ID: 955267832

View in Genome Browser
Species Human (GRCh38)
Location 3:57464298-57464320
Sequence ATTCTGCAGCACCACACTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 3, 2: 11, 3: 46, 4: 178}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955267827_955267832 28 Left 955267827 3:57464247-57464269 CCCTGGAAATGTTACTCTGTAAG 0: 1
1: 0
2: 1
3: 20
4: 186
Right 955267832 3:57464298-57464320 ATTCTGCAGCACCACACTGTAGG 0: 1
1: 3
2: 11
3: 46
4: 178
955267829_955267832 5 Left 955267829 3:57464270-57464292 CCACAGAAGATGCCAAATCAGAG 0: 1
1: 2
2: 32
3: 73
4: 252
Right 955267832 3:57464298-57464320 ATTCTGCAGCACCACACTGTAGG 0: 1
1: 3
2: 11
3: 46
4: 178
955267831_955267832 -7 Left 955267831 3:57464282-57464304 CCAAATCAGAGTGGCTATTCTGC 0: 1
1: 4
2: 33
3: 86
4: 180
Right 955267832 3:57464298-57464320 ATTCTGCAGCACCACACTGTAGG 0: 1
1: 3
2: 11
3: 46
4: 178
955267828_955267832 27 Left 955267828 3:57464248-57464270 CCTGGAAATGTTACTCTGTAAGC 0: 1
1: 0
2: 0
3: 11
4: 131
Right 955267832 3:57464298-57464320 ATTCTGCAGCACCACACTGTAGG 0: 1
1: 3
2: 11
3: 46
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955267832 Original CRISPR ATTCTGCAGCACCACACTGT AGG Intronic
902569357 1:17336952-17336974 ATTAAGCAGCCCCACCCTGTAGG - Intronic
902867555 1:19289160-19289182 ATTCTCCAGGACCACACGGCAGG - Exonic
904275289 1:29379820-29379842 ATTAAGCAGCACCATGCTGTAGG - Intergenic
904426565 1:30427628-30427650 GTTCAGCAGCACCACATTGTAGG + Intergenic
904823799 1:33261854-33261876 ATACTGCAGCAGCAGCCTGTTGG - Intronic
906538046 1:46562828-46562850 ATTCTGCAGAGCCACACTGTGGG + Exonic
907692960 1:56689187-56689209 CTGCTGTAGCACCTCACTGTAGG - Intronic
907878979 1:58525768-58525790 ATTCTGCAGAACAACACTGGAGG + Intronic
916048981 1:161021592-161021614 TTTCTGCAGGACCAAACTGCAGG - Intronic
916389580 1:164316903-164316925 TTTCTGCAGCACCACTCAGGAGG + Intergenic
916468373 1:165094930-165094952 GTTCAGCAGCACCACAGCGTAGG + Intergenic
917840812 1:178975982-178976004 ATCCTGCAGCATCACTCTTTGGG + Intergenic
918229868 1:182518431-182518453 GTTCAGCAACATCACACTGTAGG - Intronic
921146356 1:212361593-212361615 GCTCTGTATCACCACACTGTGGG - Exonic
921942195 1:220853730-220853752 GTTCAGCAGCACCATGCTGTAGG - Intergenic
923888148 1:238180723-238180745 ATTCTGCAGGACCCCCTTGTTGG - Intergenic
1062797906 10:358496-358518 ATTCTTCCACACCTCACTGTGGG - Intronic
1063475145 10:6321808-6321830 ATTCTGCAGTGCAACCCTGTAGG + Intergenic
1063492799 10:6480466-6480488 ATGATGCAGCAACACACTGTTGG + Intronic
1064014227 10:11760370-11760392 GTTCTGCAGCTACACACTGCCGG + Intronic
1069126805 10:64645222-64645244 TTACTGCAGCACTATACTGTTGG + Intergenic
1069804693 10:71112980-71113002 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1070040357 10:72772204-72772226 GTTCAGCAGCACCATGCTGTAGG + Intronic
1070584859 10:77756487-77756509 GTTCAGTAGCACCACACTGTAGG + Intergenic
1072552350 10:96488452-96488474 AGTCTGCAGGACCGCAGTGTGGG - Intronic
1072772096 10:98150713-98150735 GTTCAGCAGCACCACGCTGTAGG - Intronic
1073595180 10:104792393-104792415 ATTCTTCAGAACCACATTGTTGG + Intronic
1074616582 10:115075008-115075030 ACTCTTCACCACCACACTGGTGG + Intergenic
1074878947 10:117636643-117636665 AGTCTCCATGACCACACTGTTGG + Intergenic
1076926329 10:133490001-133490023 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1077846135 11:6026915-6026937 TTTCTTCAGCACCATACTGCTGG - Exonic
1077858293 11:6151515-6151537 TTTCTGCTGCAACACACTATAGG + Intergenic
1078156897 11:8807280-8807302 CTTCTGAAGCACCTCCCTGTGGG - Intronic
1078264986 11:9748547-9748569 TTTCTGTAGCACCTCCCTGTGGG - Intronic
1078616705 11:12872557-12872579 TTTCTCCATCACCACACTGTTGG - Intronic
1079273967 11:19016234-19016256 ATTCTGCTGCACCACATGGAAGG + Intergenic
1079345268 11:19646289-19646311 ATTCTGCAGCCCCTCAAGGTTGG - Intronic
1080716995 11:34812505-34812527 GTTCAGCAGCACCATACTGTAGG + Intergenic
1080799735 11:35599044-35599066 ACTCTGCAGCATCATTCTGTGGG + Intergenic
1081040292 11:38201496-38201518 ATTCAGCAGCATCATGCTGTAGG + Intergenic
1085457763 11:76674823-76674845 TTTCTGCAGCACCAGGCTGCTGG + Intergenic
1085829079 11:79880515-79880537 ATTCTGCACCCCCACCCTTTGGG - Intergenic
1088113413 11:106288247-106288269 CTTCTGCAGCTCCCCACTCTGGG - Intergenic
1090424439 11:126597256-126597278 ACTCTGCAGCTCCGCAATGTCGG + Intronic
1090832672 11:130429823-130429845 ATGCTGAACCACCACACTGCAGG - Intergenic
1091331138 11:134731746-134731768 ATGCCGGAGCCCCACACTGTGGG - Intergenic
1091865958 12:3837128-3837150 ATTCAGCAACACCACATTGTAGG + Intronic
1092292977 12:7175212-7175234 ATTCTGCAGCAACAGGCAGTAGG + Intergenic
1093142663 12:15527549-15527571 GTTCAGCAGCACCATACTGTAGG + Intronic
1094471694 12:30807462-30807484 CTTCAGCAGCACCATGCTGTAGG + Intergenic
1095777632 12:46026740-46026762 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1097985207 12:65775775-65775797 ATTATGGAGCACCACACTGGAGG - Intergenic
1099426980 12:82535423-82535445 ATTCTGCAGGACCACCTTATGGG + Intergenic
1099434551 12:82627897-82627919 GTTCAGCAGCACCGCACTGTAGG + Intergenic
1101364359 12:104058000-104058022 GTTCAGCAGCACCACACTGTAGG - Intronic
1102020298 12:109677680-109677702 ATCCTGCAGCCCGACACTGGGGG + Intergenic
1102540067 12:113612260-113612282 ATTCTCCTGCAGCAAACTGTCGG + Intergenic
1104147018 12:126044374-126044396 ATTGTGCAGCCCTACACCGTGGG - Intergenic
1105647076 13:22332536-22332558 ATATTGCAGTTCCACACTGTTGG - Intergenic
1106859770 13:33893162-33893184 GTTCAGCAGCACCACACCATTGG + Intronic
1108165588 13:47689813-47689835 GTTCTGCAGCAGCACACTGGAGG + Intergenic
1108258392 13:48632383-48632405 ATGCTTCTGCACCTCACTGTTGG - Intergenic
1109480517 13:62946037-62946059 TTTCTGCAGCACGACACTCTTGG + Intergenic
1110584018 13:77166488-77166510 ACTGTGCAGTACCACACTGAGGG + Exonic
1110809045 13:79791530-79791552 ATACTGCAGCCCCACTCTGTAGG - Intergenic
1112038743 13:95524168-95524190 ATTCTGTAGCATCACAATGATGG + Intronic
1112378562 13:98866290-98866312 ATTCTGAAGCTCGACACAGTTGG + Intronic
1113439160 13:110314560-110314582 TTTCTGCAGCACCACATGGGAGG + Intronic
1113839824 13:113352871-113352893 ATCCAGCAGCCCCACACTCTAGG + Intronic
1114365894 14:22026817-22026839 ATTCTGCAGCAACAGCCTGGAGG + Intergenic
1115279675 14:31647575-31647597 GTTCAGCAGCACCACATTGTAGG - Intronic
1117456406 14:55901530-55901552 CTTCTGCCCCAACACACTGTTGG - Intergenic
1118547346 14:66906183-66906205 GTTCAGCAGTACCACGCTGTAGG - Intronic
1120381100 14:83780811-83780833 AATCAGCAGCACCAGACTGGAGG - Intergenic
1121713128 14:96053767-96053789 AGTCTCCAGCAGCCCACTGTGGG + Intronic
1125403275 15:39327123-39327145 AAGCTGCAGCACCACATGGTTGG - Intergenic
1126804402 15:52331753-52331775 ATGCTGCAGCAGCACACACTGGG + Intronic
1127739844 15:61892261-61892283 GTTCAGCAGCACAACACTGTGGG + Intronic
1130647383 15:85741041-85741063 CTGCTGCAGCACCACACCCTGGG - Exonic
1131342385 15:91614501-91614523 CTTCTGCAGCCCCTCGCTGTGGG - Intergenic
1133125018 16:3641141-3641163 CTGCTGCAGCTCCACGCTGTGGG + Intronic
1133550872 16:6853477-6853499 GTCCTCGAGCACCACACTGTAGG - Intronic
1134306748 16:13039908-13039930 ATTCTTCATCACCACAGTGGTGG + Intronic
1135588173 16:23687233-23687255 ATCCTGCAGGGCCACACCGTTGG + Intronic
1137688013 16:50400449-50400471 ATTTTTCAGCACAACACTGCAGG + Intergenic
1139047175 16:63076056-63076078 GTTCAGCAGCACCACAGTGTAGG - Intergenic
1139316190 16:66071115-66071137 TTTCTGCAGCATCACACAATAGG + Intergenic
1139342235 16:66275123-66275145 ATGGTGCAGCACCACCCTCTTGG + Intergenic
1141441338 16:84031564-84031586 ATTCTGTACCTCCACACTGTGGG + Intronic
1144767363 17:17740008-17740030 ATGCTGCAGCCCCACCCTGAGGG + Intronic
1147579644 17:41621041-41621063 ACTCTGCACCAGCTCACTGTTGG + Exonic
1148403438 17:47388031-47388053 GTTCAGCAGTACCACACTGTAGG - Intronic
1150163752 17:62921705-62921727 ATTCTCAAGCACCTCACTGGTGG - Intergenic
1153722606 18:7922248-7922270 GTTAAGCAGCACCTCACTGTAGG - Intronic
1154287632 18:13075067-13075089 ACTCTGCAGTACAACAGTGTTGG + Intronic
1155113702 18:22742621-22742643 GTTCAGCAGCACCACACTGTAGG + Intergenic
1155978007 18:32152761-32152783 GTTCAGCAGCACCACACTGTAGG - Intronic
1156353389 18:36321162-36321184 ACGATGCAGAACCACACTGTTGG - Intronic
1157996593 18:52564898-52564920 ACTCTCCAGCAACACACTCTAGG - Intronic
1158489518 18:57897576-57897598 ACTGTGCAGCACGACACAGTAGG - Intergenic
1160429094 18:78799245-78799267 TTTCACCAGCACCACACTGCTGG + Intergenic
1161403156 19:4077845-4077867 AGTCTTCAGCTCCACACTGGGGG - Intergenic
1162265753 19:9572560-9572582 GTTCAGGAGCACCATACTGTAGG + Intronic
927297512 2:21471367-21471389 ATTCTGCAGCAGGAGACTCTGGG - Intergenic
927921830 2:26978398-26978420 TTTCCGCAGCACCAGACTCTTGG + Intronic
930310464 2:49733097-49733119 ATTCAGCAGCACCCCACTCCTGG + Intergenic
931542067 2:63340350-63340372 ATTCAGCAGCACCACACTTTAGG - Intronic
932799774 2:74730796-74730818 TTAGAGCAGCACCACACTGTAGG - Intergenic
934704121 2:96464388-96464410 ATTCTGGGGAACCACACTGGTGG - Intergenic
935528865 2:104207487-104207509 ATTCTGCAGCAAGATACAGTAGG - Intergenic
936851567 2:116905229-116905251 ATTAAGCAGCACCATCCTGTAGG - Intergenic
937940359 2:127280480-127280502 ATTCTGCAGCTCCATCCAGTTGG + Exonic
938653951 2:133411765-133411787 TTTCTGCATTTCCACACTGTTGG - Intronic
939080410 2:137654297-137654319 GTTCAGCAGTACCACGCTGTAGG - Intronic
939510776 2:143101688-143101710 ATTCTGAAGGACCACCCTGCTGG - Intronic
939847586 2:147267534-147267556 ATTCAGCAGCACCACACTGTAGG - Intergenic
940436578 2:153663632-153663654 TTTCTGCAGCTCCAAACTGGGGG + Intergenic
940532013 2:154889850-154889872 GTTCGGCAGCACCACATTGTAGG - Intergenic
941360610 2:164546856-164546878 GTTCAGCAGCACCACACGATAGG + Intronic
941919918 2:170840159-170840181 AGTCTTCAGAACCACTCTGTAGG - Intronic
945605026 2:211918460-211918482 ACTCTGGTGCACCACAGTGTAGG - Intronic
945676680 2:212863470-212863492 GTTCAGCAGCATCACCCTGTAGG - Intergenic
946263562 2:218518837-218518859 ATGCAGCATCATCACACTGTGGG - Intronic
946555933 2:220857352-220857374 CTTCTGAAGCACCTCACAGTGGG - Intergenic
947387879 2:229610259-229610281 TTTCTGCAGCACGACACAGTGGG - Intronic
948739962 2:240039849-240039871 GTTCAGCAGCACCATGCTGTAGG - Intergenic
948966995 2:241390208-241390230 ATCCTGCATCACAAAACTGTGGG - Intronic
1170863492 20:20130774-20130796 GTTCAGCAGCACCACACTGTAGG - Intronic
1171117483 20:22537568-22537590 GTTCTTCACCACCACACTCTAGG + Intergenic
1172582728 20:36061177-36061199 AGCCTGCAGGCCCACACTGTGGG + Intergenic
1173203061 20:40968257-40968279 ATTCTGTAGCCCCAAAATGTTGG - Intergenic
1174391536 20:50221007-50221029 ATTAAGCAGCACCACCCTGGTGG - Intergenic
1177339715 21:19783600-19783622 ATCCTGCAGAACCACAATGGTGG - Intergenic
1178932612 21:36832895-36832917 CTTCTCTAGCACCACACTTTTGG + Intronic
1179045444 21:37840419-37840441 ATTCTTCAGCTCCATACTGTGGG + Intronic
1179483749 21:41695414-41695436 GTGCTCCAGCACCACAGTGTAGG + Intergenic
1180670548 22:17549300-17549322 CGTCTGCAGCATCACACTGTGGG - Exonic
1181416440 22:22762731-22762753 CCTCTGCAGCACCAACCTGTAGG - Intronic
1182815063 22:33155166-33155188 TTTCAGCAGCACCCCACTCTTGG - Intergenic
1184587525 22:45458063-45458085 ATCCTACAGCCCCACACTATTGG + Intergenic
951453689 3:22867406-22867428 TTTCTGCAGCAACCAACTGTGGG + Intergenic
951923306 3:27879284-27879306 GTTCTGAAGCACTACACTGGTGG + Intergenic
952972684 3:38662633-38662655 GTTCAGCAGCAACACACTGTAGG + Intergenic
953206011 3:40829871-40829893 AATTTGCAGCACCATACTATCGG - Intergenic
955267832 3:57464298-57464320 ATTCTGCAGCACCACACTGTAGG + Intronic
955395226 3:58552470-58552492 GTTCAGCAGCACCATGCTGTAGG - Intergenic
959679826 3:109082040-109082062 GTTCAGCAGCATCACACTGCAGG + Intronic
960622244 3:119648228-119648250 ATCCTCCAGCACCAGACTGGTGG + Intronic
962763309 3:138538286-138538308 GTTCAGCAGCACCACACTGTAGG + Intronic
963404116 3:144840659-144840681 CTTCAGCAGCATCACACTATAGG - Intergenic
963819267 3:149869996-149870018 ATTCAGTAGCACCATACAGTAGG - Intronic
964480641 3:157135059-157135081 ATTCAGCAACTCCACTCTGTGGG - Intergenic
965567802 3:170139193-170139215 AGTCTGCAGCACCGAACTGCAGG - Intronic
966765207 3:183455283-183455305 CTTCTGCAGTACCACAGTGGAGG + Intergenic
967178937 3:186886320-186886342 GTTCTGCATCCCCACACTGAGGG - Intergenic
968265471 3:197359659-197359681 TTTCAGCAGCACCCCACTCTTGG - Intergenic
969473823 4:7409399-7409421 GTTCAGCAGCACCATGCTGTTGG - Intronic
970624518 4:17862101-17862123 TTTCAGCAGCACCCCACTCTTGG + Intronic
971797346 4:31244696-31244718 ATTCAGCAGCACCACACTGTAGG + Intergenic
972227686 4:37032745-37032767 GTTCTGCATCATGACACTGTGGG - Intergenic
973977520 4:56277629-56277651 ATTCTACAGTACTATACTGTTGG + Intronic
977519922 4:98068993-98069015 ATTATGCAGCACAAGACTGTAGG + Intronic
979380796 4:120004189-120004211 GTTCAGCAGCACCACATTATAGG + Intergenic
980066209 4:128191628-128191650 GTTCAGCAGGACCACACTGTAGG - Intronic
980868045 4:138576758-138576780 ATTCAGCAGCACCATGCTGTAGG + Intergenic
981900692 4:149858378-149858400 ATTCAGCAGCACCATGCTGTAGG + Intergenic
982994236 4:162320273-162320295 AATCTCCAGCACAACAATGTGGG - Intergenic
983129931 4:164005775-164005797 GTTTGGCAGCACCACATTGTAGG + Intronic
983655622 4:170080587-170080609 GTTCAGCAGCACCACACTGCAGG + Intronic
983917485 4:173308131-173308153 AATCTGCAGCAACACAATGGAGG - Intronic
984379620 4:178974852-178974874 ATTCAGCAGAAGCACCCTGTTGG + Intergenic
984482186 4:180319576-180319598 ATTCTTCAACAACACACTGACGG - Intergenic
985351107 4:189062225-189062247 GCTCACCAGCACCACACTGTGGG + Intergenic
986793449 5:11186202-11186224 ATTCTGCAGCAGTAAAATGTTGG - Intronic
988080568 5:26410025-26410047 TTACTGCAGCACCCCACTCTTGG - Intergenic
988361041 5:30236994-30237016 ATTGTGCATCCCCACACTGAGGG - Intergenic
989390339 5:40894066-40894088 ATTCAGCAGCAGCACACTATAGG - Intergenic
990605634 5:57407034-57407056 ATCCTGCAGCACCTCTCTGAAGG + Intergenic
991011596 5:61888409-61888431 GTTCAGCAGCACCACACTTTAGG + Intergenic
992654976 5:78900202-78900224 ATTCAGCAGCACCACACTGTAGG - Intronic
993414202 5:87605843-87605865 ATTCAGCAGTACCAACCTGTAGG - Intergenic
994597170 5:101854205-101854227 GTTCAGCATCAGCACACTGTAGG + Intergenic
994664992 5:102695246-102695268 ATTCTGCAGGACCCCCTTGTTGG - Intergenic
995220265 5:109640528-109640550 TTTCAGCAGCACCTCACTCTTGG - Intergenic
995278792 5:110308861-110308883 GTTTAGCAGCACCATACTGTAGG + Intronic
996113454 5:119592340-119592362 GTTCTGCAGCACCATGCTGTAGG + Intronic
996293482 5:121883091-121883113 ATTGTGCAGAAACACAATGTGGG + Intergenic
997164583 5:131646191-131646213 ATTCTGTAGTACCACACTGTTGG - Intronic
999412402 5:151363277-151363299 GTTCAGCAGCACCACACTGTAGG - Intergenic
999969765 5:156847612-156847634 ATTCAGCAGCAGTACATTGTAGG + Intergenic
1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG + Intronic
1003590867 6:7435581-7435603 ATTTAGCAGTACGACACTGTAGG + Intergenic
1005850345 6:29816154-29816176 AGTCTGCAGCTGCACACTGTGGG - Intergenic
1006010728 6:31040892-31040914 AATCTGCAGAATCAAACTGTGGG + Intergenic
1010564528 6:77393350-77393372 ATACTTCAGCACTACACTTTGGG + Intergenic
1013184005 6:107741586-107741608 GTTACGCAGTACCACACTGTAGG + Intronic
1013936985 6:115608320-115608342 ATTCTGCAGCATATTACTGTGGG - Intergenic
1014130789 6:117829862-117829884 CTTCAGCAGCACCACACAGTAGG + Intergenic
1015216856 6:130760076-130760098 ATTCAGCAGCACCATGCTATAGG + Intergenic
1016615356 6:146041622-146041644 GTTCAGCAGCACCACATTGTAGG - Intronic
1016636474 6:146297959-146297981 ATTCTTCAGCACCACAGAGAAGG - Intronic
1016651129 6:146462228-146462250 ATTCAGTAGCACTGCACTGTTGG - Intergenic
1017186425 6:151605412-151605434 GTTCAGCAGGACCACACTGTAGG - Intronic
1017934132 6:158989534-158989556 GTTCAGCAGCACCACATTGTAGG - Intronic
1019089949 6:169520158-169520180 GCTCAGCATCACCACACTGTAGG + Intronic
1021771830 7:24010811-24010833 GTTCAGCAGCACCACACTGTAGG - Intergenic
1023060327 7:36320543-36320565 TTTCAGCAGCACCCCACTGCTGG - Intergenic
1023998962 7:45178543-45178565 CATCTGCAGCCCCACTCTGTGGG + Intronic
1024601174 7:50982863-50982885 ATTCAGCATCTCCACACTGAGGG - Intergenic
1025634632 7:63311753-63311775 CTTCTGCAACAGGACACTGTTGG + Intergenic
1025648064 7:63436417-63436439 CTTCTGCAACAGGACACTGTTGG - Intergenic
1028560362 7:92168460-92168482 ATTCAGCAGCACCATGCTGTAGG + Intronic
1028621624 7:92834184-92834206 ATTCTGCGGCCCCACACGGATGG - Intronic
1030198820 7:106880985-106881007 ATTTTCCAGGTCCACACTGTTGG - Intronic
1034681757 7:152934168-152934190 TTTCGGCAGCACCACAATGTCGG - Intergenic
1035890162 8:3334831-3334853 AGTCTGCAGATCCACACTGCAGG + Intronic
1041989470 8:63968472-63968494 ATTCTGCAGCAGGAGTCTGTGGG - Intergenic
1042002341 8:64138699-64138721 ATTCAGCAGCACTGTACTGTAGG + Intergenic
1046941092 8:119932316-119932338 GATCTGCATAACCACACTGTGGG + Intronic
1047476657 8:125238851-125238873 GTTCTGCAGTAAGACACTGTGGG + Intronic
1055557331 9:77488527-77488549 GTTCAGCAGCATCACTCTGTAGG + Intronic
1059897591 9:118884378-118884400 TTTCTCCAACTCCACACTGTAGG - Intergenic
1059911521 9:119049777-119049799 ATACTGCAGCACAGCACTCTAGG - Intergenic
1059969807 9:119654166-119654188 ATTCTGTAGCTTCACACTGAAGG + Intergenic
1060166955 9:121425315-121425337 GTTCAGCAGCACCACGCTGTGGG + Intergenic
1060806540 9:126581173-126581195 ATTCACCAACTCCACACTGTGGG + Intergenic
1062003348 9:134227681-134227703 ACCCTGAAGCACCACACTCTGGG + Intergenic
1187854719 X:23625799-23625821 ATTCTGCAGCACTATTCTGGTGG + Intergenic
1188382018 X:29506675-29506697 ATTCAGCAGTACTATACTGTAGG - Intronic
1188903135 X:35759739-35759761 GTTCAGTAGCACCACACTGTAGG - Intergenic
1190508151 X:51149158-51149180 GTTTAGCAGCACCACACAGTAGG - Intergenic
1192521931 X:71809823-71809845 GTTCAGCAGCGCCACACTGTAGG - Intergenic
1196882779 X:120213718-120213740 GTTTAGCAGCACCACACTGTAGG + Intergenic
1196987106 X:121286368-121286390 GTTCGGCAGCACCACACGGTAGG - Intergenic
1197260612 X:124313209-124313231 GTTCAGCAGCACCACACTGCAGG + Intronic
1197267498 X:124391027-124391049 ATTCTCCAGCAACAAACTCTGGG + Intronic
1197551103 X:127893815-127893837 ATTTAGCAACACCACACAGTAGG - Intergenic
1199194821 X:145016010-145016032 ATTCAGCAGCACCATGCTATAGG + Intergenic
1199895290 X:152120704-152120726 ATTCTGTGGCCCCTCACTGTGGG + Intergenic