ID: 955270857

View in Genome Browser
Species Human (GRCh38)
Location 3:57497357-57497379
Sequence AAATCAAGGCAGCATGGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 17419
Summary {0: 1, 1: 4, 2: 80, 3: 1149, 4: 16185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955270854_955270857 -9 Left 955270854 3:57497343-57497365 CCATTGAACTACAGAAATCAAGG 0: 1
1: 0
2: 0
3: 19
4: 246
Right 955270857 3:57497357-57497379 AAATCAAGGCAGCATGGTACTGG 0: 1
1: 4
2: 80
3: 1149
4: 16185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955270857 Original CRISPR AAATCAAGGCAGCATGGTAC TGG Intronic