic
1007633553 6:43285403-43285425 GTGGGGGGCCGGGGTGAGGGTGG - Exonic
1007656750 6:43455365-43455387 CTGCGGGGACAGGGCGCGGTGGG - Intronic
1007729888 6:43939437-43939459 CTGGTGGGGCAAGGGGCAGGGGG - Intergenic
1007784089 6:44270532-44270554 CTGGGGGGCCGGGCCGGGGGGGG - Exonic
1007967518 6:46015972-46015994 CTGCGGGGTCTTGGGGCGGGGGG - Intronic
1008572503 6:52829270-52829292 CCGTGGGGGCAGGGGGCCGGGGG + Intergenic
1008598744 6:53068087-53068109 CAGGGCGGCCAGGGGGGGGAGGG - Intronic
1009511332 6:64552917-64552939 TTTGGGGGGGAGGGGGCGGGGGG - Intronic
1009842616 6:69095385-69095407 CATGGGGGGCAGGGGGCAGGGGG + Intronic
1010187063 6:73156965-73156987 GTGTGGGGCCACGGGGCTGGGGG + Intronic
1010332840 6:74645240-74645262 GTGGTGGGGTAGGGGGCGGGTGG + Intergenic
1010561562 6:77357592-77357614 ATGGGGGGGCGGGGGGCGGGGGG + Intergenic
1010796538 6:80122965-80122987 CTGGGGGGGCCGGGGGGGAGGGG - Intronic
1011605760 6:89103570-89103592 TTGGGAGGCCAGGGCGGGGGCGG - Intronic
1012401491 6:98845486-98845508 AAGTGGGGCCAGGGGCCGGGAGG + Intergenic
1013013929 6:106144170-106144192 CTGTGGGGCCTGGGGGTGGGAGG - Intergenic
1013069595 6:106716517-106716539 CTGCGGTGGCGGGGGGCGGGGGG - Intergenic
1013225763 6:108118532-108118554 CAGGGGGCGCAGGGGGCGGCCGG + Intronic
1013227944 6:108134055-108134077 CTGGAGGCCGAGGGAGCGGGAGG - Intronic
1013536244 6:111065852-111065874 CTGGGAGGCCAAGGGAGGGGGGG - Intergenic
1014001443 6:116370661-116370683 CTGGCGGGCGGGGGTGCGGGTGG + Intronic
1014098316 6:117482999-117483021 CTGGGGGGACGGAGCGCGGGAGG + Intronic
1015667932 6:135652492-135652514 GTGGGGGGCTGGGGGGAGGGGGG - Intergenic
1015965385 6:138692393-138692415 CAGGGCCGCCAGGGGGCGGGCGG + Intronic
1016005458 6:139084568-139084590 GTTGGGGGCTAGGGGGCTGGGGG - Intergenic
1016050771 6:139527809-139527831 CAGGGGTGACAGGGGGCAGGTGG + Intergenic
1016356123 6:143220086-143220108 CTTAGGGGGCAGGGGGCAGGGGG + Intronic
1016461911 6:144286469-144286491 CTGAGGGGACAGGAGGAGGGGGG + Intronic
1016831872 6:148442233-148442255 TTGGGGGGGCTGGGGGCGGGGGG - Intronic
1016937255 6:149456617-149456639 CTGGGGGGCGGCGGGGCGGGGGG - Intronic
1017705974 6:157123225-157123247 GGGGGGGGGCGGGGGGCGGGGGG - Intronic
1017743741 6:157428630-157428652 CTCGGGGGCTAGGGGCGGGGTGG - Intronic
1017810788 6:157981989-157982011 CTGGGGCGCCTGGGGGCCGAGGG + Exonic
1018086591 6:160306457-160306479 CTGGGGAGAGTGGGGGCGGGTGG + Intergenic
1018400308 6:163414562-163414584 CGGGGAGGGCCGGGGGCGGGCGG - Intronic
1018741730 6:166734150-166734172 CTGAGGGGCAAGGGGGCCGAGGG + Intronic
1018754540 6:166837681-166837703 CGGGAGGGGCAGAGGGCGGGTGG - Intronic
1018761730 6:166899376-166899398 CTGGGTGGCGGGGCGGCGGGGGG + Intronic
1018808126 6:167277068-167277090 CAGGGGAGCCAGTGGGCCGGGGG + Intronic
1018911190 6:168101592-168101614 CTGGGCGGGGAGGGGGCGGGCGG - Intergenic
1019051579 6:169187994-169188016 CAGGGGGGACGGGGAGCGGGGGG - Intergenic
1019074137 6:169373450-169373472 CTGGGGACCCAGGGGGAGCGTGG + Intergenic
1019111967 6:169724089-169724111 CTGGCGGGCCGCGGGGCGCGCGG - Intronic
1019112077 6:169724461-169724483 GTGGGGAGCCAGGCGGCGGCGGG - Intronic
1019193960 6:170270471-170270493 GTGTGGGGCCAGGGGACGTGTGG + Intergenic
1019198531 6:170296211-170296233 CTGGGGGGCCGGGTGTTGGGGGG + Intronic
1019402941 7:866717-866739 CCGGTGGGACGGGGGGCGGGGGG - Intronic
1019429737 7:993165-993187 CTGAGGTCCCAGTGGGCGGGGGG + Intergenic
1019588384 7:1816666-1816688 CTGGGGGCCCAGGGGGAGTCTGG + Intronic
1019592449 7:1842529-1842551 CTGGGGGGCCAGTGAGCACGCGG - Intronic
1019707827 7:2504920-2504942 CTGTGGAGCCGGGGGGGGGGGGG - Intergenic
1019729742 7:2623341-2623363 CTGGGAGGCCAGGGAGGGGCTGG + Intergenic
1019737921 7:2659629-2659651 CTGGGGGACCGGGGAGGGGGCGG + Intronic
1019737962 7:2659752-2659774 CTGGGGGGCCTGGGAGGGGCCGG + Intronic
1020005681 7:4782844-4782866 CTGGGAGGCCACGTGCCGGGCGG - Intronic
1020035331 7:4960080-4960102 GTGGGGGACCTGGGGGTGGGGGG + Intergenic
1020070478 7:5223806-5223828 CTTGGGTGCCAGGGTGCTGGCGG - Intronic
1020094708 7:5361861-5361883 CAGGGGCCCCACGGGGCGGGCGG + Intronic
1020428432 7:8095245-8095267 GTGGGGGGCTGGGGGGTGGGGGG + Intergenic
1021276944 7:18663449-18663471 CTGGGGGGTGAGGGGGAGGGAGG - Intronic
1021710144 7:23407937-23407959 TGTGGGGGGCAGGGGGCGGGGGG + Intronic
1021896356 7:25239687-25239709 CTGGGGGGCGGGGGGTGGGGAGG + Intergenic
1022125179 7:27349445-27349467 CTGGGGGGCCATCGTGAGGGTGG - Intergenic
1022317881 7:29262777-29262799 ATGGGGGTGCAGGGGGAGGGAGG + Intronic
1022478524 7:30727736-30727758 GTGGGGGGCCAGGGGTCAGCAGG + Intronic
1022490868 7:30816605-30816627 TTGGGAGGCAGGGGGGCGGGAGG - Intronic
1022815056 7:33905451-33905473 CTGGGGGGCGGGGGGGTGTGAGG - Intronic
1023805346 7:43869255-43869277 CCTGGGGGCCGGGGGGCCGGGGG - Intronic
1023805351 7:43869262-43869284 CTGGGGGCCTGGGGGCCGGGGGG - Intronic
1023805352 7:43869263-43869285 CCTGGGGGCCTGGGGGCCGGGGG - Intronic
1023842229 7:44104221-44104243 GCGGGGGGGCGGGGGGCGGGGGG - Intergenic
1023969236 7:44979052-44979074 CTGGTGGGGCAGGGCGGGGGCGG - Exonic
1023984896 7:45088718-45088740 GAGGGGGGCCAGGGGGATGGGGG + Intronic
1024043826 7:45574474-45574496 CCGGGGCGCCGGGGCGCGGGCGG - Intronic
1024262045 7:47580607-47580629 CTTGAGGGCCAGGGAGGGGGTGG - Intronic
1024382384 7:48712587-48712609 TTGGGGGGGCGCGGGGCGGGGGG + Intergenic
1024532282 7:50403506-50403528 CTGGGGTGTCAGGGAGGGGGCGG - Intronic
1024558981 7:50627928-50627950 CTGGGAGCCCAGCGGGTGGGTGG - Intronic
1024803497 7:53108480-53108502 CTGCAGGGGCAAGGGGCGGGGGG + Intergenic
1026364733 7:69636483-69636505 TTGGGAGGCCAAGGGGGGGGGGG - Intronic
1026847828 7:73707484-73707506 CTGGGAGGCGAGGGGAGGGGCGG + Intronic
1026866633 7:73828087-73828109 CCGGGGGGGCAGGAGGCGGGCGG + Intronic
1026960309 7:74403771-74403793 CTGGAGGGCCAGGCGGCCAGAGG - Intronic
1026968100 7:74453247-74453269 CGGGGCGGGCGGGGGGCGGGGGG + Intergenic
1026983094 7:74537994-74538016 CTGGAGGGCCAGGGGCCGATGGG + Intronic
1027220582 7:76211351-76211373 CTGGAGTGCCAGGGTCCGGGCGG + Intronic
1027240857 7:76327669-76327691 TTGGGGGGGGAGGGGGGGGGGGG - Exonic
1027390342 7:77697099-77697121 CGTGGGCGCCAGGGGGCGGCGGG - Intronic
1027497358 7:78904788-78904810 CCCGGGGGCCAGGGGAGGGGTGG - Intronic
1027810346 7:82888942-82888964 GGGGTGGGGCAGGGGGCGGGGGG - Intronic
1027908397 7:84215429-84215451 TTGGGAGGCCAAGGGGGGGGCGG - Intronic
1028223094 7:88219743-88219765 CTGCGGGGCCAAGGTGAGGGTGG - Intronic
1028282408 7:88947519-88947541 GTGGGGGGCTAGGGGAAGGGAGG + Intronic
1028459724 7:91077488-91077510 TTGGGGAGTCAGGGGGCGAGGGG + Intronic
1028683602 7:93567695-93567717 GTTGGGGGGCAGGGGGCTGGGGG - Intronic
1029285230 7:99461107-99461129 ATGGAGGGCCAGGGAGTGGGTGG + Intronic
1029287093 7:99473082-99473104 GTGGGGGGCGTGGGTGCGGGGGG + Intronic
1029440496 7:100584412-100584434 CTGGGGGAGGAGGGGGCCGGGGG + Intronic
1029536577 7:101160964-101160986 CTGGCTGGCTAGGGGGAGGGTGG - Exonic
1029570044 7:101363199-101363221 CTCGGGGCCGAGGGGCCGGGGGG + Intronic
1029570050 7:101363206-101363228 CCGAGGGGCCGGGGGGTGGGGGG + Intronic
1029708717 7:102288123-102288145 CTGGGAGGACTGGGGGCAGGGGG + Intronic
1030021468 7:105279185-105279207 TGGGGGTGCCAGAGGGCGGGCGG + Intronic
1030659740 7:112206466-112206488 CTGCGGGGCCCTGGGACGGGAGG - Intergenic
1030772190 7:113488214-113488236 GTGGGAGCCCACGGGGCGGGGGG + Intergenic
1031549200 7:123087264-123087286 TTGGGGGGTCAGGGGGCTAGGGG + Intergenic
1031689217 7:124766343-124766365 CTGGGGGGCGAGGGGCGGGGCGG + Intergenic
1032001417 7:128267850-128267872 TTGGGCTGCCAGGGGTCGGGGGG + Intergenic
1032018138 7:128392636-128392658 CTGGGAGGCTAGGGGCAGGGAGG + Exonic
1032054367 7:128672642-128672664 CTGGGGGAGGGGGGGGCGGGGGG + Intronic
1032517941 7:132520799-132520821 CTGTGGGGCCAGAAGGTGGGTGG - Intronic
1033079653 7:138283319-138283341 CTGGGAGGCCGGGGGGGAGGAGG + Intergenic
1033097324 7:138442572-138442594 CTGGGGGGCTGGGGGCAGGGAGG - Intergenic
1033306771 7:140230913-140230935 CTGGGGGGCGTGGGGGCCGTAGG + Intergenic
1033406369 7:141074007-141074029 CGGGGCGGGGAGGGGGCGGGAGG + Intergenic
1033607703 7:142939620-142939642 CTGGGGGGCCAGGGGAGGCATGG - Exonic
1033929248 7:146503859-146503881 CTGAGGGGACAGGTGGCAGGTGG + Intronic
1034216750 7:149413506-149413528 CTGGGGGGGAGGGGGGAGGGGGG + Intergenic
1034422386 7:150996474-150996496 CTCAGGGGCCGGGGGGCCGGGGG - Exonic
1034445424 7:151111572-151111594 CAGGGGGGTGAGGGGCCGGGGGG - Intronic
1034911662 7:155002977-155002999 CCGCGGGGGCCGGGGGCGGGGGG - Exonic
1034983967 7:155496310-155496332 CTGGGCTGCCATGGGGTGGGGGG + Intronic
1035223260 7:157419121-157419143 CTGGGGGGCCCTGCGGGGGGTGG + Intergenic
1035450424 7:158973996-158974018 GTGGGGGGCCTGGGCGAGGGTGG - Intergenic
1035450443 7:158974036-158974058 GTGGGGGGCCTGGGCGAGGGTGG - Intergenic
1035607440 8:939084-939106 CTGGGGTGCCTGGGAGTGGGAGG + Intergenic
1035607452 8:939121-939143 CTGGGGTGCCTGGGAGTGGGAGG + Intergenic
1035607464 8:939158-939180 CTGGGGTGCCTGGGAGTGGGAGG + Intergenic
1035607476 8:939197-939219 CTGGGGTGCCTGGGAGTGGGAGG + Intergenic
1035607488 8:939234-939256 CTGGGGTGCCTGGGAGTGGGAGG + Intergenic
1035607511 8:939310-939332 CTGGGGTGCCTGGGAGTGGGAGG + Intergenic
1035607525 8:939349-939371 CTGGGGTGCCTGGGAGTGGGAGG + Intergenic
1035607537 8:939388-939410 CTGGGGTGCCTGGGAGTGGGAGG + Intergenic
1035607549 8:939425-939447 CTGGGGTGCCTGGGAGTGGGAGG + Intergenic
1035607561 8:939462-939484 CTGGGGTGCCTGGGAGTGGGAGG + Intergenic
1035607573 8:939501-939523 CTGGGGTGCCTGGGAGTGGGAGG + Intergenic
1035607585 8:939538-939560 CTGGGGTGCCTGGGAGTGGGAGG + Intergenic
1035607597 8:939577-939599 CTGGGGTGCCTGGGAGTGGGAGG + Intergenic
1035607609 8:939614-939636 CTGGGGTGCCTGGGAGTGGGAGG + Intergenic
1035607621 8:939651-939673 CTGGGGTGCCTGGGAGTGGGAGG + Intergenic
1035607633 8:939688-939710 CTGGGGTGCCTGGGAGTGGGAGG + Intergenic
1035607647 8:939727-939749 CTGGGGTGCCTGGGAGTGGGAGG + Intergenic
1035607671 8:939801-939823 CTGGGGTGCCTGGGAGTGGGAGG + Intergenic
1035607683 8:939838-939860 CTGGGGTGCCTGGGAGTGGGAGG + Intergenic
1035680210 8:1482591-1482613 CTCGTGGGCCACGGGGTGGGCGG + Intergenic
1036558819 8:9884245-9884267 GTGTGGGGCAAGGGGGTGGGCGG + Intergenic
1036708035 8:11059613-11059635 CTGGGGGCGCGGGGGGCGCGGGG + Intronic
1038197932 8:25385119-25385141 CTGGGGTGCCAGCGGGGAGGCGG + Intronic
1038313727 8:26465426-26465448 CAGAGGGACCAGGGGGTGGGAGG - Intronic
1038599924 8:28929931-28929953 TTGGCGGGGCGGGGGGCGGGCGG - Intronic
1039020370 8:33198077-33198099 CTGCGGGGTGGGGGGGCGGGGGG - Intergenic
1039419049 8:37420368-37420390 CTGCGGGGACAGGAGGCGGGGGG - Intergenic
1039512921 8:38105816-38105838 CTGGGTTCGCAGGGGGCGGGCGG - Intronic
1040020427 8:42736106-42736128 TTGGGAGGCCTGGGGGTGGGGGG - Intronic
1040844840 8:51826370-51826392 ATGGGGGGCTAGGGGACGAGAGG + Intronic
1040969248 8:53115600-53115622 CTGGGTGGACAGTGGGCTGGGGG - Intergenic
1041256317 8:55982528-55982550 CTGGGGGTCCTGGGTGGGGGAGG - Intronic
1041373974 8:57193544-57193566 CGGGGGCGCCAGGGGGCAGCTGG + Intergenic
1043354962 8:79401546-79401568 GTGGGGGGGCGGGGGGCAGGGGG - Intergenic
1043885235 8:85591656-85591678 CTTGGGAGCCAGGGTGGGGGAGG - Intergenic
1044258727 8:90094326-90094348 CTGAGGGGACAGGCGGAGGGGGG + Intronic
1044637586 8:94342041-94342063 CTGGGTGGCCTGGGGGCAGGGGG - Intergenic
1045367854 8:101493361-101493383 CTGGGAGGCCGGGGGGCGCGGGG + Intronic
1045367858 8:101493369-101493391 CCGGGGGGCGCGGGGGCGGCCGG + Intronic
1045501183 8:102745554-102745576 CTGGGGAGTGAGGGGGCGGAGGG - Intergenic
1045575040 8:103411401-103411423 CTCGGGGGCCAGGGAGGGGCTGG - Intronic
1046199875 8:110911143-110911165 CTGGGGATACAGAGGGCGGGGGG + Intergenic
1046857071 8:119044601-119044623 TTGGGAGGCCAGCGGGAGGGCGG + Intronic
1047274575 8:123396099-123396121 CGGAGGGGCCTGGGGGTGGGCGG - Intronic
1047423715 8:124727687-124727709 CTGCGGGGTCACTGGGCGGGTGG - Intronic
1047425205 8:124739084-124739106 CAGGGGGGCAGGGGGGCAGGGGG + Intergenic
1048375488 8:133818949-133818971 GGCGGGGGGCAGGGGGCGGGGGG + Intergenic
1048477094 8:134753262-134753284 TTGGGGGGGCAGAGGGAGGGTGG + Intergenic
1049027843 8:140008684-140008706 CTGGGAGGCCAGGAGGTGGCAGG - Intronic
1049190884 8:141286732-141286754 GTGGGGAGCGGGGGGGCGGGGGG - Intronic
1049212411 8:141392729-141392751 CTGGTGGCCCAGGGGTGGGGTGG + Intronic
1049257090 8:141619924-141619946 CTGGGGGGCCAGGAGGCATCTGG + Intergenic
1049257547 8:141621915-141621937 CTGGGAGGCCAGGAGTCGGAAGG - Intergenic
1049365624 8:142235430-142235452 ATGGGGGGCCAGGGTGCAGGGGG - Intronic
1049410114 8:142470156-142470178 CTGGGGGGCGGTGGGGCGTGGGG - Intronic
1049427061 8:142542411-142542433 CTGGGGGGCTGGCGGGAGGGCGG - Exonic
1049558133 8:143293830-143293852 CTGAGCAGCCAGGGGGCGGGAGG - Intronic
1049566790 8:143344493-143344515 CTGGGTGGGCATGGGGCTGGGGG - Intronic
1049577037 8:143394250-143394272 CTGTGGGGCCAGGGGGCTGTGGG + Intergenic
1049641412 8:143717635-143717657 CTGGGTGGGCAGGGGATGGGGGG + Intronic
1049687793 8:143945887-143945909 CTGGGCGGCCAGGGGTCGGGCGG + Intronic
1049707763 8:144050772-144050794 CTGGGGGATCCGGGGGAGGGCGG - Intergenic
1049785392 8:144448342-144448364 CTGGGACGCCAGGGGCCTGGAGG - Intergenic
1049830775 8:144699640-144699662 CTGGTGGGCTACGGGACGGGAGG + Intergenic
1049842988 8:144786228-144786250 TTGGGAGGCCAAGGCGCGGGGGG - Intronic
1049957536 9:707294-707316 CCGGGGGGCCTGGGCGAGGGGGG + Intronic
1050130418 9:2406551-2406573 CTGGGGGGCCAGGAGCAGGAAGG + Intergenic
1050460827 9:5875969-5875991 CAGAGGGGCCATGGGGCAGGGGG + Intergenic
1050738034 9:8786758-8786780 GTGGGGGGGCGGGGGGCGAGGGG + Intronic
1051170226 9:14313969-14313991 CAGGAGGGCGAGCGGGCGGGCGG + Intronic
1051404942 9:16727116-16727138 CCGGCGGGCCGGCGGGCGGGCGG + Intronic
1051634112 9:19166137-19166159 ACAGGGGGCCAGGGGGCAGGTGG - Intergenic
1052218651 9:25995511-25995533 CTCGGGGGGCGGGGGGCGGATGG - Intergenic
1052314940 9:27106698-27106720 TTGGGAGGCCAAGGGGGGGGGGG + Intergenic
1052792557 9:32889503-32889525 CTGGGGTGGCAGGGCGGGGGAGG - Intergenic
1052865010 9:33459583-33459605 CTGAGGGGCCAGGGGAGGGGAGG - Intergenic
1052991762 9:34522844-34522866 CTTGGGAGCCTGCGGGCGGGGGG + Exonic
1053612516 9:39729200-39729222 CGGGGGGGCAGGGGGGAGGGAGG + Intergenic
1053707154 9:40767730-40767752 CTGGGGGTCCTGGGGACGAGGGG - Intergenic
1053870548 9:42487171-42487193 CGGGGGGGCAGGGGGGAGGGAGG + Intergenic
1054417067 9:64888498-64888520 CTGGGGGTCCTGGGGACGAGGGG - Intergenic
1054555131 9:66647717-66647739 CGGGGGGGCAGGGGGGAGGGAGG - Intergenic
1054820356 9:69515689-69515711 CTGGGGGGGGGGGGGGCGGGGGG + Intronic
1055369549 9:75582446-75582468 CTGGGGGGCGAGTGTGGGGGTGG + Intergenic
1055497164 9:76867200-76867222 CTGGCGGGGGCGGGGGCGGGGGG - Intronic
1056010250 9:82321700-82321722 CTGGGAGGGCAGGGGGTGGGAGG - Intergenic
1056066142 9:82937039-82937061 TTGGGGGGTGAGGGGGTGGGGGG - Intergenic
1056497668 9:87176145-87176167 ATGGGGGGAGAGGGGGGGGGGGG - Intergenic
1056658931 9:88530843-88530865 CTGGGGGCCCAGGTGGTGGGGGG - Intergenic
1056731061 9:89167104-89167126 CTGGGGGTCCAGCAGGAGGGAGG + Intronic
1056763935 9:89433328-89433350 CAGGGGGGCCAGGCGGTCGGTGG + Intronic
1056812688 9:89776625-89776647 CTGTGGGGCAAGGGGGCAGATGG + Intergenic
1056831433 9:89920305-89920327 CTGGGAGGCCAGGTGGAGGGTGG + Intergenic
1056962560 9:91139129-91139151 CTGGAGGGCCTGGGGGGCGGGGG - Intergenic
1057047930 9:91900203-91900225 CAGGGCCGCCAGGGGGTGGGGGG + Intronic
1057152474 9:92808056-92808078 CTGGGAAGCCAGGGGCCGCGGGG - Intergenic
1057274364 9:93668493-93668515 CTGGGGGTCCTGGGGGTTGGGGG + Intronic
1057995952 9:99821912-99821934 CTGGAGGGGTGGGGGGCGGGAGG - Exonic
1058023711 9:100117596-100117618 CGGGGGGGGCGGGGGGCCGGAGG - Intronic
1058233560 9:102461508-102461530 CTGGTGGGGCAGGGGGTGGCGGG + Intergenic
1058351657 9:104032463-104032485 CTGGGAGGGTAGGGGGTGGGAGG - Intergenic
1058612909 9:106794209-106794231 CAGGGGGGATCGGGGGCGGGGGG + Intergenic
1058687253 9:107489648-107489670 GTGGGGGGCCAGAGGGGCGGGGG + Intronic
1058860458 9:109113075-109113097 CAGCGGGGCCAGGGGCAGGGCGG + Intronic
1059102419 9:111483573-111483595 CTGGGGGGGCAGGGCGCGGCCGG + Intronic
1059206938 9:112476254-112476276 CGGGGGGGGGGGGGGGCGGGGGG - Intronic
1059305435 9:113349853-113349875 CTGGGGAGCCTGGGGCTGGGCGG + Intronic
1059352709 9:113676940-113676962 CTGGGGGGGCAGGTGGAGGTGGG + Intergenic
1059405214 9:114095023-114095045 CTTGGGGGCCTGTGGTCGGGTGG + Exonic
1059474406 9:114532834-114532856 CGGCGGGGGCGGGGGGCGGGGGG + Intergenic
1059517761 9:114911726-114911748 TAGGTGGGGCAGGGGGCGGGGGG - Intronic
1060017422 9:120098725-120098747 CAGGGGAGCATGGGGGCGGGAGG + Intergenic
1060147903 9:121268104-121268126 CGGGGTGGGCAGGGCGCGGGCGG - Intronic
1060186764 9:121568345-121568367 CTTTGGGCCCAGGGGACGGGGGG + Intronic
1060397270 9:123325021-123325043 CTGGGAGGCCTGGGGGTCGGAGG + Intergenic
1060518124 9:124278590-124278612 ATGGTGGGCCAGGGGTGGGGGGG - Intronic
1060555325 9:124504868-124504890 ATGGGGGGCGGGGAGGCGGGAGG - Intronic
1060847642 9:126849852-126849874 GTGGGGGGCGGGGGGGCGGTGGG - Intergenic
1060867946 9:127014676-127014698 CAGGGAGGCCTGGGGGTGGGGGG + Intronic
1060978146 9:127777404-127777426 CTGGGGCGGCAGGGGGATGGGGG - Intronic
1060978166 9:127777454-127777476 CTGGGGCGGCAGGGGGATGGGGG - Intronic
1061190692 9:129081076-129081098 ATGGGGAGCCAGGGGGGCGGTGG - Intergenic
1061196447 9:129109721-129109743 CTACGGGGCCAGAGGGCGGAGGG - Intronic
1061261722 9:129483894-129483916 CTGTGGGGCCAGGGCTGGGGAGG + Intergenic
1061466729 9:130786221-130786243 CTGGGGGGCCCTGGGGCAGAGGG + Intronic
1061489821 9:130938736-130938758 CGGGGCGGCCCGGGAGCGGGCGG + Exonic
1061494419 9:130963529-130963551 GTGCGGGGCGGGGGGGCGGGGGG + Intergenic
1061508727 9:131047608-131047630 CTGGGAGGCCGGGGTGGGGGTGG + Intronic
1061559724 9:131394460-131394482 CCGCGGGGCCTGGGGGCGGCGGG + Intronic
1061571248 9:131478634-131478656 GTGGGGGGGCATGGGGCTGGAGG + Intronic
1061626656 9:131844382-131844404 CTCGGTGGCCAGAGGGCGGAGGG + Intergenic
1061806360 9:133139709-133139731 TTGGGGAGCCAGGGTGTGGGTGG - Intronic
1061828234 9:133274991-133275013 CTGGGGAGCCGGCGGGCAGGTGG - Intronic
1061887276 9:133598141-133598163 CCTGGGAGCCAGGCGGCGGGAGG + Intergenic
1061899559 9:133666050-133666072 CTGGGTGGCCAGGGGTGGTGGGG - Intronic
1061920615 9:133780391-133780413 CTGGGGGACTCGGGGGCAGGAGG + Intronic
1061954981 9:133956696-133956718 CCAGGGGGCGAGGGAGCGGGAGG + Intronic
1062022744 9:134326879-134326901 CGGCGGGGCCGGGGGGCGGGTGG + Intronic
1062023131 9:134328515-134328537 CTGGGAGGCCATGGGCCGGTCGG - Intronic
1062050941 9:134446717-134446739 CTGGGGGGCTGGGGGGCTGCTGG + Intergenic
1062144345 9:134980625-134980647 CTGGGTGGCCGGGGGGCAGGTGG + Intergenic
1062222496 9:135424967-135424989 GTGGGAGGCTGGGGGGCGGGGGG - Intergenic
1062233798 9:135498540-135498562 CATGGGGGGCAGGGGGTGGGTGG - Intronic
1062247354 9:135576061-135576083 GTGGGGGCCCAGGTGCCGGGGGG - Intergenic
1062250938 9:135593039-135593061 CTGGGGGACTCGGGGGCTGGGGG + Intergenic
1062250970 9:135593115-135593137 CTGGGGGGCTCAGGGGCTGGGGG + Intergenic
1062250979 9:135593131-135593153 CTGGGGGGCTTGGGGGCTGGGGG + Intergenic
1062250987 9:135593147-135593169 CTGGGGGACTCGGGGGCTGGGGG + Intergenic
1062389283 9:136327625-136327647 CAGGGCGGGCAGGGGGCGGACGG + Exonic
1062389417 9:136327978-136328000 GTGGGGGGCCGGGGGGCTGGAGG + Intronic
1062395751 9:136351944-136351966 CTGGGGCGTCAGTGGCCGGGTGG + Intronic
1062466067 9:136682211-136682233 CTGCGGAGCCCGGGGGAGGGAGG - Intronic
1062526085 9:136978599-136978621 CTAGGGGGGCATGGGGCGTGAGG + Intronic
1062531122 9:137000868-137000890 TTGGGGGGCCGGAGGGCTGGGGG + Intergenic
1062532816 9:137009250-137009272 CTGTGGGGCCAGGGGGGCTGGGG - Intronic
1062533806 9:137012959-137012981 CTGGGGGGGCAGGGGCAGTGAGG - Intronic
1062568772 9:137174911-137174933 CTGGCGGGCGGGCGGGCGGGCGG + Exonic
1062580709 9:137228095-137228117 GGGGGTGGGCAGGGGGCGGGGGG + Intronic
1062588735 9:137263507-137263529 CAGGAGGGCCAGGGGGAAGGAGG - Intronic
1062592480 9:137280564-137280586 CTGGCGGGCCCGGGGTTGGGGGG - Exonic
1062615925 9:137395639-137395661 CAGGGAGGGCAGGGGGTGGGAGG + Intronic
1062655934 9:137604797-137604819 CGGGGAAGGCAGGGGGCGGGGGG + Intergenic
1062686064 9:137814066-137814088 CTTGTGGGGCGGGGGGCGGGGGG - Intronic
1062696843 9:137879985-137880007 GTGGGGGCCCAGGGGGTGCGGGG + Intronic
1203360422 Un_KI270442v1:216632-216654 CTGGGCAGGCGGGGGGCGGGCGG + Intergenic
1185648664 X:1632857-1632879 CTGGGGGGCTGGGAGGCTGGGGG + Intronic
1185747550 X:2584451-2584473 CGGGGGGCCCTGGGGGCGGCCGG + Intergenic
1185959949 X:4538558-4538580 ATGGGAGGCCAGGGGGCTGCGGG + Intergenic
1186451142 X:9674684-9674706 CTGGGGGGGGGGGGGGGGGGGGG - Intronic
1187443966 X:19344322-19344344 CAGCTGGGCCCGGGGGCGGGAGG - Intronic
1187669655 X:21656479-21656501 GTCGGGGGCCTGGGTGCGGGCGG - Exonic
1187976955 X:24712325-24712347 TTGGGAGGCCACGAGGCGGGCGG - Intronic
1189556823 X:42153575-42153597 CTCAGGGGGCAGGGGGCAGGGGG + Intergenic
1189848598 X:45158008-45158030 CTGGGGGGCCAGGTGGGGCGTGG + Intronic
1189865298 X:45321294-45321316 GTGGGGGGACAGGGGCAGGGAGG + Intergenic
1190052157 X:47158361-47158383 CTGGGTGGCCAGGGGTGGGGGGG - Intronic
1191112828 X:56821166-56821188 TTCGGAGGCCAAGGGGCGGGCGG - Intergenic
1192201052 X:69066989-69067011 CTGTGGGGGCAGGGAGGGGGAGG + Intergenic
1192251432 X:69417032-69417054 GGGGGGGGAGAGGGGGCGGGGGG - Intergenic
1192362065 X:70446421-70446443 GTGGGGTGGCGGGGGGCGGGGGG + Intronic
1192584025 X:72306301-72306323 CTGGCGGGCGGGCGGGCGGGCGG + Intronic
1192630957 X:72777489-72777511 CTGCGGGGGCGGGGGGCGGCGGG - Intronic
1192650752 X:72943312-72943334 CTGCGGGGGCGGGGGGCGGCGGG + Intronic
1193601007 X:83508539-83508561 CTGCTGGTCCAGGGGGCTGGTGG - Exonic
1193722719 X:85005398-85005420 TTGGGAGGCCCGGGGGGGGGGGG - Intronic
1195379244 X:104255304-104255326 CGAGGGGGCGAGGGGGCGAGGGG + Intergenic
1195379248 X:104255312-104255334 CGAGGGGGCGAGGGGGCGAGGGG + Intergenic
1195446417 X:104957455-104957477 CTGGGGGTTCAGAGGGAGGGAGG + Intronic
1195827593 X:109019473-109019495 GTCGGGGGCTAGGGGGCTGGGGG - Intergenic
1195992121 X:110693159-110693181 GGGTGGGGGCAGGGGGCGGGTGG + Intronic
1196016419 X:110944689-110944711 CTGGGAGGGCACGGGGCGGGAGG + Intronic
1196854528 X:119970376-119970398 GGGGGGGGGCGGGGGGCGGGGGG + Intergenic
1197753254 X:129979919-129979941 GTGGGGGGCCGGGGGAGGGGCGG + Intergenic
1198152249 X:133922659-133922681 GCGGGGGGCAAGGGGGCGGTTGG - Intronic
1198215308 X:134549737-134549759 CTCCGGGGCCCGGGGGCGGAAGG + Intergenic
1198242851 X:134802019-134802041 CTGGTGGGGCAGGGGGGTGGGGG - Intronic
1198517560 X:137425031-137425053 GGCGGGGGCCCGGGGGCGGGGGG + Intergenic
1198972129 X:142293456-142293478 CCGGGGGGTTGGGGGGCGGGGGG + Intergenic
1199017056 X:142830449-142830471 GTGGGGGGCGGGGGGGCGGAGGG - Intergenic
1199086621 X:143635582-143635604 CTGGAGAGCCTGGGGGAGGGGGG + Intronic
1199609282 X:149599491-149599513 GGGGGGGACCAGGGGGTGGGGGG - Intronic
1199832945 X:151562811-151562833 CGGGGGGGGCGGGGGGTGGGGGG + Intergenic
1199832956 X:151562826-151562848 GTGGGGGGGCGGGGGGCGGGGGG + Intergenic
1199832976 X:151562856-151562878 TCGGGGGGGCGGGGGGCGGGGGG + Intergenic
1199832989 X:151562873-151562895 GGGGGGGGCGGGGGGGCGGGGGG + Intergenic
1200045857 X:153400832-153400854 CTGTGGGGCTGGGGGTCGGGAGG - Intergenic
1200053920 X:153448860-153448882 CTTGGGGGGCAGGGGGCAGGTGG - Intronic
1200100763 X:153688315-153688337 GTCGGGGGCCCGGGGGCGCGCGG - Exonic
1200179849 X:154143655-154143677 ATGGGGGGCAAGGGGGAGGAGGG + Intergenic
1200247579 X:154534298-154534320 CCGGGGGACCAGGGTGGGGGTGG - Intronic
1201140466 Y:11023281-11023303 ATGGGGGGCGGGGGGGTGGGGGG - Intergenic
1201424162 Y:13831097-13831119 TTGGGGGTCCAGGGGAAGGGTGG + Intergenic