ID: 955271138

View in Genome Browser
Species Human (GRCh38)
Location 3:57500505-57500527
Sequence TAGTTAAAGAATAGGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 284}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955271138_955271142 10 Left 955271138 3:57500505-57500527 CCCTGTTCCCTATTCTTTAACTA 0: 1
1: 0
2: 0
3: 23
4: 284
Right 955271142 3:57500538-57500560 TTTATATTCTCTGAACACCCTGG 0: 1
1: 0
2: 1
3: 17
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955271138 Original CRISPR TAGTTAAAGAATAGGGAACA GGG (reversed) Intronic
900079115 1:842411-842433 GACTTAAAGAAAAGTGAACAGGG + Intergenic
902426107 1:16323494-16323516 TAACTAAAGAATAAGGGACAGGG + Intronic
903017368 1:20369819-20369841 TAGCTAAAGAGTTAGGAACATGG - Intergenic
903156834 1:21450893-21450915 TAGTTCAAAATGAGGGAACATGG + Intronic
903517529 1:23921909-23921931 AGGTTAAAGCAGAGGGAACATGG - Intergenic
904113003 1:28141399-28141421 TGGTTATAGAAAAGGGAACGGGG + Intergenic
905131173 1:35759215-35759237 TAGGGATAGAGTAGGGAACAAGG + Intronic
905417913 1:37817198-37817220 TAGTTAAAGAATGTTAAACACGG + Intronic
905968036 1:42115944-42115966 TAGTCAGAGCAGAGGGAACAAGG + Intergenic
907183221 1:52588930-52588952 TGGTTGAAGCATAGGGTACATGG + Intergenic
907367297 1:53972908-53972930 TAAGTAAAGAAAATGGAACAGGG + Intergenic
909218525 1:72924012-72924034 TAATGAAAGAATGGGGAGCAGGG - Intergenic
910259343 1:85280686-85280708 GAGTTACAGAATAAGGATCAGGG + Intergenic
910269233 1:85375414-85375436 TAGTTATAAAATGGGGTACATGG - Intronic
911958674 1:104270913-104270935 TGGATAAAGAATATGGAGCAAGG - Intergenic
912745076 1:112239364-112239386 CAGTTAGAGAATAAGGACCATGG + Intergenic
913601641 1:120426838-120426860 TAGTTCAAAATGAGGGAACATGG + Intergenic
913992773 1:143630184-143630206 TAGTTCAAAATGAGGGAACATGG - Intergenic
914085404 1:144449762-144449784 TAGTTCAAAATGAGGGAACATGG - Intronic
914191291 1:145413736-145413758 TAGTTCAAAATGAGGGAACATGG - Intergenic
914362831 1:146950419-146950441 TAGTTCAAAATGAGGGAACATGG + Intronic
914488840 1:148136692-148136714 TAGTTCAAAATGAGGGAACATGG - Intronic
914589223 1:149091740-149091762 TAGTTCAAAATGAGGGAACATGG - Intronic
917287524 1:173436711-173436733 TACTTAAGGAAAAGGGCACAGGG + Intergenic
918604615 1:186407621-186407643 TACTGAAAGAATAGGTTACAGGG - Intronic
919654477 1:200184056-200184078 TAATTAATGTATAGAGAACATGG - Intergenic
919865646 1:201780992-201781014 TAGCTAAAGAAAAGAGAAAAAGG - Exonic
922639969 1:227220128-227220150 GAATTAAAGAATGGGGTACAGGG - Intronic
922667995 1:227489094-227489116 TAGTTCCAGAATAGGGGATAGGG - Intergenic
923300807 1:232638856-232638878 TTGCTGAAGAATAGGGAGCAAGG - Intergenic
924196614 1:241614467-241614489 TTTTTAAAAAATAGGGTACACGG + Intronic
924759261 1:246968856-246968878 CAGCTAAAGCACAGGGAACAGGG + Intronic
1064116219 10:12579632-12579654 TAGGGAAAGAAAAGGGTACAGGG - Intronic
1064215956 10:13400818-13400840 TTGATAAAGAAAAGGGAAAAGGG + Intergenic
1064714293 10:18160749-18160771 AAGTGACAGAATAGGGAAGAGGG - Intronic
1066751018 10:38657294-38657316 TAGTCAAAGAATAAGTCACAAGG + Intergenic
1066966029 10:42265798-42265820 TAGTCAAAGAATAAGTCACAAGG - Intergenic
1067953436 10:50766272-50766294 TTGTTAAAGCATCTGGAACATGG + Intronic
1068505853 10:57898335-57898357 TAGTAAAGGAATGGGCAACATGG + Intergenic
1069185935 10:65422903-65422925 TGGTCAGAGAACAGGGAACAGGG + Intergenic
1070469958 10:76768864-76768886 TAGTTAAAGAAATGGGACAAAGG + Intergenic
1071950071 10:90693142-90693164 TAGTAAAGGAACAGGCAACATGG - Intergenic
1075145490 10:119879444-119879466 TAGGCAAAAAATAGGGAAGATGG + Intronic
1075905756 10:126080638-126080660 TAGTTAAATATTAGAGAAAAAGG - Intronic
1075978301 10:126715905-126715927 AAGTAAGAGAATAGGCAACATGG + Intergenic
1078197279 11:9146470-9146492 TATTTACAGAAGAGGGAAGAGGG - Intronic
1080960743 11:37156777-37156799 TAGTTAATAAACAGGGAACTAGG + Intergenic
1081165931 11:39809307-39809329 TAGTAAAAGAAGAGAGAAGAAGG + Intergenic
1082059240 11:47846516-47846538 TGGTAAAAGAAGAGAGAACAAGG - Intronic
1084975155 11:72793009-72793031 TAGGAGAAGAATTGGGAACAGGG + Exonic
1085553256 11:77395089-77395111 TAGTTGAAGCATAGGGAAATTGG - Intronic
1086161591 11:83727721-83727743 AAGTTTAAGACTAGGGAACATGG + Intronic
1086572254 11:88298771-88298793 CAGTCAAAGAATAAAGAACATGG + Intronic
1087048222 11:93862139-93862161 TGGTTATAGAAAAGGGAAAAGGG + Intergenic
1087567493 11:99880048-99880070 TAGTTCAAGAATAGTGAACGGGG - Intronic
1087942903 11:104122276-104122298 TAGTAAAGGAATAAGCAACATGG + Intronic
1088102697 11:106172529-106172551 TTTTTAAAGCAAAGGGAACAAGG - Intergenic
1091031854 11:132197087-132197109 TAGTTAAAGAACAGGGCTGATGG + Intronic
1092517351 12:9228704-9228726 TAGTAAAAGAAAAGGGAGAAAGG + Intergenic
1093762165 12:22922895-22922917 TAGCTAGAGAAAAGGGAAGAGGG - Intergenic
1094327114 12:29252370-29252392 TACTGAAGGAAAAGGGAACATGG + Intronic
1098528227 12:71511299-71511321 TAGATAAAGAATAAATAACAAGG - Intronic
1100152958 12:91763483-91763505 TATTTAAACAATTGAGAACATGG + Intergenic
1101125262 12:101627201-101627223 AATTTAAAGAACAGGGAAAAGGG - Intronic
1104515364 12:129420236-129420258 TACTTAGAGAATATGAAACACGG - Intronic
1105395338 13:20028307-20028329 TAGTTTAAGAAAAGCCAACAAGG - Intronic
1105955049 13:25273886-25273908 CAGTTATAGAATATGTAACATGG - Intronic
1106524840 13:30531303-30531325 TAATGAAAGAAAAGAGAACAAGG + Intronic
1107181137 13:37460794-37460816 TACTTAAAAAATAGTTAACATGG - Intergenic
1113011990 13:105778691-105778713 TAATTAAAGAATTGGGGACAAGG - Intergenic
1114461983 14:22892319-22892341 CAGAGAAAGAAGAGGGAACAAGG + Intergenic
1114846671 14:26331251-26331273 TAGTCAAGGAATAAGGAACAGGG - Intergenic
1115030008 14:28784050-28784072 CAGTTGGAGAATAGGGAAAAGGG + Intronic
1115886569 14:37978302-37978324 TAGGAAAAGAATAAGGAAAAGGG + Intronic
1116046820 14:39753660-39753682 TAATTGAAAAATAGGAAACAGGG + Intergenic
1116346496 14:43801851-43801873 CAGTAAAGGAATAGGCAACATGG + Intergenic
1118942453 14:70350060-70350082 TGGTTATAGAAAAGGGAAAAGGG - Intronic
1120717267 14:87853293-87853315 TAGAGAAAGAAAAGGGAAAATGG + Intronic
1121872155 14:97418328-97418350 TATTTACAGAAAAGGGCACAGGG + Intergenic
1121898289 14:97669446-97669468 TAGTTAAAGGATGAGGAAAATGG + Intergenic
1126221880 15:46223587-46223609 TTGTTAAAGAAAAAGGGACAGGG - Intergenic
1126684209 15:51233191-51233213 TAGAAAAAGAATAGGGAAGGAGG - Intronic
1127981030 15:64035200-64035222 TAATCAAAGGATAGGAAACAAGG + Intronic
1128956809 15:71955427-71955449 TAGTTTAAGAACAGACAACATGG - Intronic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1130835336 15:87644668-87644690 TGGCTAAACAACAGGGAACAAGG - Intergenic
1130917453 15:88317049-88317071 TAGTCAAAGAAAAGGGCACCAGG + Intergenic
1132270789 15:100522516-100522538 AAGTTCAAGAACAGGCAACACGG - Intronic
1134168528 16:11949746-11949768 GTGTTAAAGAAGAGGGAGCAAGG - Intronic
1136054218 16:27676087-27676109 TTGTTAAGGAAAAGGGAACCAGG - Intronic
1137494035 16:48955620-48955642 TGGTTAATGAATAGGGAAATGGG + Intergenic
1137745174 16:50815374-50815396 CAGGTAATGAATAGGGAGCACGG + Intergenic
1139371622 16:66472717-66472739 TAAATAAAGAATAGGAAACTGGG + Intronic
1202994682 16_KI270728v1_random:97456-97478 TAGTCAAAGAATAAGTCACAAGG + Intergenic
1203021369 16_KI270728v1_random:409798-409820 TAGTCAAAGAATAAGTCACAAGG + Intergenic
1143401305 17:6645707-6645729 TAATAAAATAATAGGAAACAAGG + Intronic
1147701514 17:42398681-42398703 TAGTGAAAGAGTAGGAATCAGGG - Intergenic
1148274036 17:46287682-46287704 TAGTTAACGGGTAGGGAACGTGG + Intronic
1148946852 17:51270166-51270188 TTCTTAAAGAAAAGGGAAGAAGG - Intronic
1149105013 17:52952915-52952937 TAATGAAATAATAGTGAACATGG - Intergenic
1150409020 17:64926895-64926917 TAATTAACGGGTAGGGAACATGG - Intergenic
1150528068 17:65944962-65944984 AATCTAAAGAAAAGGGAACATGG + Intronic
1150965552 17:69963937-69963959 TTGTTAAAGAGTAAGGAAGATGG - Intergenic
1150984546 17:70180941-70180963 TAGTTAAAGAAAAAAGAGCAAGG - Intergenic
1154180104 18:12129444-12129466 TAGTTAAAAAACAGGTAATAGGG + Intronic
1155448907 18:25943103-25943125 TTGATAAAGAAAAGGGAAGATGG - Intergenic
1155630913 18:27891193-27891215 TAGTTAAAGGAAAGGGGAAATGG + Intergenic
1156805940 18:41181733-41181755 TATTTTAAGAAAAGGCAACATGG - Intergenic
1157920628 18:51709762-51709784 TGGTTATAGAAAAGGGAAAAGGG - Intergenic
1158045927 18:53155303-53155325 TTGATAAAGACTAGGGAAAATGG + Intronic
1158130360 18:54146249-54146271 TAGTTCAAGAATATACAACAAGG - Intergenic
1158175804 18:54654587-54654609 AAGGTAAAGAATTGGGAAGAGGG - Intergenic
1160399516 18:78599789-78599811 AAGTCAAAGAATGGGGAACAAGG + Intergenic
1161873041 19:6885423-6885445 TTGATAAAGAAAAGGGAACATGG - Intergenic
1163050077 19:14676419-14676441 GTGATAAAGAAAAGGGAACATGG + Intronic
1164623751 19:29713527-29713549 TTGTTAAAGAAAAGGGTACTTGG - Intronic
1166096697 19:40543975-40543997 AACTTAATGAATGGGGAACAGGG - Intronic
1166626136 19:44357628-44357650 TAGTTAAAGCAGAGGAAACGTGG - Intronic
925793149 2:7513491-7513513 TCGTTAAAAAATAGGAAAGAGGG + Intergenic
926426406 2:12742583-12742605 TACTTAAAAAATAGGGGAGAGGG - Exonic
927291130 2:21405991-21406013 TTGTCAAAGAAGGGGGAACAGGG + Intergenic
927309134 2:21608567-21608589 AATATTAAGAATAGGGAACACGG - Intergenic
930822029 2:55656071-55656093 TAATAATAGAATAGGGAATATGG + Intronic
931074947 2:58700353-58700375 TAGGTAAAGAATGGGGGACATGG - Intergenic
933167494 2:79092433-79092455 TGGTTATAGAAAAGGGAAAAGGG + Intergenic
933442775 2:82334439-82334461 TAGGTACAGTATGGGGAACAGGG + Intergenic
934314013 2:91899452-91899474 TAGTCAAAGAATAAGTCACAAGG + Intergenic
935352633 2:102166749-102166771 TTGTTACAGAAGAGGAAACAGGG - Intronic
936100778 2:109577294-109577316 TAGTTAAAAAATAGAGAACTCGG + Intronic
937488668 2:122342328-122342350 TAGGGAAATAATAGGCAACAGGG - Intergenic
938547305 2:132346529-132346551 TAGTTAAAGCAGAGGAAACGTGG + Intergenic
939082662 2:137681481-137681503 TAGATAGAGACTAGGGAACTGGG + Intergenic
940382274 2:153029154-153029176 TAGCTAAAGAATATCCAACACGG - Intergenic
941964737 2:171289855-171289877 TAATTAAAAAGTAGGGAAAAAGG + Intergenic
942837012 2:180312610-180312632 TAGTGAAGGAAAAGGGAGCAGGG + Intergenic
944310657 2:198229889-198229911 TAGTTCAATAATATGGAATATGG + Intronic
944967879 2:204956325-204956347 TAGTTAAATAATATTGAATATGG + Intronic
945364690 2:208937531-208937553 ATGTTGAAGAATAGGAAACATGG - Intergenic
945883504 2:215350868-215350890 AAGTTAAAGACTTGGGAAGAGGG - Intergenic
945928183 2:215827910-215827932 GAGTTCAAGACTAGGCAACATGG - Intergenic
946144028 2:217715088-217715110 TAATTAAAGAATAGGAAAATTGG - Intronic
946658475 2:221974778-221974800 TAGTTAAAAACTAGGGAAGGAGG + Intergenic
947056125 2:226106255-226106277 TACTTAAAAAATGAGGAACATGG + Intergenic
947158885 2:227192247-227192269 TAGTTATAGAATTGTGAAGAAGG + Intronic
1169597339 20:7215248-7215270 GAGTGAAAGAATATGGAACAAGG - Intergenic
1169688417 20:8303214-8303236 TATACAAAGAATAGGTAACAAGG - Intronic
1171876176 20:30579282-30579304 TAGTTAAAGCAGAGGAAACGTGG + Intergenic
1173912876 20:46683382-46683404 TGGTAAAAGAAAAGGGAAGATGG - Intronic
1178213814 21:30569783-30569805 TAATTAATTAATAGAGAACAAGG - Intergenic
1179111877 21:38454139-38454161 TAGATAAAAAATAAGGAAAAGGG - Intronic
1180540766 22:16445338-16445360 TAGTCAAAGAATAAGTCACAAGG + Intergenic
949663892 3:6314309-6314331 GAGTTAAAGAATATAGAACAAGG - Intergenic
950000492 3:9652451-9652473 TGGCTAAAGAATGGGGAAGAGGG + Intronic
953255772 3:41289078-41289100 TAGAAAAAGAATAGGGAAAAAGG - Intronic
955271138 3:57500505-57500527 TAGTTAAAGAATAGGGAACAGGG - Intronic
955676013 3:61449657-61449679 TAGTGAAGGAAAAGGAAACATGG + Intergenic
955929948 3:64046511-64046533 TAGTTACAGAGAGGGGAACATGG - Intergenic
956078821 3:65535497-65535519 AAGAAAAAGAACAGGGAACAAGG + Intronic
956706276 3:72001881-72001903 TGGTAAAGGAATAGGCAACATGG + Intergenic
957149568 3:76468578-76468600 TAGTTAAATAATAAGGACAAAGG - Intronic
957775392 3:84751998-84752020 TAGATAAGGAGTAGGGAGCAGGG - Intergenic
958037748 3:88190161-88190183 CAGTAAAGGAATAGGCAACATGG + Intergenic
958192766 3:90204639-90204661 TGGTTAAAGCATAGTGAGCAAGG - Intergenic
958527061 3:95275439-95275461 TAGTTGAATATTAGGCAACATGG + Intergenic
958655630 3:96999259-96999281 TATTTAAAGCCTAGGGAACTGGG - Intronic
958658908 3:97040792-97040814 TAGTAAAAGAAGAGGGCAAATGG - Intronic
959013596 3:101108310-101108332 TATTTAAAGAATATGAAAAATGG + Intergenic
959880294 3:111437561-111437583 TATTAACAGAATAGGGAATAGGG - Intronic
960538121 3:118835216-118835238 TATTTATAAAATTGGGAACAAGG - Intergenic
961414149 3:126745195-126745217 TTATTAAAGAAGAGGGAAGAGGG + Intronic
961796208 3:129410911-129410933 TAATTAAAGAATAGGGAGAGGGG + Intronic
961901783 3:130220058-130220080 TAGTTTAAGAAAAGGGCTCAAGG + Intergenic
963098047 3:141566766-141566788 TAGATAGAGAATAGAGAAGATGG + Intronic
963981832 3:151546712-151546734 TACTTATAGAATGGGGAAGAGGG - Intergenic
965991599 3:174825659-174825681 TGTTTAAGGAATAGGGAAGAAGG - Intronic
967550057 3:190782222-190782244 TATTTAAAAAATAGGAAATAAGG - Intergenic
968023857 3:195420976-195420998 TAGTGATAGAATAAGGAATAGGG + Intronic
969925583 4:10582925-10582947 CAGGTAAAAAATAGGGTACAAGG - Intronic
971613877 4:28762422-28762444 GTGTTAGGGAATAGGGAACAAGG - Intergenic
972453572 4:39229941-39229963 TGGGTAAAGATGAGGGAACACGG - Intronic
972683331 4:41327996-41328018 TAGTAAAGGAACAGGTAACATGG - Intergenic
972771850 4:42204655-42204677 TAGGCAAAGAATAAGGAAAAAGG - Intergenic
973169139 4:47117232-47117254 TAGTTGAATTATAGGGATCAAGG + Intronic
973262051 4:48175095-48175117 TAGCTATAAAATAAGGAACAGGG + Intronic
973876580 4:55225960-55225982 TAGTTGAAGAATGGGGAGAAGGG - Intergenic
974701696 4:65457457-65457479 TAGTGGAAGAATAGGGGAAAAGG - Intronic
975681792 4:76884811-76884833 TTGTAAAAGAAGAGGAAACAAGG + Intergenic
976120000 4:81769565-81769587 TAGCTAAAGAACAAGGAACCTGG - Intronic
976826690 4:89268435-89268457 TGGTTCAAGCACAGGGAACAAGG + Intronic
977366474 4:96075284-96075306 AAGTTAAAGATTTGGGAATAAGG - Intergenic
977946225 4:102917535-102917557 TAGTCAAAGAATAAGTCACAAGG + Intronic
978275817 4:106948401-106948423 TAATTAAAGAATAGGGGAATGGG - Intronic
979117471 4:116844710-116844732 TAGTTAAAGACAAGGAAACGTGG - Intergenic
980949590 4:139360357-139360379 TTCTTAAAGAATAGTTAACATGG - Intronic
980959584 4:139461627-139461649 CAGTGAAAGAATAGGGAAAGAGG + Intronic
981215310 4:142158740-142158762 TATCTAAAGAAAAGGAAACAAGG + Intronic
981401729 4:144321667-144321689 TAGTTAAAGAAGAGCCAAGACGG + Intergenic
982290591 4:153778286-153778308 TAATTAGAGAATAGGGAATCAGG + Intergenic
983280320 4:165672822-165672844 TTCTTAAAGAATAGGGCCCAAGG - Intergenic
983321939 4:166205891-166205913 TTGTAAAGGAACAGGGAACAAGG - Intergenic
983781285 4:171673635-171673657 TAATTAAAGAAAAGGCAAGATGG + Intergenic
984997069 4:185444604-185444626 TTGATAGAGAATGGGGAACAAGG - Intronic
985275075 4:188230233-188230255 CAGTGAATGAATAGAGAACAAGG - Intergenic
986088029 5:4472284-4472306 TAGTTAAACAATAAGCAATAGGG + Intergenic
987659985 5:20860024-20860046 GAGTTAAAGAAGAGAGATCAAGG - Intergenic
987887572 5:23831368-23831390 TGGTGAAAAGATAGGGAACAAGG - Intergenic
988056873 5:26108578-26108600 AAGTAAAGGAAGAGGGAACAGGG - Intergenic
988266404 5:28956532-28956554 TAGTGAAATAATTGGGAACAGGG - Intergenic
988673839 5:33410723-33410745 TAGATAAAGACTAAGGAACAAGG - Intergenic
988763658 5:34345630-34345652 GAGTTAAAGAAGAGAGATCAAGG + Intergenic
993942287 5:94074002-94074024 TAGGTTAAGAATCAGGAACAAGG - Intronic
994439637 5:99785711-99785733 TAGTAAAAGATTAGGTAAAAAGG - Intergenic
995401109 5:111742723-111742745 TAATTCAAGCATAGTGAACACGG + Intronic
997441174 5:133909591-133909613 TAGTGAATGAATAGGAGACAGGG + Intergenic
997780041 5:136647913-136647935 TATTTAAAGAATAGAGAGAAAGG - Intergenic
999601195 5:153267193-153267215 AAGAGAAAGAATAGGGAAGAAGG - Intergenic
1001810985 5:174628034-174628056 TAGTTGACAAATAGGAAACAAGG - Intergenic
1004862347 6:19817736-19817758 TTGTTAAAGAGTAGGGATCATGG - Intergenic
1005200855 6:23342617-23342639 TAGGTACAGGATAGGGGACATGG - Intergenic
1006761210 6:36463226-36463248 TAGATACAGAAAAGGGAAAAAGG - Intronic
1008287290 6:49669456-49669478 AAATTAAAGAATAGGACACATGG - Intergenic
1008287292 6:49669492-49669514 AAATTAAAGAATAGGACACATGG - Intergenic
1008287294 6:49669527-49669549 AAATTAAAGAATAGGACACATGG - Intergenic
1010685542 6:78850761-78850783 CAGCTAAAGAAGAGGGCACATGG + Intergenic
1011252425 6:85386032-85386054 AAGTTAAAGTAAAGGGAAAAAGG + Intergenic
1011945711 6:92899973-92899995 TAGTAAAAGAAAAAGGAACTAGG - Intergenic
1012373514 6:98533677-98533699 TACATAAAGAACAGGGACCATGG + Intergenic
1012853692 6:104476207-104476229 CAGTAAAATATTAGGGAACATGG + Intergenic
1013273781 6:108564313-108564335 TAGTGGAAGAAGAGGGAAAAGGG + Intronic
1013731021 6:113167657-113167679 AAGATAAACAATAGGGAAAATGG - Intergenic
1014949671 6:127540092-127540114 TTGTAAAAGAAAGGGGAACATGG - Intronic
1016954312 6:149611697-149611719 CACTTAAAGAATAAGGAATATGG + Intronic
1017183746 6:151578996-151579018 TAGTTAAAGAATAAGCTGCATGG - Intronic
1017379418 6:153811212-153811234 TAGTAAAAGAATAGAGACCATGG - Intergenic
1017945809 6:159095546-159095568 TTGTCAAAGAACAGGGAAGAAGG + Intergenic
1019030554 6:169006772-169006794 TGGTTACAGAATATGGATCATGG - Intergenic
1019775053 7:2907389-2907411 CACTTAAAGAATAGGTAACATGG - Intronic
1019897814 7:3996701-3996723 TAATAAAAGAATATGGAATATGG - Intronic
1020468152 7:8504582-8504604 TAGTAAATGAATGGAGAACAAGG + Intronic
1021513136 7:21455874-21455896 TACTTAAAGAACACGGAAAATGG - Intronic
1022003955 7:26250190-26250212 TGGTTATAGAAAAGGGAAAAGGG - Intergenic
1022559274 7:31332578-31332600 GAGTTGAAGAAGAGTGAACAAGG + Intergenic
1022850497 7:34256873-34256895 GAGTCAGAGAAGAGGGAACAAGG - Intergenic
1024437264 7:49373431-49373453 TAATTAAAGAATACGTCACAAGG - Intergenic
1024687471 7:51762313-51762335 TGGATAAAGAAAAGAGAACATGG - Intergenic
1024757256 7:52549596-52549618 TAGCCAAAGAACAGGGAAGAGGG - Intergenic
1025796467 7:64742247-64742269 AAGTCAGAGAATAGGTAACATGG + Intergenic
1026251946 7:68679042-68679064 TAGTCAAAGAATAAAGATCAAGG + Intergenic
1027397597 7:77772228-77772250 TAGTTAAATAATAGAGATTAAGG + Intronic
1027867624 7:83667503-83667525 TATTTAAAGAATAGGGCAAATGG - Intergenic
1028001723 7:85506792-85506814 AAGTGAAAAAATAGGGAAGATGG + Intergenic
1028840475 7:95424117-95424139 TAGTTATAGAGTAGTGAGCAGGG + Intronic
1028898785 7:96072357-96072379 CTGTTAAAGAAAAGGGAAAAAGG - Intronic
1031694051 7:124826994-124827016 TAGTGAAAAATTAAGGAACAGGG - Intronic
1033898270 7:146102815-146102837 AAGTTAAAGAATGGTGAAGAGGG - Intergenic
1034703227 7:153115505-153115527 TAGTTAGAGAAGAGGGTACCTGG + Intergenic
1035526516 8:317272-317294 GACTTAAAGAAAAGTGAACAGGG - Intergenic
1035974246 8:4289388-4289410 TAGTTAAAGTAGAGGGAGCCAGG + Intronic
1037207810 8:16345071-16345093 TATGTAAAGAATATGGCACAAGG - Intronic
1037486059 8:19347819-19347841 TGGTTAAAGAATATGTCACAGGG - Intronic
1038226519 8:25663235-25663257 TAGCTTAGGAATAGGGAACATGG + Intergenic
1044667468 8:94644807-94644829 TCGTTAAAGAAAAGGGAAAATGG + Intronic
1044902539 8:96963028-96963050 TAGTTAAAAAATTGGAAAGATGG - Intronic
1045251407 8:100486100-100486122 TAGGAAAAGAAAAGGGAACCCGG + Intergenic
1047209562 8:122830452-122830474 TGGTTATAGAAAAGGGAAAAGGG + Intronic
1050748446 9:8906309-8906331 TTGTAAAAGAATTTGGAACAAGG - Intronic
1051425525 9:16927980-16928002 GAGTTAATGAATACGGAAAAAGG + Intergenic
1051812696 9:21068155-21068177 TAAGAACAGAATAGGGAACAGGG + Intergenic
1052031342 9:23632486-23632508 CAATAAAAGAATAGGGAAGAGGG - Intergenic
1052500024 9:29276830-29276852 TATACAAAGAATAGAGAACATGG + Intergenic
1053260386 9:36658312-36658334 TAGATAAAGAAAAATGAACAGGG - Intronic
1053347910 9:37391641-37391663 TAGTTCAAGACTGGGCAACATGG - Intergenic
1053807800 9:41821213-41821235 TAGTTAAAGAATACAAGACAGGG - Intergenic
1054622792 9:67366215-67366237 TAGTTAAAGAATACAAGACAGGG + Intergenic
1055510733 9:76993449-76993471 CAGTAAAAGAATAGGCAACATGG - Intergenic
1056237508 9:84609836-84609858 TATTTATGGAAAAGGGAACATGG + Intergenic
1058609526 9:106760282-106760304 TAGTTAGAGTATAGGGTTCAGGG - Intergenic
1060004049 9:119983809-119983831 GAGGTAAAGAATTGGGAAGAGGG + Intergenic
1060675880 9:125514154-125514176 TAGGTGAAGAAGAGGGAAGAGGG - Intronic
1062258403 9:135642964-135642986 GAGTTCAAGACTAGGCAACATGG + Intergenic
1186230393 X:7447367-7447389 TAGTTATATAATGGGGAAGAGGG + Intergenic
1186990895 X:15066316-15066338 AAGTTAAAGAATAGGCAAACTGG + Intergenic
1187073579 X:15912248-15912270 TAGTGATAGTAGAGGGAACAGGG + Intergenic
1188316633 X:28682573-28682595 TACCTAAAGAATTGTGAACAGGG - Intronic
1188610824 X:32095220-32095242 TAGTGAAAGAATAGAGGAAATGG - Intronic
1188849669 X:35116233-35116255 TAGTAAAGGAATGGGCAACATGG + Intergenic
1188997837 X:36907177-36907199 TAGTTAAAGAATAAGGAGTAAGG + Intergenic
1189078428 X:37942801-37942823 TAGCTAAAGAACTGAGAACATGG - Intronic
1189953887 X:46259091-46259113 TTGATAAAGAAAAGGGAAGATGG - Intergenic
1191151482 X:57224410-57224432 TGGTTAGAGAAAAGGGAAAAGGG - Intergenic
1191607586 X:63079288-63079310 TACTTAAAGAACATGGAAAATGG + Intergenic
1191734440 X:64374607-64374629 TAGTTAAAGAGAAGTGAAAAAGG + Intronic
1191743033 X:64455927-64455949 TAGAGTAAGAAGAGGGAACAAGG + Intergenic
1191990767 X:67033250-67033272 AAGTTAAAAAATAAGGACCAAGG - Intergenic
1192566346 X:72167025-72167047 TTGTTAAAAACTAGGGAACGAGG + Intergenic
1193175326 X:78385583-78385605 TAGAAAAAGAATAGAAAACAAGG + Intergenic
1193347380 X:80420237-80420259 AAGTTAAAAAATAGTGAAGAGGG - Intronic
1193582093 X:83278309-83278331 TGGTTAAAGGATTGGGAAAAAGG + Intergenic
1194295623 X:92123022-92123044 TAGTTAAAGCATAGGGTAAATGG - Intronic
1194765436 X:97842775-97842797 CAGTAAGAGAAAAGGGAACATGG - Intergenic
1195574737 X:106437233-106437255 CAGTTGAAGAAAAGGGAAAAAGG - Intergenic
1195696179 X:107669329-107669351 TAGCTAAAGCATAAGGAGCAAGG - Intergenic
1196204221 X:112920525-112920547 TAGTAAAAGTATATGCAACAAGG + Intergenic
1197014350 X:121605417-121605439 AAGTTACAGAGTAGGGAAAATGG + Intergenic
1197142549 X:123132481-123132503 TGGTTATAGAAAAGGGAAAAGGG - Intergenic
1197306357 X:124846336-124846358 TAATAAAAGGATAAGGAACAAGG + Intronic
1198675921 X:139130016-139130038 AACTGAATGAATAGGGAACAAGG + Intronic
1200613125 Y:5347535-5347557 TAGTTAAAGCATAGGGTAAATGG - Intronic