ID: 955271068

View in Genome Browser
Species Human (GRCh38)
Location 3:57499975-57499997
Sequence ACAAGGTCCCTTGAGGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955271063_955271068 -5 Left 955271063 3:57499957-57499979 CCAGTTTTAACCAATAGAACAAG 0: 1
1: 0
2: 1
3: 9
4: 187
Right 955271068 3:57499975-57499997 ACAAGGTCCCTTGAGGAGGTAGG 0: 1
1: 0
2: 2
3: 17
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955271068 Original CRISPR ACAAGGTCCCTTGAGGAGGT AGG Intronic
903441288 1:23389870-23389892 ACCAGCTCCCTTGAGCTGGTAGG + Intronic
904565622 1:31426573-31426595 ACAGGGTCCCTCGAGGGAGTAGG + Intronic
905366553 1:37454770-37454792 ACAAGGGCCCTTCAGGGAGTAGG - Intergenic
913271185 1:117095062-117095084 GCAAGCTGCCTTGAGGAGCTTGG + Intronic
913276848 1:117146513-117146535 ACAAAGACTCTTGGGGAGGTGGG + Intronic
914808134 1:151006723-151006745 ACAAGCTCCCTGGAGGAGGAGGG + Intronic
915689755 1:157676995-157677017 TTAAGGTCCCTTGAAGAGGGAGG - Exonic
916600302 1:166286830-166286852 ACAACATCCCTCAAGGAGGTAGG - Intergenic
918158275 1:181872304-181872326 ACAAGGATCCTTCAGGAGGGTGG + Intergenic
918945326 1:191057442-191057464 ACCAGGGCCTGTGAGGAGGTGGG - Intergenic
922755964 1:228097131-228097153 AAAAAGGCCCTTGAAGAGGTTGG - Exonic
923628953 1:235636925-235636947 ACAAGGTGCCTAGAGGAGCAAGG - Intronic
924614668 1:245602846-245602868 ACAAGGGCCCTTGAGCTGGGAGG + Intronic
1063139285 10:3242184-3242206 AGAGGGTCCCTTGACGAGGGTGG - Intergenic
1063941107 10:11130354-11130376 ACAAGCTCCCCTGAGCAGGTAGG + Intronic
1064444573 10:15382124-15382146 AGATGGTCCCTTTATGAGGTTGG - Intergenic
1065243078 10:23727802-23727824 ACAAGGGCCCATCGGGAGGTGGG - Intronic
1069170764 10:65226056-65226078 ACGAGGTCCATTCAGGTGGTTGG - Intergenic
1070390581 10:75967072-75967094 ACAAGTTTCCTTGAGGTGTTGGG + Intronic
1072745683 10:97937692-97937714 ACAAGGGCCCTGCAGGAAGTCGG + Intronic
1072802435 10:98402257-98402279 CCCAGGTCACTTTAGGAGGTAGG + Intronic
1072991859 10:100203148-100203170 GTAAGGTCCCTTGAGGTGGATGG - Intronic
1073900537 10:108215518-108215540 ACAAGGGTCCTTCAGGAGGGTGG - Intergenic
1073968180 10:109015286-109015308 ACAAGGCCCCTTAATGAGGGAGG - Intergenic
1074775367 10:116764086-116764108 AGAGGGTCCCATGAGGAGGCAGG - Intergenic
1076391700 10:130108199-130108221 ACCTGGTTCCTGGAGGAGGTGGG - Intergenic
1077327990 11:1971903-1971925 AGAAGGGTCCCTGAGGAGGTGGG - Intronic
1077607559 11:3622267-3622289 ACAAGGTCATTTTATGAGGTGGG + Intergenic
1078455015 11:11468290-11468312 ACAACTTGCCTTGGGGAGGTGGG - Intronic
1078769448 11:14334761-14334783 GCAAGGACCTTTGAGAAGGTTGG - Intronic
1078854481 11:15195778-15195800 ACTAGCTCACTGGAGGAGGTTGG + Intronic
1081646038 11:44791412-44791434 ACCAGGTCCCCTGAAGAGGCTGG + Intronic
1084601567 11:70148892-70148914 AGAAGGTCCCGAGAGGAGCTGGG + Intronic
1084641767 11:70430506-70430528 ACAAGGTCCTGAGAGGAGGGAGG - Intronic
1087930748 11:103974633-103974655 ACCAGGGCCTGTGAGGAGGTGGG - Intronic
1088619858 11:111671020-111671042 ATCAGGTCCCTGGAGGAGCTGGG + Intronic
1090351720 11:126112270-126112292 TAAAGATCCCTTGAGAAGGTGGG - Intergenic
1090464545 11:126922587-126922609 ACAAGGTCCCTAGAAGTGGGAGG - Intronic
1202810969 11_KI270721v1_random:27083-27105 AGAAGGGTCCCTGAGGAGGTGGG - Intergenic
1094398151 12:30030964-30030986 ACTAGCTGCCTTGAGGAGTTTGG - Intergenic
1097032798 12:56101666-56101688 CCAAGTTCCCTTGAGGAGCTGGG + Exonic
1097410675 12:59248709-59248731 ACAAGGGCCTGTTAGGAGGTGGG + Intergenic
1097521319 12:60673583-60673605 ACAATTTCCCTTCAGGAGCTAGG - Intergenic
1100662417 12:96714566-96714588 ACAAGGTGTTTTGAGGAGGAAGG + Intronic
1101561656 12:105862914-105862936 ACAAGGTCCCTAGAAGAGGAAGG - Intergenic
1105928974 13:25034198-25034220 AGGAGGACCATTGAGGAGGTGGG + Intergenic
1106758511 13:32845567-32845589 AAAAGGTACCTTGAGGAAGTAGG + Intergenic
1107689042 13:42933690-42933712 ACATGGTTCCTTCAGGAGGCTGG - Intronic
1108458288 13:50638957-50638979 ACCAGATCCCTTGAAGGGGTAGG + Intronic
1108576392 13:51795179-51795201 AGAAGGTCCCTTGGGCAGGAGGG - Intronic
1108715514 13:53074580-53074602 ACAAGGTTCCTGGGGGAGGCTGG - Intergenic
1110414593 13:75238170-75238192 ACATCGTTCCTGGAGGAGGTTGG + Intergenic
1111906536 13:94262010-94262032 ACAAGGTCCCCTGCAGAGGGAGG + Intronic
1112064837 13:95781959-95781981 ACCAGGGCCCGTGGGGAGGTAGG - Intronic
1112922412 13:104630481-104630503 TCAAGTTCCATTGAGGAGATAGG + Intergenic
1113480523 13:110616435-110616457 AGGAGGTCCCTTGGGGAGGGAGG + Intronic
1115904183 14:38188799-38188821 ACAAAGTCCCCTGAGAAGTTTGG + Intergenic
1116010757 14:39348889-39348911 ACATGGCTCCTGGAGGAGGTGGG - Exonic
1119571136 14:75673795-75673817 ACAAGGATCCTTGGGGAGGAAGG - Intronic
1121279639 14:92689291-92689313 AAAAGCTTCCTGGAGGAGGTTGG - Intergenic
1121855211 14:97262867-97262889 CCATGGTTCCTTGTGGAGGTGGG + Intergenic
1124376324 15:29131433-29131455 AGAAGTGCCCTTGAGGAGTTTGG - Intronic
1125597325 15:40895192-40895214 ACCAGGCCCCTTCTGGAGGTGGG + Intronic
1126609152 15:50511272-50511294 ACAAGTTCGGTTGAGGATGTGGG + Exonic
1127898478 15:63323258-63323280 ATAAAGACCCTGGAGGAGGTGGG - Exonic
1129294896 15:74594819-74594841 AGGAGGCCCCTGGAGGAGGTGGG + Intronic
1129835758 15:78704422-78704444 AGAAGGTGCCATGAGGTGGTGGG + Intronic
1132712598 16:1276245-1276267 ACCAGGTCCCTTGAGTAGCCTGG - Intergenic
1138345527 16:56317894-56317916 ACAGGGTCTCTTGAGGAGGTAGG - Intronic
1139407957 16:66734562-66734584 ACAAGCTCCCATCAGGAGGCAGG + Intronic
1140271389 16:73469328-73469350 ACAAGGTTCCTTGAAGAGCTGGG + Intergenic
1141138716 16:81483368-81483390 AGAATGTGCCTTGAGGAGGGTGG + Intronic
1144958385 17:19031175-19031197 ACATGCTCCCTGGAGGAGGAGGG + Intronic
1144976773 17:19143349-19143371 ACATGCTCCCTGGAGGAGGAGGG - Intronic
1145177826 17:20717075-20717097 ACAAGTTCCTATGAGGTGGTAGG - Intergenic
1145916274 17:28575873-28575895 ACTTGGTCCCTTGTTGAGGTAGG + Intronic
1147610413 17:41798763-41798785 CCAGGGTTCCTTGAGGTGGTTGG - Intergenic
1148386732 17:47239461-47239483 ACAACATCCCTTAATGAGGTGGG - Intergenic
1149273651 17:55011864-55011886 CCAAGTGCCATTGAGGAGGTTGG + Intronic
1150280523 17:63927555-63927577 CCTAGGTCCCTGGTGGAGGTAGG + Intergenic
1150386387 17:64765011-64765033 ACAAGGTCAATTGATGAGTTGGG + Intergenic
1151384016 17:73744213-73744235 ACAAGGGCCCTTGAGGACTGTGG - Intergenic
1153125552 18:1786007-1786029 ACAAGGTCGATTGATGAGTTGGG + Intergenic
1155081585 18:22415723-22415745 ACACGGTTCCTGGAGGAGGTGGG + Exonic
1162898235 19:13778234-13778256 GCAAGGTCCCATATGGAGGTAGG - Exonic
1164524553 19:29003811-29003833 ACAAGGTCCCATCAGGGGTTCGG - Intergenic
930753583 2:54954472-54954494 ACAAGGACCCTTGGGTAGGAAGG - Intronic
933446425 2:82385789-82385811 ACAAGGTCCAGTGAGGAGTGGGG - Intergenic
935707530 2:105870020-105870042 ACAAGGACCCATGTGGTGGTCGG + Intronic
936646824 2:114382002-114382024 AAAAGGTCACTTGAGGGGTTGGG - Intergenic
941615478 2:167713886-167713908 ACATGGTTCCTGGAGGAGGTTGG + Intergenic
945107995 2:206334807-206334829 TCAAGGAACCCTGAGGAGGTTGG + Intergenic
946804918 2:223462525-223462547 ACAAGGTCCATTGATCAGTTAGG - Intergenic
947137736 2:226991983-226992005 ACAAGCTTCCTTGGGGTGGTAGG - Intronic
1169286133 20:4308728-4308750 CAAAGGTCCCTGGAGAAGGTTGG - Intergenic
1171449648 20:25226556-25226578 ACACTGTCCATGGAGGAGGTGGG - Exonic
1173198017 20:40931968-40931990 ACAAGGCCCCTAGAGTGGGTGGG + Intergenic
1174161195 20:48551679-48551701 ACAGGGTGTCTGGAGGAGGTGGG - Intergenic
1174724571 20:52847916-52847938 ACAATGTCCTTTGCAGAGGTGGG + Intergenic
1175202754 20:57289461-57289483 CCAGGCACCCTTGAGGAGGTTGG - Intergenic
1175667991 20:60876715-60876737 ACAAGCTCCCGGGAGGAGGGTGG + Intergenic
1175798339 20:61786132-61786154 ACAAGGACCCTTGAGAAAGTTGG + Intronic
1177933348 21:27313528-27313550 AGAATGTTCCTTGTGGAGGTGGG + Intergenic
1179712890 21:43273332-43273354 CCATGGGGCCTTGAGGAGGTGGG - Intergenic
1182774822 22:32823302-32823324 CCAAGGTCCCTGCAGGAGATGGG + Intronic
1183063295 22:35348215-35348237 CGAAGGTGCCTTGAGGAGGGAGG - Intergenic
1183303844 22:37071512-37071534 AAAAGCTTCCTGGAGGAGGTAGG - Intronic
1183898792 22:40990133-40990155 ACAAGCTCCATGGAGGATGTGGG - Intergenic
1184370361 22:44078036-44078058 ACCAGGTCCCTTGAGGACAGGGG + Intronic
1184473119 22:44707109-44707131 ACAGGGGCCCTTGAGGAGGGAGG - Intronic
1184680560 22:46070603-46070625 GCAAGGTGCCTGGAGGAGTTGGG - Intronic
950769546 3:15300721-15300743 ACAAGGTCCCTTGGGGTTGAGGG + Intronic
955271068 3:57499975-57499997 ACAAGGTCCCTTGAGGAGGTAGG + Intronic
955351770 3:58198857-58198879 ATTCAGTCCCTTGAGGAGGTGGG + Intronic
960039401 3:113134343-113134365 ACAAGGTTCCTTGAGGAGCTTGG - Intergenic
962249158 3:133824476-133824498 AGATGGTTCCTTCAGGAGGTGGG - Exonic
965322589 3:167267288-167267310 ACAAGGAACCTTCAGCAGGTAGG + Intronic
965423629 3:168494080-168494102 ACAAGGATGGTTGAGGAGGTGGG + Intergenic
966708898 3:182950035-182950057 ACAAGATTCCTTAAAGAGGTAGG - Intronic
969703733 4:8781198-8781220 ACAAGGTCCCAGGAGGAAGATGG - Intergenic
970708242 4:18831196-18831218 AGAAGGTCTCTGGAGGAGGAAGG - Intergenic
971378398 4:26074000-26074022 ACAGGGTCTCTTGATGAGGCAGG - Intergenic
974764855 4:66330587-66330609 ACAAGGTGTTTTGAGGAGGATGG + Intergenic
976648109 4:87406531-87406553 AAAAGGTCCCTACAGGAGTTAGG - Intergenic
978222728 4:106296241-106296263 ACAAGGTTATTTGAGGAGTTTGG + Intronic
979321813 4:119333457-119333479 TCAGGGTCCCATGAGGAGGGGGG - Intergenic
980258714 4:130419212-130419234 AAAAGGTCCCATGCTGAGGTCGG - Intergenic
980521107 4:133935419-133935441 AGAAGTGCCCCTGAGGAGGTAGG - Intergenic
983239789 4:165219063-165219085 TCAGGGTCCCATGAGGAGGGGGG - Intronic
983837386 4:172407680-172407702 ACAAGGTCCATTGAGTTTGTGGG + Intronic
987293053 5:16525923-16525945 CCCAGGTCCCTTGAAGAGGAAGG - Intronic
989439113 5:41449562-41449584 AAAAGGACCATAGAGGAGGTGGG + Intronic
990757112 5:59085847-59085869 AAAAGCTCCCTGGAGGAAGTGGG + Intronic
992073510 5:73170447-73170469 ATAAGGGCCCTTGTGGAGCTGGG + Intergenic
997411198 5:133692306-133692328 ACAAGGATCTTGGAGGAGGTTGG + Intergenic
997536332 5:134625040-134625062 ACAAAGTCCCAAGAGGAGCTTGG + Intronic
997826602 5:137112147-137112169 ACAAGCTTCCTGGAGAAGGTGGG - Intronic
997979340 5:138459283-138459305 AGAAGGTGCCCTGAGGGGGTGGG - Intergenic
998552849 5:143094028-143094050 AGAAGTCCCCATGAGGAGGTGGG - Intronic
1001642976 5:173258321-173258343 ACAAGGTCTCTTGAGGGAGGAGG - Intergenic
1001775269 5:174324137-174324159 ACAAGGCCACTTGTGGAGGCTGG + Intergenic
1001845157 5:174915836-174915858 AGAAGGTGCCATGAGGTGGTGGG - Intergenic
1002939021 6:1699658-1699680 ACAAGGTCCTTATAGGAGGAAGG - Intronic
1004477659 6:15988847-15988869 ACATGTTCCCTGGAGGATGTGGG + Intergenic
1004683814 6:17922312-17922334 GCAAGGTGACTTGAGGAGTTTGG + Intronic
1005810437 6:29511147-29511169 ATAAGGTCCCTGGCTGAGGTAGG - Intergenic
1005894372 6:30164918-30164940 ACGTGGTGCCTTGAGGAGGGAGG - Intronic
1006779956 6:36625715-36625737 GCAAGGGCCCTTTAAGAGGTGGG + Intergenic
1012529753 6:100221223-100221245 AGAAGGTGGCTTGAAGAGGTAGG - Intergenic
1013913028 6:115300652-115300674 ACAGGGGCCTTTCAGGAGGTAGG + Intergenic
1015227479 6:130873948-130873970 ACATCGTCCCTTGGGGAAGTGGG + Intronic
1015305972 6:131708830-131708852 ACATGGTTCCTGGAGGAGGTGGG + Exonic
1017190565 6:151648790-151648812 ACAAGGATCCTTCAGGAGGGTGG - Intergenic
1018938092 6:168287137-168287159 ACCTGGTTCCTGGAGGAGGTGGG + Intergenic
1022404971 7:30080402-30080424 AGAAGGTCCTTTGAGGGGCTTGG + Exonic
1024295204 7:47836262-47836284 ACAAGGTCCGTTTCCGAGGTGGG - Intronic
1026824515 7:73573129-73573151 ACCAGGTCCCTAGGGAAGGTGGG - Intronic
1028918688 7:96287624-96287646 ACATGGTCCCTGGAGAAGCTAGG - Intronic
1029169541 7:98620895-98620917 CCAAGTTGCCATGAGGAGGTGGG + Intronic
1029798931 7:102925541-102925563 TCAAGCTCCCTAGAGGTGGTGGG + Intronic
1030682389 7:112447752-112447774 CCACTGTCCCATGAGGAGGTGGG + Intronic
1031042420 7:116852105-116852127 ACAAGGTCATTTGAGTACGTAGG - Intronic
1033679005 7:143573983-143574005 ACATGGTTCCTGGAGGAGGTGGG - Exonic
1033692833 7:143755471-143755493 ACATGGTTCCTGGAGGAGGTGGG + Exonic
1033731578 7:144185669-144185691 ACATGGTTCCTGGAGGAGGTGGG - Exonic
1033740087 7:144267063-144267085 ACATGGTTCCTGGAGGAGGTGGG + Exonic
1034275179 7:149820872-149820894 ACAGGGTCCCTGGAGCAGGATGG + Intergenic
1035446306 7:158945293-158945315 AGCAGGTCCCTGGAGAAGGTGGG - Intronic
1036010634 8:4718087-4718109 ACCAGGTACTTTGAGGAAGTGGG - Intronic
1037762579 8:21751663-21751685 ACAAGGTCCCGCAAGGTGGTGGG + Intronic
1038225261 8:25650781-25650803 ACAATGTACCTTGAGGAACTAGG - Intergenic
1042258181 8:66828350-66828372 GAAAGCTCCTTTGAGGAGGTGGG - Intronic
1042512747 8:69628395-69628417 CCACGGTCCCTTGGTGAGGTGGG - Intronic
1044229173 8:89755997-89756019 ACAAGGTCCATTGATCAGTTAGG - Intergenic
1044474251 8:92607509-92607531 ACAAGCTACCTTGAGGCAGTAGG + Intergenic
1049204252 8:141356038-141356060 GCAAGGGCACTGGAGGAGGTGGG + Intergenic
1049804714 8:144533646-144533668 ACAGGGGCCCTTGGGAAGGTGGG + Intronic
1052365566 9:27608615-27608637 ACATGGTTCCTGGAGGAGGTGGG + Intergenic
1054913976 9:70479130-70479152 ACAAGCACCTTTGGGGAGGTTGG - Intergenic
1055554160 9:77458949-77458971 ACAGAGTGCCATGAGGAGGTGGG - Intronic
1059434275 9:114266855-114266877 ACCAGGACCCTTGTGGGGGTTGG + Intronic
1060228830 9:121812509-121812531 ACATTTTCCCTTGAGGGGGTAGG - Intergenic
1060593280 9:124832840-124832862 GCCAGGACCCCTGAGGAGGTGGG - Intergenic
1189705733 X:43756866-43756888 ACAAGGTGACTTCAGGATGTTGG - Intergenic
1193771467 X:85592938-85592960 ACAGGGGTCCTTGAGGAGGGCGG + Intergenic
1194773011 X:97927814-97927836 ACCAGGGCCCGTCAGGAGGTGGG + Intergenic
1194932234 X:99901806-99901828 ACAGGGGTCCTTGGGGAGGTAGG - Intergenic
1195700851 X:107704574-107704596 ACAGGGTCCAGTGTGGAGGTAGG + Intergenic
1195906721 X:109851536-109851558 ACAAGGGCCCTGGAGGAGATTGG - Intergenic
1199990740 X:152986412-152986434 ACAAGTGCCCCTGAGGAGGGCGG - Intergenic
1200033829 X:153315886-153315908 ACAAGTGCCCCTGAGGAGGGCGG - Intergenic
1201301432 Y:12508340-12508362 ACCAGGGCCTTTGAGGGGGTGGG - Intergenic